AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 283: F1020-F1029, 2002. First published July 2, 2002; doi:10.1152/ajprenal.00118.2002
0363-6127/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/5/F1020    most recent
00118.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chakravarty, D.
Right arrow Articles by Kültz, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chakravarty, D.
Right arrow Articles by Kültz, D.
Vol. 283, Issue 5, F1020-F1029, November 2002

Three GADD45 isoforms contribute to hypertonic stress phenotype of murine renal inner medullary cells

Devulapalli Chakravarty1, Qi Cai2, Joan D. Ferraris2, Luis Michea2, Maurice B. Burg2, and Dietmar Kültz1,3

1 The Whitney Laboratory, University of Florida, St. Augustine, Florida 32080; 2 Laboratory of Kidney and Electrolyte Metabolism, National Institutes of Health, Bethesda, Maryland 20892-1603; and 3 Department of Animal Sciences, University of California, Davis, California 95616-8521


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Mammalian renal inner medullary (IM) cells routinely face and resist hypertonic stress. Such stress causes DNA damage to which IM cells respond with cell cycle arrest. We report that three growth arrest and DNA damage-inducible 45 (GADD45) isoforms (GADD45alpha , GADDD45beta , and GADD45gamma ) are induced by acute hypertonicity in murine IM cells. Maximum induction occurs 16-18 h after the onset of hypertonicity. GADD45gamma is induced more strongly (7-fold) than GADD45beta (3-fold) and GADD45alpha (2-fold). GADD45alpha and GADD45beta protein induction is more pronounced and stable compared with the corresponding transcripts. Hypertonicity of various forms (NaCl, KCl, sorbitol, or mannitol) always induces GADD45 transcripts, whereas nonhypertonic hyperosmolality (urea) has no effect. Actinomycin D does not prevent hypertonic GADD45 induction, indicating that mRNA stabilization is the mechanism that mediates this induction. GADD45 induction patterns in IM cells exposed to 10 different stresses suggest isoform specificity, but similar functions, of individual isoforms during hypertonicity, heat shock, and heavy metal stress, when GADD45gamma induction is strongest (17-fold). These data associate all known GADD45 isoforms with the hypertonicity phenotype of renal IM cells.

cell cycle; hypertonicity; nephrotoxins; kidney inner medulla


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

CELLS OF THE MAMMALIAN RENAL inner medulla are routinely subjected to a wide range of osmolality as part of their function in renal urinary concentration. They express a phenotype that allows them to counteract the threat posed by hypertonicity and other stresses prevalent in the renal inner medulla. Because hypertonic stress represents such an immense threat to most human cells, it is critical to understand the molecular basis of the phenomenon and to study the cellular mechanisms by which cells minimize its consequences. Hypertonic stress damages proteins, leading to their unfolding and malfunction (35). This is compensated for by compatible and counteracting organic osmolytes, which are accumulated during hypertonic stress in many cell types, including renal inner medullary (IM) cells (reviewed in Refs. 4, 14, and 31). DNA is also threatened by hypertonic stress, which increases the amount of DNA double-strand breaks (19) and chromosomal aberrations (13).

Our laboratory previously provided evidence that hypertonicity leads to activation of a complex network of intracellular signaling pathways, including MAPK pathways (20), the p53 pathway (8), and DNA-dependent protein kinases (19). Previous evidence also indicates that the growth arrest and DNA damage-inducible 45 (GADD45) family of genes is part of such networks (20, 33), but little is known about the osmotic regulation of the three mammalian GADD45 isoforms, prompting us to analyze this aspect of the hypertonic stress phenotype of IM cells.

The first GADD45 gene, later designated GADD45alpha , was cloned on the basis of its induction by ionizing radiation-induced DNA damage and cell cycle arrest (12). Subsequently, two other GADD45 genes have been identified and designated GADD45beta and GADD45gamma (2, 18, 24, 32, 33, 37). GADD45 proteins are necessary for maintaining DNA integrity and genome stability in mammalian cells (16), and their induction is often a consequence of DNA damage. They are involved in many processes during cellular adaptation to a diverse array of cellular stresses, including apoptosis, DNA repair, chromatin regulation, and cell cycle delay (5, 28). Understanding the osmotic regulation of GADD45 should help in the identification of the cell functions that are regulated by these proteins during hypertonic stress.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Culture of murine IM collecting duct 3 cells. Murine IM collecting duct 3 (mIMCD-3) cells of passage 15 were used for all experiments (25). Monolayers were grown to 90% confluency in isosmotic medium consisting of 45% Ham's F-12, 45% DMEM, 10% fetal bovine serum, and 1% of a saline solution containing 10 mU/ml penicillin and 10 µg/ml streptomycin (Invitrogen-Life Technologies). The final osmolality of the medium was 300 ± 5 mosmol/kgH2O, as verified with a vapor pressure osmometer (model 5500, Wescor). Hypertonic media were prepared by addition of the appropriate solute to the isosmotic medium to achieve the desired osmolality. UV irradiation was done in a sterile tissue culture hood by epi-illumination of cell monolayers with a UV-C and UV-B probe (UVP, San Diego, CA). The distance of the lamp to the cell monolayers and the time interval of UV exposure were calibrated to achieve a dose of 500 J/m2. From the beginning of UV irradiation, cells were given a period of 18 h to respond to the UV pulse before they were analyzed, to be consistent with the response period allowed for other stresses and previously published protocols for stressing cells with UV. Chemical toxicants were added to the medium in the concentrations indicated, and cells were exposed to these concentrations for a period of 18 h. Cells were incubated at 37°C and 5% CO2 during all experiments except during heat shock, when they were incubated at 42°C.

Passage 2 mouse IM epithelial cells. Passage 2 mouse IM epithelial (p2mIME) cells were prepared and maintained as described previously (9, 38). Briefly, male mice (4-8 wk old; B6SJL) were killed by cervical dislocation, shaved, and cleaned with an antiseptic solution containing 70% ethanol and betadine. After dissection of the kidneys using aseptic technique, they were transferred into a sterile plastic tube containing PBS. The inner medulla was dissected from both kidneys by using aseptic technique and minced into 1- to 2-mm cubes. These tissue pieces were transferred to an Erlenmeyer flask containing a sterile solution of 500 ml of DMEM/F-12 (no. 21041-025, GIBCO-BRL), 80 mM urea, 130 mM NaCl, 50 mg/25 ml of collagenase B (no. 1088 807, Roche), and 18 mg/25 ml of hyaluronidase (no. 2592, Worthington Chemical). The final osmolality of this solution was ~615 mosmol/kgH2O. The tissue pieces were incubated in this solution under constant agitation (300 rpm) for 90 min at 37°C, humidified air, and 5% CO2. Every 20 min, the cell suspension was mixed by repeated aspiration into a 10-ml pipette. At the end of the enzymatic cell disaggregation, the cell suspension was centrifuged at 160 g for 1 min and washed three times at 37°C. Cells were suspended in 5 ml of medium that contained 45% DMEM (low glucose, no. 99-688-CV, Cellgro), 45% Coon's improved F-12 (no. 99-687-CV, Cellgro), 10% fetal bovine serum, 10 mM HEPES (pKa 7.5, pH 7.5), 5 mg/l T3, 5 pM transferrin, 10 nM selenium, 50 nM hydrocortisone, 2 mM L-glutamine, 2.5 ml/l penicillin G/streptomycin sulfate (10,000 U/ml; no. 936620120, Irvine), 80 mM urea, and 130 mM NaCl. The final osmolality of this medium was 640 mosmol/kgH2O. Cells were seeded into a 6-cm dish (Corning). When confluent, they were split at a 1:4 ratio and grown to confluence. Then, before the experimental manipulation, the medium was switched for 48 h to an otherwise identical one lacking serum and urea and with reduced NaCl, yielding a final osmolality of 300 mosmol/kgH2O. On the basis of our previous studies with p2mIME cells, 48 h are sufficient for them to recover from the hypotonic stress, considering that their subsequent response to hypertonicity is little affected (38). Thus we were able to use a hypertonic stress protocol for p2mIME cells that is comparable to the protocol used for mIMCD-3 cells.

RNA and protein extraction. For total RNA extraction, cells were lysed in 800 µl/10-cm dish of denaturing solution (4 M guanidine isothiocyanate, 0.02 M sodium citrate, 0.5% sarcosyl, and 0.7% beta -mercaptoethanol). Total RNA was isolated by phenol-chloroform extraction (6). The RNA pellet was quickly resuspended in 50-100 µl of diethyl pyrocarbonate-treated water. A 1-µl aliquot was mixed with 119 µl of Tris-EDTA buffer (pH 8.0) and used for spectrophotometric quantification of RNA yield. The A260/A280 ratios were typically >= 2.0.

For protein extraction, cells were lysed by addition of 500 µl ice-cold cell lysis buffer to each 10-cm tissue culture dish followed by a 10-min incubation at 4°C. The cell lysis buffer contained 50 mM Tris · HCl (pH 7.4), 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 tablet mini-complete protease inhibitor cocktail (Roche), 1 mM activated Na3VO4, and 1 mM NaF. Samples were centrifuged at 20,000 g for 10 min at 4°C, and the supernatants were saved into a fresh Eppendorf tube. A 5-µl aliquot was used for assaying protein concentration, and the remainder was divided into 50-µl aliquots and stored at -80°C. Protein concentration was measured with BCA reagents (Pierce) and a Spectromax Plus microplate reader (Molecular Devices).

GADD45 cloning and riboprobe generation. PCR primers for cloning full-length GADD45 cDNAs were designed on the basis of GenBank nos. NM_007836 (murine GADD45alpha ), NM_008655 (murine GADD45beta ), and NM_011817 (murine GADD45gamma ) using Vector-NTI 5.5. The following primer pairs were used for amplification of the GADD45 coding sequence from mIMCD-3 cell RNA by RT-PCR: GADD45alpha , primer 1 = ACTTTGGAGGAATTCTCGGCT and primer 2 = AATCACGGGCACCCACTGATCCA; GADD45beta , primer 1 = ATGACCCTGGAAGAGCTGGT and primer 2 = CCAGGAGGCAGTGCAGGTCT; and GADD45gamma , primer 1 = TCTGGAAGAAGTCCGTGGCCA and primer 2 = GATGCTGGGCACCCAGTCGT. The three GADD45 cDNAs were then cloned into pGEM-T vector (Promega) before they were subcloned into pCDNA5/FRT vector (Invitrogen-Life Technologies) in reverse orientation such that in vitro transcription of the insert with T7 polymerase yields antisense mRNA. Plasmid minipreps were made by using Qiagen kits as described by the manufacturer, followed by linearization of the plasmids. The linear DNA template was purified and used for in vitro transcription with T7 MAXIscript (Ambion). The resulting riboprobes were labeled with [32P]CTP (NEG508X, PerkinElmer) and purified by using AquaSelect-D G-25 columns (Eppendorf-5 Prime) to remove free nucleotides. Purified riboprobes were recovered in water for subsequent use in Northern blot hybridization.

Northern blot analysis. Seven micrograms of total RNA from each sample were premixed with 5 µl of formaldehyde-formamide loading dye (Ambion) containing ethidium bromide (50 µg/1 ml of loading dye). Samples were heated to 65°C for 15 min, quick-chilled on ice, and centrifuged at maximum speed for 10 s before being loaded into the wells of 1% agarose-formaldehyde gels. Gels were electrophoresed in MOPS buffer and visualized by UV-transillumination in a Fluor-S Multiimager (Bio-Rad). RNA was transferred overnight from the gels to positively charged Biodyne B nylon membrane (Pall) by upward capillary transfer using an alkaline transfer buffer (0.01 N NaOH/3 M NaCl). RNA transfer was followed by cross-linking the RNA to the membrane as described by Sambrook and Russell (26). The membrane was prehybridized in UltraHyb buffer (0.1 ml/cm2; Ambion) at 65°C in a rotisserie-type hybridization oven for 3 h. After prehybridization, radiolabeled riboprobe was added (1:1,000, vol/vol) and allowed to hybridize overnight at 65°C. The membrane was washed twice with low-stringency wash solution (2× SSC; no. 8673, Ambion) for 5 min each, followed by two washes with high-stringency buffer (0.1× SSC; no. 8674, Ambion) for 15 min each, and imaged with a PhosphorImager (Molecular Dynamics). Quantification was done with ImageQuant and QuantityOne software, and values were normalized for 28S rRNA.

Ribonuclease protection assay. Ribonuclease protection assay (RPA) analysis was carried out as described previously (8) by using the RPA III Kit (Ambion). Briefly, antisense, biotin-labeled RNA probes encoding the murine GADD45 mRNAs were synthesized using T7 polymerase (MAXIscript, Ambion) with purified RT-PCR products as templates. Antisense probes were then hybridized with 5 µg of RNA, and nonhybridized RNA was digested using ribonuclease. Protected fragments were separated on 6% Tris-boric acid-EDTA/urea polyacrylamide gels (NOVEX) at 23 mA constant current, followed by transfer of RNA from gels to a BrightStar nylon membrane (Ambion) at 200 mA constant current for 60 min. RNA immobilization to the nylon membrane was achieved by UV cross-linking with a Stratalinker 1800 (Stratagene). A nonisotopic detection kit from Ambion (Bright-Star BioDetect) was used for visualization of biotinylated probes hybridized to GADD45 on the membrane.

SDS-PAGE and Western blot immunodetection. Proteins were separated by SDS-PAGE as described previously (20). Equal amounts of protein (20 µg) were loaded in each lane of 8% Tris/glycine polyacrylamide gels. The first lane of each gel was loaded with prestained molecular weight standards (Kaleidoskope, Bio-Rad). Samples were electrophoresed at 125 V constant voltage, the gels were briefly rinsed in transfer buffer (25 mM Tris, 200 mM glycine, 20% methanol), and proteins were blotted onto Immobilon P membrane (Millipore) at 1 mA/cm2 constant current for 90 min by using a Trans-Blot SD semidry transfer cell (Bio-Rad). Membranes were blocked for 30 min at room temperature in a solution containing 137 mmol/l NaCl, 20 mmol/l Tris, pH 7.6, with HCl, 0.1% vol/vol Tween-20, 5% wt/vol nonfat dry milk, and 0.02% wt/vol thimerosal. Then, they were incubated for 3 h in blocking buffer containing either GADD45alpha (1:100; sc-792, Santa Cruz Biotechnology) or GADD45beta antibody (1:100; sc-7775, Santa Cruz Biotechnology). After three washes in blocking buffer, the blots were incubated for 1 h in blocking buffer containing secondary antibody coupled to horseradish peroxidase (1:2,000). After more washes, blots were developed with SuperSignal Femto (Pierce) for 5 min and imaged with a Fluor-S MultiImager (Bio-Rad). Quantification of GADD45 bands was performed by using Quantity-One software (Bio-Rad).

Statistics. Data analysis was carried out with STATMOST32 software. Time series effects were evaluated by analysis of variance and differences between values within a single series by a Student's-Newman-Keuls test. Differences between pairs of data for the same time point were analyzed by an F-test followed by either a paired t-test or Mann-Whitney test. The significance threshold was set at P < 0.05, and values represent means of at least three experiments for all data shown.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

All three GADD45 transcripts are induced in response to hypertonic stress in mIMCD-3 cells. The expression of GADD45 mRNAs correlates with the adaptation of mammalian cells to a wide spectrum of genotoxic stresses (15). In addition, we have previously provided evidence that acute hypertonicity is genotoxic to renal cells (19), and previous reports have indicated that GADD45alpha protein and GADD45beta transcript are induced during hypertonicity (20, 33). Therefore, we decided to investigate systematically the regulation of all three GADD45 transcripts in mIMCD-3 cells after exposing these cells to hypertonicity, ranging from 400 to 675 mosmol/kgH2O, for 18 h. These experiments show that the abundance of all three GADD45 mRNAs increases during hypertonicity. The increase in GADD45 mRNA abundance is statistically significant for all three GADD45 transcripts and highest when the hypertonic medium has an osmolality of 600 mosmol/kgH2O (Fig. 1). GADD45alpha mRNA is induced 2.2-fold, GADD45beta mRNA is induced ~3.3-fold, and GADD45gamma mRNA is induced 7.1-fold. Interestingly, we did not observe any significant induction of any of the GADD45 transcripts during less severe hypertonicity (400 and 500 mosmol/kgH2O), and the level of induction was also less at 675 compared with 600 mosmol/kgH2O. Thus the maximum level of induction of all three GADD45 transcripts coincides with the highest degree of acute, nonlethal hypertonicity that mIMCD-3 cells can tolerate.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1.   All three growth arrest and DNA damage-inducible 45 (GADD45) transcripts are maximally induced in murine inner medullary collecting duct 3 (mIMCD-3) cells after medium osmolality was raised from 300 to 600 mosmol/kgH2O by addition of NaCl. Cells were kept for 18 h in osmolalities ranging from 300 (isosmotic) to 675 mosmol/kgH2O followed by total RNA isolation. A-C: Northern blots of GADD45 transcripts in cells exposed to this osmolality range (GADD45alpha , GADD45beta , and GADD45gamma , respectively). Top: one representative Northern blot (dark bands on light background). Center: corresponding RNA gel with ethidium bromide-stained 28S and 18S rRNA. The 28S rRNA served as a control for even loading and for normalization of the Northern blot data. Bottom: histogram depicts the mean mRNA abundance of GADD45alpha , GADD45beta , and GADD45gamma  ± SE of 3 independent experiments.

The hypertonic induction of GADD45 transcripts is transient, but GADD45 protein induction is more stable. The kinetics of induction of GADD45 was determined for all three transcripts, and for GADD45alpha and GADD45beta also at the protein level, to further our insight into their osmotic regulation and to correlate GADD45 induction with other adaptive mechanisms utilized by mIMCD-3 cells during hypertonicity. Exposure of mIMCD-3 cells to hypertonicity of 600 mosmol/kgH2O (NaClup-arrow ) causes a rapid and transient increase of all three GADD45 transcripts, as determined by Northern blot analysis (Fig. 2A). This increase was maximal after 18-h exposure to hypertonicity. As seen also in Fig. 1, the degree of hypertonic induction of the three GADD45 transcripts in response to hypertonicity differed considerably, in particular for GADD45gamma , which was induced much more strongly than GADD45alpha and GADD45beta . The kinetics of hypertonic GADD45 induction in p2mIME cells is very similar to that in mIMCD-3 cells, even though it was analyzed by RPA and not Northern blotting (Fig. 2B). Maximum levels of induction were observed at 16 h for all three GADD45 transcripts. The only notable difference between the two cell types concerns the lesser degree of GADD45beta induction in p2mIME cells compared with mIMCD-3 cells. We performed Western blot experiments for GADD45alpha and GADD45beta to complement the kinetic data on hypertonic GADD45 mRNA induction at the protein level. Western blot analysis of these two GADD45 isoforms in mIMCD-3 cells revealed that the kinetics of hypertonic induction of GADD45 protein lags behind that of the mRNA induction (Fig. 2C). Even though this is expected, it was unexpected to see the levels of GADD45alpha and GADD45beta protein still elevated at 36 h after the onset of hypertonicity, because the corresponding mRNA levels had already declined to near baseline values within 24 h (Fig. 2D). In addition, the maximal hypertonic induction of GADD45alpha and GADD45beta protein is 4.3- and 4.1-fold, respectively, which is almost twice that observed at the level of mRNA abundance. Thus the increase in the abundance of these two GADD45 proteins appears to be more stable and mediated not only by increased mRNA abundance but also by additional mechanisms. We did not succeed in Western blot analysis of GADD45gamma because no suitable antibodies were identified.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2.   Hypertonic GADD45 induction is transient at the mRNA level and sustained at the protein level. Time course studies on mIMCD-3 cells and passage 2 mouse IM epithelial (p2mIME) cells show that the increase in mRNA abundance after hypertonic stress peaks between 16 and 18 h. A: abundance of GADD45 mRNAs in mIMCD-3 cells in response to 600 mosmol/kgH2O (NaClup-arrow ) hypertonicity as determined by Northern blot analysis. B: abundance of GADD45 mRNAs in p2mIME cells in response to 700 mosmol/kgH2O (NaClup-arrow ) hypertonicity as determined by RNase protection assay. C: representative Western blots of GADD45alpha and GADD45beta from mIMCD-3 cells exposed to 600 mosmol/kgH2O (NaClup-arrow ) hypertonicity for various times. Shown below each blot is the corresponding upper part of the gel that was stained with Coomassie blue to confirm even loading of total protein. D: time course of GADD45alpha and GADD45beta protein abundance in mIMCD-3 cells exposed to 600 mosmol/kgH2O (NaClup-arrow ) hypertonicity, as in C. Values are means ± SE of 3 independent experimental observations.

Osmotic regulation of GADD45 transcripts is specific to hypertonic stress and not seen with urea-imposed hyperosmotic stress. The next question we addressed was whether the hypertonic induction of GADD45 transcripts was solute specific. We tested this by comparing mRNA levels of GADD45 in mIMCD-3 cells after dosing these cells for 18 h in 600 mosmol/kgH2O hyperosmotic medium, created by addition of NaCl, KCl, sorbitol, mannitol, or urea. Hypertonicity in any of these forms (NaClup-arrow , KClup-arrow , sorbitolup-arrow , or mannitolup-arrow ) results in an induction of all three GADD45 mRNA transcripts, although the degree of induction is variable to some extent (Fig. 3A). Sorbitol has the most pronounced effect on the abundance of all three GADD45 transcripts. In contrast, nonhypertonic hyperosmolality resulting from urea addition to the medium does not induce any GADD45 transcript significantly (Fig. 3B). Surprisingly, the hypertonic induction of GADD45beta and, to an even greater extent, GADD45gamma mRNA is not as strong during hypertonicity in the form of KCl compared with hypertonicity in the form of the other solutes tested (Fig. 3). The cause underlying this effect is unknown. Nevertheless, these data clearly demonstrate that hypertonicity (i.e., a change in cell volume or intracellular ionic strength), and not just hyperosmolality per se, is the trigger for the induction of all three GADD45 transcripts in mIMCD-3 cells.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3.   All solutes causing hypertonicity induce GADD45, but comparable hyperosmolality due to elevated urea fails to induce GADD45. The abundance of all 3 GADD45 transcripts is significantly increased in mIMCD-3 cells in response to hypertonic stress by elevating medium osmolality from 300 to 600 mosmol/kgH2O with the addition of NaCl, KCl, sorbitol, and mannitol. The increase in GADD45 mRNA abundance was measured by Northern blot analysis and is absent when cells are exposed to hyperosmolality in the form of elevated urea (300 to >600 mosmol/kgH2O). A: representative Northern blots showing the solute specificity of mRNA abundance of all 3 GADD45 transcripts in mIMCD-3 cells: GADD45alpha (top), GADD45beta (middle), and GADD45gamma (bottom). The following solutes were tested: isosmotic control, NaCl, KCl, sorbitol, mannitol, and urea (lanes 1-6, respectively). mIMCD-3 cells were dosed by substituting isosmotic medium with the respective hyperosmotic medium and incubated for 18 h. The dark bands on a light background (top) represent the abundance of the mRNA transcript. The bright bands on a dark background (bottom) represent the amounts of 28S and 18S rRNA on the corresponding gels. B: average amounts of GADD45 mRNA, depending on the solute used to impose hyperosmotic stress on mIMCD-3 cells. Values are means ± SE of 3 independent experimental observations.

Induction of GADD45 results from mRNA stabilization and not from nascent mRNA synthesis. The upregulation of GADD45 transcripts in response to hypertonicity could be mediated either by increased transcription or by mRNA stabilization. To differentiate between these two possible mechanisms, we added actinomycin D to the cell culture medium during hypertonic stress experiments. Actinomycin D is a commonly used blocker of transcription that inhibits RNA synthesis. Addition of 10 µg/ml actinomycin D to mIMCD-3 cells kept in isosmotic medium strongly inhibits nascent mRNA synthesis of all three GADD45 transcripts. Using Northern blot analysis, we demonstrate that the reduction of mRNA abundance is 4-fold for GADD45alpha and nearly 10-fold for GADD45beta and GADD45gamma (Fig. 4, A-C, respectively). For GADD45beta and GADD45gamma , virtually no mRNA is detectable after mIMCD-3 cells are grown for 18 h in isosmotic medium in the presence of actinomycin D. In contrast to the dramatic inhibition of GADD45 mRNA synthesis in mIMCD-3 cells grown in isosmotic medium, none of the three GADD45 transcripts shows diminished hypertonic induction after mIMCD-3 cells were dosed in 600 mosmol/kgH2O medium (NaClup-arrow ) in the presence of actinomycin D (Fig. 4). In fact, GADD45alpha and GADD45beta transcripts even significantly increase in the presence of actinomycin D (Fig. 4, A and B) while poly(A)+ RNA and c-abl levels decrease (Fig. 5, A and B). These data clearly indicate that the induction of all three mammalian GADD45 transcripts in response to hypertonicity is not a result of increased nascent mRNA synthesis but instead is due to increased mRNA stabilization. Because such stabilization of GADD45 transcripts is absent in isosmotic medium, the mechanisms involved must be activated by hypertonic stress.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4.   All three GADD45 transcripts are hypertonically induced by means of mRNA stabilization. Actinomycin D (10 µg/ml; Biovision) reduces the transcript abundance of GADD45alpha (A), GADD45beta (B), and GADD45gamma (C) in mIMCD-3 cells grown in isosmotic medium. In contrast, actinomycin D does not prevent the hypertonic induction of any GADD45 transcript when cells are treated for 18 h in hypertonic medium (600 mosmol/kgH2O, NaClup-arrow ), indicating that the increase is due to mRNA stabilization. Values are means ±SE of 3 independent experimental observations. Insets: representative Northern blots for each GADD45 transcript (top) and the corresponding 28S and 18S rRNAs (bottom). Samples were loaded in the following order: 300 mosmol/kgH2O, 300 mosmol/kgH2O+10 µg/ml actinomycin D, 600 mosmol/kgH2O (NaClup-arrow ), and 600 mosmol/kgH2O (NaClup-arrow )+10 µg/ ml actinomycin D (lanes 1-4, respectively).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5.   Actinomycin D reduces overall and c-abl transcript levels. Actinomycin D (10 µg/ml) reduces the abundance of overall poly(A)+ mRNA (A) and c-abl tyrosine kinase transcript (B) in mIMCD-3 cells grown in isosmotic (300 mosmol/kgH2O) and hypertonic (600 mosmol/kgH2O, NaClup-arrow ) media. These data show that the actinomycin D effect on GADD45 transcripts is unique and not a result of interference of hypertonicity with the action of actinomycin D as a universal transcriptional inhibitor. Values are means ± SE of 3 independent experimental observations. Inset: representative Northern blot for c-abl transcript (top) and the corresponding 28S and 18S rRNAs (bottom). Samples were loaded in the following order: 300 mosmol/kgH2O, 300 mosmol/kgH2O+10 µg/ ml actinomycin D, 600 mosmol/kgH2O (NaClup-arrow ), and 600 mosmol/kgH2O (NaClup-arrow )+10 µg/ml actinomycin D (lanes 1-4, respectively).

GADD45 isoforms show distinct profiles of induction in response to exposure of mIMCD-3 cells to various other stresses. Because we have shown that all three GADD45 isoforms are induced in response to hypertonic stress and because this response was found to be solute specific (ureaup-arrow did not elicit an increase in any GADD45 mRNA), we asked whether there are discernable differences among the three isoforms regarding the pattern of GADD45 induction in response to a whole array of cellular stresses. Thus we carried out a comprehensive experiment in which mIMCD-3 cells were exposed for 18 h to 10 different stresses that are either known to have effects on cells similar to those of osmotic stress or have previously been shown to be genotoxic. We show that despite the uniform hypertonic induction of all three GADD45 transcripts, there are clear differences with regard to the stressor-specificity of induction for each GADD45 isoform (Fig. 6). This is particularly evident during the cellular response to altered extracellular pH. In response to acid stress (pH 5.5), GADD45beta is strongly induced (3.5-fold), whereas GADD45alpha is not much affected. In contrast, alkaline stress (pH 9.0) induces GADD45alpha significantly (2-fold), whereas GADD45beta is unaffected. The mRNA abundance of GADD45gamma does not increase in response to any pH change. mIMCD-3 cells subjected to heat shock (42°C) respond by significant induction of all three GADD45 isoforms, but the degree of induction of GADD45alpha transcript is higher (4-fold) compared with GADD45beta (1.5-fold) and GADD45gamma (2.6-fold). A cold shock (2°C) only marginally induces GADD45alpha transcript (1.5-fold), whereas the other two GADD45 transcripts do not increase significantly. The response to UV irradiation (UV-C and UV-A/B) is not very pronounced and is comparable to that during cold shock. For UV treatment, cells were irradiated for 40 s at a dose of 500 J/m2 and allowed to recover for 18 h before they were analyzed. Hydrogen peroxide has a more marked effect than UV radiation, leading to the induction of all three GADD45 transcripts, although the degree of induction is strongest for GADD45alpha (2.5-fold) and less for GADD45gamma (1.6-fold) and GADD45beta (1.4-fold). In response to heavy metal toxicity, GADD45gamma is induced far more potently than the other two isoforms (Hg2+ stress, 17-fold; Cd2+ stress, 11-fold), although such stress also results in significant induction of GADD45alpha (Hg2+ stress, 4-fold; Cd2+ stress, 2.8-fold) and GADD45beta (Hg2+ stress, 2-fold; Cd2+ stress, 1.5-fold). Thus GADD45alpha is mostly induced during hypertonic, alkaline, heat, hydrogen peroxide, and heavy metal stress, whereas GADD45beta is only induced appreciably during hypertonic and acid stress and, to some extent, also during heat and heavy metal stress (Fig. 6). GADD45gamma is the most strongly induced isoform during hypertonic and heavy metal stress and is also induced by heat and H2O2 stress. Clearly, there is overlap with regard to stressor specificity of particular GADD45 isoforms, but it is also evident from these data that the induction profile of GADD45 transcripts is far from identical when comparing cellular responses to various stresses. These data should facilitate the discovery of biological functions of individual GADD45 isoforms.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 6.   Stressor specificity of GADD45 induction in mIMCD-3 cells. A-C: effect of 10 different stressful conditions on the mRNA abundance of GADD45 was analyzed by Northern blots in cells treated for 18 h (GADD45alpha , GADD45beta , and GADD45gamma , respectively). All gels are loaded in the following order: isosmotic control, hypertonic medium (600 mosmol/kgH2O, NaClup-arrow ), pH 5.5, pH 9.0, heat shock (42°C), cold shock (2°C), UV-C, UV-A/B, 4 mM H2O2, 30 µM HgCl2, and 35 µM CdCl2 (lanes 1-11, respectively). pH 5.5 was generated by substituting HEPES in DMEM/F-12 medium with 15 mM MES (Sigma). pH 9.0 was generated by substituting HEPES in DMEM/F-12 with 15 mM AMPSO (Sigma). UV treatment (UV-C = 250-300 nm, UV-B = 300-350 nm, UV-A = 350-380 nm) was achieved by irradiating cells with a UV-lamp (UVGL-58, M/s UVP-USA) from a distance of 8.5 cm for 37-42 s. A-C: dark bands on a light background (top) represent GADD45 mRNA abundance and bright bands on a dark background (bottom) represent 28S and 18S rRNA. D: average effects of hyperosmolality caused by different solutes on GADD45 mRNA abundance in mIMCD-3 cells. Values are means ± SE of 3 independent experimental observations.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The ability of renal IM cells to adapt to a severely hyperosmotic milieu and wide osmotic fluctuations is essential for the renal concentrating mechanism. Therefore, it is important to understand the nature of the osmotic threat that these cells face routinely and to investigate the hypertonic stress phenotype that serves to alleviate such a threat. Our laboratory previously reported that mIMCD-3 cells suffer DNA damage during acute hypertonicity (19). This observation may explain the activation of cell cycle checkpoints and the p53 pathway in mIMCD-3 cells exposed to hypertonicity (8, 19). In addition, hypertonicity causes induction of GADD45alpha protein in mIMCD-3 cells (20) and GADD45beta mRNA in ML-1 myeloid leukemia cells (33). GADD45 proteins have been implicated in multiple aspects of cellular stress adaptation that could be of critical importance during hypertonicity, including DNA repair (29, 30), regulation of cell growth (15), modulation of chromatin compactness (5), and apoptosis (28). Despite these potentially critical functions of GADD45 proteins in hypertonically stressed IM cells, it was not known before the present study which GADD45 proteins contribute the most to the hypertonic stress phenotype of renal IM cells and how the GADD45 isoforms are regulated by hypertonicity.

Our results demonstrate that all three GADD45 transcripts are induced during hypertonicity in mIMCD-3 cells and in p2mIME cells. We report different degrees of induction of individual GADD45 isoforms (GADD45gamma  > GADD45beta  > GADD45alpha ), which could be reflective of varying significance during hypertonic stress adaptation. GADD45gamma , which was not previously known to be osmoregulated, is induced most potently by hypertonicity (7-fold) and may be the most important. The kinetics of GADD45 induction is similar for all three isoforms and suggests that these proteins are involved in adaptive events taking place during later stages, i.e., 18-24 h after the onset of hypertonicity. At this time, most of the increase in mRNA and protein levels of all three GADD45 isoforms is observed. Such kinetics does not support a role for any of the GADD45 isoforms in the onset of cell cycle arrest. Conversely, the kinetics of hypertonic GADD45 induction supports a role for these proteins in DNA repair after hypertonicity, which does not have a significant effect until 24 h after the onset of hypertonicity (19). In this regard, it is interesting that the amount of all GADD45 transcripts increases up to 600 mosmol/kgH2O in mIMCD-3 cells but starts to decline if these cells are exposed to higher osmolalities. We have previously shown that the same pattern of osmolality dependence applies to the tumor suppressor protein p53 and to cell survival in mIMCD-3 cells (8). Apoptosis is much more prevalent in mIMCD-3 cells when the acute hypertonicity exceeds 600 mosmol/kgH2O (22, 27). In addition, high urea does not cause DNA double-strand breaks and fails to induce GADD45 or p53. Any increase in extracellular osmolality that is mediated by nonpermeable solutes causes hypertonicity (cell shrinkage and increased intracellular ionic strength) and triggers DNA damage and the induction of GADD45 and p53. Collectively, these observations suggest that all three GADD45 proteins may be involved in DNA repair or chromatin modulation rather than having antiproliferative effects or being proapoptotic during hypertonicity. Abcouwer et al. (1) suggest that GADD45 could be functionally analogous to traditional stress response genes such as molecular chaperones, which protect cells from stress-induced damage and aid in the recovery of cell function after stress.

Hypertonic induction of all three mammalian GADD45 transcripts apparently is not dependent on nascent mRNA synthesis but is mediated by means of mRNA stabilization, evidenced by lack of prevention by the universal transcription inhibitor actinomycin D. Thus the mechanism of osmotic regulation of GADD45 transcripts differs from that of other hypertonically regulated genes, most of which are transcriptionally induced (4). For some of these osmoregulated genes, including BGT1 and aldose reductase, it is known that their hypertonic induction is mediated by tonicity-responsive enhancer elements in the 5'-flanking region, named tonicity-responsive enhancers (34) or osmotic response elements (11). Our finding that actinomycin D blocks nascent GADD45 synthesis in isotonic medium is not surprising and verifies the well-documented property of actinomycin D to be a universal blocker of transcription in mIMCD-3 cells. However, we find that actinomycin D does not elicit any decrease in GADD45 mRNA levels in hypertonic medium. This observation is consistent with increased mRNA stability of all three GADD45 transcripts in response to hypertonic stress. Stabilization of GADD45alpha mRNA is also seen in Chinese hamster ovary cells exposed to methyl methanesulfonate and UV irradiation (17) and in human breast cell lines deprived of glutamine (1). Interestingly, hypertonicity and actinomycin D have a synergistic effect on the abundance of GADD45alpha and GADD45beta transcripts in mIMCD-3 cells. This apparent paradox may have its roots in slight interference of actinomycin D with the RNA degradation machinery (10). Such interference could be potentiated during hypertonicity and limit the production of labile regulatory factors, resulting in enhanced mRNA stability. However, it is unlikely that such interference is dominant because, unlike in GADD45 genes, actinomycin D potently inhibits the hypertonic induction of many other genes, including ATA2, BGT1, and Cox-2, and the alpha - and beta -subunits of Na+-K+-ATPase (3, 7, 23, 36). In addition, our data on actinomycin D effects on overall poly(A)+ mRNA content and an osmoregulated control transcript (c-abl tyrosine kinase) illustrate that hypertonicity does not lead to nonspecific mRNA stabilization but that GADD45 transcripts are stabilized selectively in hypertonic medium, whereas most other mRNAs are reduced under these conditions (Fig. 5). Of great interest, increases in GADD45alpha and GADD45beta protein levels may result in part from protein stabilization that parallels the mRNA stabilization. Two arguments support this speculation. First, increases in GADD45alpha and GADD45beta protein abundance (ca. 4-fold) exceed the increases in their mRNAs (~2- to 3-fold). Second, and perhaps more importantly, both GADD45 proteins continue to increase in abundance 36 h after the onset of hypertonicity, when the corresponding transcript levels have already returned to baseline. An increase in GADD45 stability during hypertonicity is unusual because most proteins are destabilized by hypertonicity (31). Nevertheless, the aquaporin 1 protein, for which hypertonic induction is physiologically relevant, is also stabilized during hypertonicity (21). In this case, stabilization results from a phosphorylation-dependent decrease in aquaporin 1 ubiquitination during hypertonicity.

Our laboratory previously provided evidence that GADD45alpha protein induction during hypertonicity depends in part on the p38 MAPK pathway (20). Furthermore, inhibition of p38 MAPK by a specific inhibitor (25 µM SB-203580) results in partial (50%) suppression of the hypertonic induction of GADD45beta and GADD45gamma transcripts (data not shown). Thus proteins involved in GADD45 mRNA stabilization may be hypertonically induced by means of the p38 MAPK cascade.

We have compared the degree of hypertonic induction for all three GADD45 transcripts with that in response to other stresses to obtain information about the relative significance of the three GADD45 isoforms during exposure of mIMCD-3 cells to various insults. These experiments suggest that although all three GADD45 isoforms are induced during hypertonic, heat, and heavy metal stress, the degree of induction differs greatly. In addition, individual GADD45 isoforms show discernable patterns of specificity with regard to additional types of stress. GADD45alpha is involved in adaptation to alkali, cold shock, UV irradiation, and hydrogen peroxide stress. In contrast, only GADD45beta is induced significantly in response to acid stress. The pattern of stressor specificity of GADD45gamma induction is dominated by its strong responsiveness to hypertonic and heavy metal stress. In fact, our study shows that mercury-induced GADD45gamma induction represents the highest degree of induction of any GADD45 transcript under any of the conditions tested (17-fold). Overall, the hypertonic induction profile of GADD45 isoforms is most similar to that seen in response to heat shock and heavy metal stress. This may indicate that induction of all three GADD45 proteins is critical for cell functions that are common during adaptation to triple-H stress (hypertonicity, heat, and heavy metal stress). These cell functions remain to be determined. On the other hand, the relative ineffectiveness of UV radiation for inducing the GADD45 transcripts may point to the possible involvement of GADD45 in cell functions that are poorly or not at all affected by UV radiation stress in mIMCD-3 cells. Alternatively, higher doses of UV radiation may be required to induce an adaptive response. We view the latter possibility as unlikely because mIMCD-3 cells showed signs of massive apoptotic cell death in response to the doses of UV radiation that were used in our study (unpublished observations). UV radiation leads to a special form of DNA damage, the formation of pyrimidine dimers, suggesting that GADD45 may not be involved in the recognition or repair of this form of DNA damage in kidney cells. Nevertheless, the GADD45 transcripts are induced by UV radiation in skin fibroblasts, which in contrast to kidney cells are exposed to UV radiation under physiological conditions. Thus the contingencies involved in GADD45 induction and maintenance of genomic integrity may be cell type specific and reflect the physiological relevance of a particular stressor.

In summary, we have shown that all three GADD45 isoforms are part of the hypertonic stress phenotype of renal IM cells. Their induction kinetics support a possible involvement in DNA repair and/or chromatin regulation. The induction of GADD45 is dependent on hypertonicity, not seen during isovolumetric hyperosmolality, and is based on mRNA stabilization of all three transcripts. Because the pattern of hypertonic GADD45 induction most closely resembles that seen in response to heat and heavy metal stress, it is likely that these proteins are involved in cell functions that are common for adaptation to these three types of stress. In contrast, individual GADD45 isoforms may be involved in other aspects of cell adaptation during pH, oxidative, and ionizing radiation stress.


    ACKNOWLEDGEMENTS

This work was supported by the National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-59470.


    FOOTNOTES

Address for reprint requests and other correspondence: D. Kültz, Dept. of Animal Sciences, Univ. of California, Meyer Hall, 1 Shields Ave., Davis, CA 95616-8521 (E-mail: dkueltz{at}ucdavis.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

July 2, 2002;10.1152/ajprenal.00118.2002

Received 25 March 2002; accepted in final form 27 June 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abcouwer, SF, Schwarz C, and Meguid RA. Glutamine deprivation induces the expression of GADD45 and GADD153 primarily by mRNA stabilization. J Biol Chem 274: 28645-28651, 1999[Abstract/Free Full Text].

2.   Abdollahi, A, Lord KA, Hoffman-Liebermann B, and Liebermann DA. Sequence and expression of a cDNA encoding MyD118: a novel myeloid differentiation primary response gene induced by multiple cytokines. Oncogene 6: 165-167, 1991[Web of Science][Medline].

3.   Alfieri, RR, Petronini PG, Bonelli MA, Caccamo AE, Cavazzoni A, Borghetti AF, and Wheeler KP. Osmotic regulation of ATA2 mRNA expression and amino acid transport System A activity. Biochem Biophys Res Commun 283: 174-178, 2001[Web of Science][Medline].

4.   Burg, MB, Kwon ED, and Kültz D. Regulation of gene expression by hypertonicity. Annu Rev Physiol 59: 437-455, 1997[Web of Science][Medline].

5.   Carrier, F, Georgel PT, Pourquier P, Blake M, Kontny HU, Antinore MJ, Gariboldi M, Myers TG, Weinstein JN, Pommier Y, and Fornace AJJ Gadd45, a p53-responsive stress protein, modifies DNA accessibility on damaged chromatin. Mol Cell Biol 19: 1673-1685, 1999[Abstract/Free Full Text].

6.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

7.   De Angelis, E, Petronini PG, Borghetti P, Borghetti AF, and Wheeler KP. Induction of betaine-gamma-aminobutyric acid transport activity in porcine chondrocytes exposed to hypertonicity. J Physiol 518: 187-194, 1999[Abstract/Free Full Text].

8.   Dmitrieva, N, Kültz D, Michea L, Ferraris JD, and Burg MB. p53 activation by hypertonicity in renal inner medullary epithelial cells (mIMCD3) protects them from apoptosis. J Biol Chem 275: 18243-18247, 2000[Abstract/Free Full Text].

9.   Dmitrieva, NI, Bulavin DV, Fornace AJJ, and Burg MB. Rapid activation of G2/M checkpoint after hypertonic stress in renal inner medullary epithelial (IME) cells is protective and requires p38 kinase. Proc Natl Acad Sci USA 99: 184-189, 2002[Abstract/Free Full Text].

10.   Edwards, DR, and Mahadevan LC. Protein synthesis inhibitors differentially superinduce c-fos and c-jun by three distinct mechanisms: lack of evidence for labile repressors. EMBO J 11: 2415-2424, 1992[Web of Science][Medline].

11.   Ferraris, JD, Williams CK, Jung KY, Bedford JJ, Burg MB, and Garcia-Perez A. ORE, a eukaryotic minimal essential osmotic response element. The aldose reductase gene in hyperosmotic stress. J Biol Chem 271: 18318-18321, 1996[Abstract/Free Full Text].

12.   Fornace, AJ, Jr, Alamo IJ, and Hollander MC. DNA damage-inducible transcripts in mammalian cells. Proc Natl Acad Sci USA 85: 8800-8804, 1988[Abstract/Free Full Text].

13.   Galloway, SM, Deasy DA, Bean CL, Kraynak AR, Armstrong MJ, and Bradley MO. Effects of high osmotic strength on chromosome aberrations, sister-hromatid exchanges and DNA strand breaks, and the relation to toxicity. Mutat Res 189: 15-25, 1987[Web of Science][Medline].

14.   Handler, JS, and Kwon HM. Kidney cell survival in high tonicity. Comp Biochem Physiol A Physiol 117: 301-306, 1997[Medline].

15.   Hollander, MC, and Fornace AJ, Jr. Cell cycle checkpoints and growth-arrest genes activated by genotoxic stress. In: DNA Repair Mechanisms: Impact on Human Diseases and Cancer, edited by Vos JM-H.. Georgetown, TX: Landes, 1995, p. 219-237.

16.   Hollander, MC, Sheikh MS, Bulavin DV, Lundgren K, Augeri-Henmueller L, Shehee R, Molinaro TA, Kim KE, Tolosa E, Ashwell JD, Rosenberg MP, Zhan Q, Fernandez-Salguero PM, Morgan WF, Deng CX, and Fornace AJJ Genomic instability in Gadd45alpha -deficient mice. Nat Genet 23: 176-184, 1999[Web of Science][Medline].

17.   Jackman, J, Alamo IJ, and Fornace AJJ Genotoxic stress confers preferential and coordinate messenger RNA stability on the five gadd genes. Cancer Res 54: 5656-5662, 1994[Abstract/Free Full Text].

18.   Kojima, S, Mayumi-Matsuda K, Suzuki H, and Sakata T. Molecular cloning of rat GADD45gamma , gene induction and its role during neuronal cell death. FEBS Lett 446: 313-317, 1999[Web of Science][Medline].

19.   Kültz, D, and Chakravarty D. Hyperosmolality in the form of elevated NaCl but not urea causes DNA damage in murine kidney cells. Proc Natl Acad Sci USA 98: 1999-2004, 2001[Abstract/Free Full Text].

20.   Kültz, D, Madhany S, and Burg MB. Hyperosmolality causes growth arrest of murine kidney cells: induction of GADD45 and GADD153 by osmosensing via stress-activated protein kinase 2. J Biol Chem 273: 13645-13651, 1998[Abstract/Free Full Text].

21.   Leitch, V, Agre P, and King LS. Altered ubiquitination and stability of aquaporin-1 in hypertonic stress. Proc Natl Acad Sci USA 98: 2894-2898, 2001[Abstract/Free Full Text].

22.   Michea, L, Ferguson DR, Peters EM, Andrews PM, Kirby MR, and Burg MB. Cell cycle delay and apoptosis are induced by high salt and urea in renal medullary cells. Am J Physiol Renal Physiol 278: F209-F218, 2000[Abstract/Free Full Text].

23.   Muto, S, Ohtaka A, Nemoto J, Kawakami K, and Asano Y. Effects of hyperosmolality on Na, K-ATPase gene expression in vascular smooth muscle cells. J Membr Biol 162: 233-245, 1998[Web of Science][Medline].

24.   Nakayama, K, Hara T, Hibi M, Hirano T, and Miyajima A. A novel oncostatin M-inducible gene OIG37 forms a gene family with MyD118 and GADD45 and negatively regulates cell growth. J Biol Chem 274: 24766-24772, 1999[Abstract/Free Full Text].

25.   Rauchman, MI, Nigam SK, Delpire E, and Gullans SR. An osmotically tolerant inner medullary collecting duct cell line from an SV40 transgenic mouse. Am J Physiol Renal Fluid Electrolyte Physiol 265: F416-F424, 1993[Abstract/Free Full Text].

26.   Sambrook, J, and Russell PW. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001.

27.   Santos, BC, Chevaile A, Hebert MJ, Zagajeski J, and Gullans SR. A combination of NaCl and urea enhances survival of IMCD cells to hyperosmolality. Am J Physiol Renal Physiol 274: F1167-F1173, 1998[Abstract/Free Full Text].

28.   Sheikh, MS, and Fornace AJJ Death and decoy receptors and p53-mediated apoptosis. Leukemia 14: 1509-1513, 2000[Web of Science][Medline].

29.   Smith, ML, Ford JM, Hollander MC, Bortnick RA, Amundson SA, Seo YR, Deng CX, Hanawalt PC, and Fornace AJJ p53-mediated DNA repair responses to UV radiation: studies of mouse cells lacking p53, p21, and/or gadd45 genes. Mol Cell Biol 20: 3705-3714, 2000[Abstract/Free Full Text].

30.   Smith, ML, Kontny HU, Zhan Q, Sreenath A, O'Connor PM, and Fornace AJJ Antisense GADD45 expression results in decreased DNA repair and sensitizes cells to u. v-irradiation or cisplatin. Oncogene 13: 2255-2263, 1996[Web of Science][Medline].

31.   Somero, GN, and Yancey P. Osmolytes and cell volume regulation: physiological and evolutionary principles. In: Handbook of Cell Physiology, edited by Hoffmann JF, and Jamieson JD.. Oxford, UK: Oxford University Press, 1997, p. 441-484.

32.   Suzuki, M, Watanabe TK, Fujiwara T, Nakamura Y, Takahashi E, and Tanigami A. Molecular cloning, expression, and mapping of a novel human cDNA, GRP17, highly homologous to human gadd45 and murine MyD118. J Hum Genet 44: 300-303, 1999[Web of Science][Medline].

33.   Takekawa, M, and Saito H. A family of stress-inducible GADD45-like proteins mediate activation of the stress-responsive MTK1/MEKK4 MAPKKK. Cell 95: 521-530, 1998[Web of Science][Medline].

34.   Takenaka, M, Preston AS, Kwon HM, and Handler JS. The tonicity-sensitive element that mediates increased transcription of the betaine transporter gene in response to hypertonic stress. J Biol Chem 269: 29379-29381, 1994[Abstract/Free Full Text].

35.   Timasheff, SN. The control of protein stability and association by weak interactions with water: how do solvents affect these processes? Annu Rev Biophys Biomol Struct 22: 67-97, 1993[Web of Science][Medline].

36.   Zhang, F, Warskulat U, Wettstein M, Schreiber R, Henninger HP, Decker K, and Häussinger D. Hyperosmolarity stimulates prostaglandin synthesis and cyclooxygenase-2 expression in activated rat liver macrophages. Biochem J 312: 135-143, 1995[Web of Science][Medline].

37.   Zhang, W, Bae I, Krishnaraju K, Azam N, Fan W, Smith K, Hoffman B, and Liebermann DA. CR6: a third member in the MyD118 and Gadd45 gene family which functions in negative growth control. Oncogene 18: 4899-4907, 1999[Web of Science][Medline].

38.   Zhang, Z, Cai Q, Michea L, Dmitrieva N, Andrews P, and Burg MB. Proliferation and osmotic tolerance of renal inner medullary epithelial cells in vivo and in cell culture. Am J Physiol Renal Physiol 283: F302-F308, 2002[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 283(5):F1020-F1029



This article has been cited by other articles:


Home page
Physiol. Rev.Home page
M. B. Burg, J. D. Ferraris, and N. I. Dmitrieva
Cellular Response to Hyperosmotic Stresses
Physiol Rev, October 1, 2007; 87(4): 1441 - 1474.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Stubbe, K. Madsen, F. T. Nielsen, O. Skott, and B. L. Jensen
Glucocorticoid impairs growth of kidney outer medulla and accelerates loop of Henle differentiation and urinary concentrating capacity in rat kidney development
Am J Physiol Renal Physiol, October 1, 2006; 291(4): F812 - F822.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Q. Cai, N. I. Dmitrieva, J. D. Ferraris, L. F. Michea, J. M. Salvador, M. C. Hollander, A. J. Fornace Jr., R. A. Fenton, and M. B. Burg
Effects of expression of p53 and Gadd45 on osmotic tolerance of renal inner medullary cells
Am J Physiol Renal Physiol, August 1, 2006; 291(2): F341 - F349.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. I. Dmitrieva, M. B. Burg, and J. D. Ferraris
DNA damage and osmotic regulation in the kidney
Am J Physiol Renal Physiol, July 1, 2005; 289(1): F2 - F7.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
U. Hasler, M. Vinciguerra, A. Vandewalle, P.-Y. Martin, and E. Feraille
Dual Effects of Hypertonicity on Aquaporin-2 Expression in Cultured Renal Collecting Duct Principal Cells
J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1571 - 1582.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. T. Lamitina and K. Strange
Transcriptional targets of DAF-16 insulin signaling pathway protect C. elegans from extreme hypertonic stress
Am J Physiol Cell Physiol, February 1, 2005; 288(2): C467 - C474.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Kaur, O. Norkina, D. Ziemer, L. C. Samuelson, and R. C. De Lisle
Acidic duodenal pH alters gene expression in the cystic fibrosis mouse pancreas
Am J Physiol Gastrointest Liver Physiol, August 1, 2004; 287(2): G480 - G490.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. I. Dmitrieva, D. V. Bulavin, and M. B. Burg
High NaCl causes Mre11 to leave the nucleus, disrupting DNA damage signaling and repair
Am J Physiol Renal Physiol, August 1, 2003; 285(2): F266 - F274.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/5/F1020    most recent
00118.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chakravarty, D.
Right arrow Articles by Kültz, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chakravarty, D.
Right arrow Articles by Kültz, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online