|
|
||||||||
1 The Whitney Laboratory, University of Florida, St. Augustine, Florida 32080; 2 Laboratory of Kidney and Electrolyte Metabolism, National Institutes of Health, Bethesda, Maryland 20892-1603; and 3 Department of Animal Sciences, University of California, Davis, California 95616-8521
| |
ABSTRACT |
|---|
|
|
|---|
Mammalian renal inner medullary
(IM) cells routinely face and resist hypertonic stress. Such stress
causes DNA damage to which IM cells respond with cell cycle arrest. We
report that three growth arrest and DNA damage-inducible 45 (GADD45)
isoforms (GADD45
, GADDD45
, and GADD45
) are induced by acute
hypertonicity in murine IM cells. Maximum induction occurs 16-18 h
after the onset of hypertonicity. GADD45
is induced more strongly
(7-fold) than GADD45
(3-fold) and GADD45
(2-fold). GADD45
and
GADD45
protein induction is more pronounced and stable compared with
the corresponding transcripts. Hypertonicity of various forms (NaCl,
KCl, sorbitol, or mannitol) always induces GADD45 transcripts, whereas
nonhypertonic hyperosmolality (urea) has no effect. Actinomycin D does
not prevent hypertonic GADD45 induction, indicating that mRNA
stabilization is the mechanism that mediates this induction.
GADD45 induction patterns in IM cells exposed to 10 different stresses
suggest isoform specificity, but similar functions, of individual
isoforms during hypertonicity, heat shock, and heavy metal stress, when GADD45
induction is strongest (17-fold). These data associate all
known GADD45 isoforms with the hypertonicity phenotype of renal IM cells.
cell cycle; hypertonicity; nephrotoxins; kidney inner medulla
| |
INTRODUCTION |
|---|
|
|
|---|
CELLS OF THE MAMMALIAN RENAL inner medulla are routinely subjected to a wide range of osmolality as part of their function in renal urinary concentration. They express a phenotype that allows them to counteract the threat posed by hypertonicity and other stresses prevalent in the renal inner medulla. Because hypertonic stress represents such an immense threat to most human cells, it is critical to understand the molecular basis of the phenomenon and to study the cellular mechanisms by which cells minimize its consequences. Hypertonic stress damages proteins, leading to their unfolding and malfunction (35). This is compensated for by compatible and counteracting organic osmolytes, which are accumulated during hypertonic stress in many cell types, including renal inner medullary (IM) cells (reviewed in Refs. 4, 14, and 31). DNA is also threatened by hypertonic stress, which increases the amount of DNA double-strand breaks (19) and chromosomal aberrations (13).
Our laboratory previously provided evidence that hypertonicity leads to activation of a complex network of intracellular signaling pathways, including MAPK pathways (20), the p53 pathway (8), and DNA-dependent protein kinases (19). Previous evidence also indicates that the growth arrest and DNA damage-inducible 45 (GADD45) family of genes is part of such networks (20, 33), but little is known about the osmotic regulation of the three mammalian GADD45 isoforms, prompting us to analyze this aspect of the hypertonic stress phenotype of IM cells.
The first GADD45 gene, later designated GADD45
, was cloned on the
basis of its induction by ionizing radiation-induced DNA damage and
cell cycle arrest (12). Subsequently, two other
GADD45 genes have been identified and designated GADD45
and
GADD45
(2, 18, 24, 32, 33, 37). GADD45 proteins are
necessary for maintaining DNA integrity and genome stability in
mammalian cells (16), and their induction is often a
consequence of DNA damage. They are involved in many processes during
cellular adaptation to a diverse array of cellular stresses, including
apoptosis, DNA repair, chromatin regulation, and cell cycle
delay (5, 28). Understanding the osmotic regulation of
GADD45 should help in the identification of the cell functions that are
regulated by these proteins during hypertonic stress.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Culture of murine IM collecting duct 3 cells. Murine IM collecting duct 3 (mIMCD-3) cells of passage 15 were used for all experiments (25). Monolayers were grown to 90% confluency in isosmotic medium consisting of 45% Ham's F-12, 45% DMEM, 10% fetal bovine serum, and 1% of a saline solution containing 10 mU/ml penicillin and 10 µg/ml streptomycin (Invitrogen-Life Technologies). The final osmolality of the medium was 300 ± 5 mosmol/kgH2O, as verified with a vapor pressure osmometer (model 5500, Wescor). Hypertonic media were prepared by addition of the appropriate solute to the isosmotic medium to achieve the desired osmolality. UV irradiation was done in a sterile tissue culture hood by epi-illumination of cell monolayers with a UV-C and UV-B probe (UVP, San Diego, CA). The distance of the lamp to the cell monolayers and the time interval of UV exposure were calibrated to achieve a dose of 500 J/m2. From the beginning of UV irradiation, cells were given a period of 18 h to respond to the UV pulse before they were analyzed, to be consistent with the response period allowed for other stresses and previously published protocols for stressing cells with UV. Chemical toxicants were added to the medium in the concentrations indicated, and cells were exposed to these concentrations for a period of 18 h. Cells were incubated at 37°C and 5% CO2 during all experiments except during heat shock, when they were incubated at 42°C.
Passage 2 mouse IM epithelial cells. Passage 2 mouse IM epithelial (p2mIME) cells were prepared and maintained as described previously (9, 38). Briefly, male mice (4-8 wk old; B6SJL) were killed by cervical dislocation, shaved, and cleaned with an antiseptic solution containing 70% ethanol and betadine. After dissection of the kidneys using aseptic technique, they were transferred into a sterile plastic tube containing PBS. The inner medulla was dissected from both kidneys by using aseptic technique and minced into 1- to 2-mm cubes. These tissue pieces were transferred to an Erlenmeyer flask containing a sterile solution of 500 ml of DMEM/F-12 (no. 21041-025, GIBCO-BRL), 80 mM urea, 130 mM NaCl, 50 mg/25 ml of collagenase B (no. 1088 807, Roche), and 18 mg/25 ml of hyaluronidase (no. 2592, Worthington Chemical). The final osmolality of this solution was ~615 mosmol/kgH2O. The tissue pieces were incubated in this solution under constant agitation (300 rpm) for 90 min at 37°C, humidified air, and 5% CO2. Every 20 min, the cell suspension was mixed by repeated aspiration into a 10-ml pipette. At the end of the enzymatic cell disaggregation, the cell suspension was centrifuged at 160 g for 1 min and washed three times at 37°C. Cells were suspended in 5 ml of medium that contained 45% DMEM (low glucose, no. 99-688-CV, Cellgro), 45% Coon's improved F-12 (no. 99-687-CV, Cellgro), 10% fetal bovine serum, 10 mM HEPES (pKa 7.5, pH 7.5), 5 mg/l T3, 5 pM transferrin, 10 nM selenium, 50 nM hydrocortisone, 2 mM L-glutamine, 2.5 ml/l penicillin G/streptomycin sulfate (10,000 U/ml; no. 936620120, Irvine), 80 mM urea, and 130 mM NaCl. The final osmolality of this medium was 640 mosmol/kgH2O. Cells were seeded into a 6-cm dish (Corning). When confluent, they were split at a 1:4 ratio and grown to confluence. Then, before the experimental manipulation, the medium was switched for 48 h to an otherwise identical one lacking serum and urea and with reduced NaCl, yielding a final osmolality of 300 mosmol/kgH2O. On the basis of our previous studies with p2mIME cells, 48 h are sufficient for them to recover from the hypotonic stress, considering that their subsequent response to hypertonicity is little affected (38). Thus we were able to use a hypertonic stress protocol for p2mIME cells that is comparable to the protocol used for mIMCD-3 cells.
RNA and protein extraction.
For total RNA extraction, cells were lysed in 800 µl/10-cm dish of
denaturing solution (4 M guanidine isothiocyanate, 0.02 M sodium
citrate, 0.5% sarcosyl, and 0.7%
-mercaptoethanol). Total RNA was
isolated by phenol-chloroform extraction (6). The RNA
pellet was quickly resuspended in 50-100 µl of diethyl pyrocarbonate-treated water. A 1-µl aliquot was mixed with 119 µl
of Tris-EDTA buffer (pH 8.0) and used for spectrophotometric quantification of RNA yield. The A260/A280 ratios were typically
2.0.
80°C. Protein concentration was
measured with BCA reagents (Pierce) and a Spectromax Plus microplate
reader (Molecular Devices).
GADD45 cloning and riboprobe generation.
PCR primers for cloning full-length GADD45 cDNAs were designed on the
basis of GenBank nos. NM_007836 (murine GADD45
), NM_008655 (murine
GADD45
), and NM_011817 (murine GADD45
) using Vector-NTI 5.5. The
following primer pairs were used for amplification of the GADD45 coding
sequence from mIMCD-3 cell RNA by RT-PCR: GADD45
, primer 1 = ACTTTGGAGGAATTCTCGGCT and
primer 2 = AATCACGGGCACCCACTGATCCA; GADD45
,
primer 1 = ATGACCCTGGAAGAGCTGGT and primer
2 = CCAGGAGGCAGTGCAGGTCT; and GADD45
, primer
1 = TCTGGAAGAAGTCCGTGGCCA and primer 2 = GATGCTGGGCACCCAGTCGT. The three GADD45 cDNAs were then cloned
into pGEM-T vector (Promega) before they were subcloned into pCDNA5/FRT
vector (Invitrogen-Life Technologies) in reverse orientation such that
in vitro transcription of the insert with T7 polymerase yields
antisense mRNA. Plasmid minipreps were made by using Qiagen kits as
described by the manufacturer, followed by linearization of the
plasmids. The linear DNA template was purified and used for in vitro
transcription with T7 MAXIscript (Ambion). The resulting
riboprobes were labeled with [32P]CTP (NEG508X,
PerkinElmer) and purified by using AquaSelect-D G-25 columns
(Eppendorf-5 Prime) to remove free nucleotides. Purified riboprobes
were recovered in water for subsequent use in Northern blot hybridization.
Northern blot analysis. Seven micrograms of total RNA from each sample were premixed with 5 µl of formaldehyde-formamide loading dye (Ambion) containing ethidium bromide (50 µg/1 ml of loading dye). Samples were heated to 65°C for 15 min, quick-chilled on ice, and centrifuged at maximum speed for 10 s before being loaded into the wells of 1% agarose-formaldehyde gels. Gels were electrophoresed in MOPS buffer and visualized by UV-transillumination in a Fluor-S Multiimager (Bio-Rad). RNA was transferred overnight from the gels to positively charged Biodyne B nylon membrane (Pall) by upward capillary transfer using an alkaline transfer buffer (0.01 N NaOH/3 M NaCl). RNA transfer was followed by cross-linking the RNA to the membrane as described by Sambrook and Russell (26). The membrane was prehybridized in UltraHyb buffer (0.1 ml/cm2; Ambion) at 65°C in a rotisserie-type hybridization oven for 3 h. After prehybridization, radiolabeled riboprobe was added (1:1,000, vol/vol) and allowed to hybridize overnight at 65°C. The membrane was washed twice with low-stringency wash solution (2× SSC; no. 8673, Ambion) for 5 min each, followed by two washes with high-stringency buffer (0.1× SSC; no. 8674, Ambion) for 15 min each, and imaged with a PhosphorImager (Molecular Dynamics). Quantification was done with ImageQuant and QuantityOne software, and values were normalized for 28S rRNA.
Ribonuclease protection assay. Ribonuclease protection assay (RPA) analysis was carried out as described previously (8) by using the RPA III Kit (Ambion). Briefly, antisense, biotin-labeled RNA probes encoding the murine GADD45 mRNAs were synthesized using T7 polymerase (MAXIscript, Ambion) with purified RT-PCR products as templates. Antisense probes were then hybridized with 5 µg of RNA, and nonhybridized RNA was digested using ribonuclease. Protected fragments were separated on 6% Tris-boric acid-EDTA/urea polyacrylamide gels (NOVEX) at 23 mA constant current, followed by transfer of RNA from gels to a BrightStar nylon membrane (Ambion) at 200 mA constant current for 60 min. RNA immobilization to the nylon membrane was achieved by UV cross-linking with a Stratalinker 1800 (Stratagene). A nonisotopic detection kit from Ambion (Bright-Star BioDetect) was used for visualization of biotinylated probes hybridized to GADD45 on the membrane.
SDS-PAGE and Western blot immunodetection.
Proteins were separated by SDS-PAGE as described previously
(20). Equal amounts of protein (20 µg) were loaded in
each lane of 8% Tris/glycine polyacrylamide gels. The first lane of
each gel was loaded with prestained molecular weight standards
(Kaleidoskope, Bio-Rad). Samples were electrophoresed at 125 V constant
voltage, the gels were briefly rinsed in transfer buffer (25 mM Tris,
200 mM glycine, 20% methanol), and proteins were blotted onto
Immobilon P membrane (Millipore) at 1 mA/cm2 constant
current for 90 min by using a Trans-Blot SD semidry transfer cell
(Bio-Rad). Membranes were blocked for 30 min at room temperature in a
solution containing 137 mmol/l NaCl, 20 mmol/l Tris, pH 7.6, with HCl,
0.1% vol/vol Tween-20, 5% wt/vol nonfat dry milk, and 0.02% wt/vol
thimerosal. Then, they were incubated for 3 h in blocking buffer
containing either GADD45
(1:100; sc-792, Santa Cruz Biotechnology)
or GADD45
antibody (1:100; sc-7775, Santa Cruz Biotechnology). After
three washes in blocking buffer, the blots were incubated for 1 h
in blocking buffer containing secondary antibody coupled to horseradish
peroxidase (1:2,000). After more washes, blots were developed with
SuperSignal Femto (Pierce) for 5 min and imaged with a Fluor-S
MultiImager (Bio-Rad). Quantification of GADD45 bands was performed by
using Quantity-One software (Bio-Rad).
Statistics. Data analysis was carried out with STATMOST32 software. Time series effects were evaluated by analysis of variance and differences between values within a single series by a Student's-Newman-Keuls test. Differences between pairs of data for the same time point were analyzed by an F-test followed by either a paired t-test or Mann-Whitney test. The significance threshold was set at P < 0.05, and values represent means of at least three experiments for all data shown.
| |
RESULTS |
|---|
|
|
|---|
All three GADD45 transcripts are induced in response to hypertonic
stress in mIMCD-3 cells.
The expression of GADD45 mRNAs correlates with the adaptation of
mammalian cells to a wide spectrum of genotoxic stresses (15). In addition, we have previously provided evidence
that acute hypertonicity is genotoxic to renal cells (19),
and previous reports have indicated that GADD45
protein and
GADD45
transcript are induced during hypertonicity (20,
33). Therefore, we decided to investigate systematically the
regulation of all three GADD45 transcripts in mIMCD-3 cells after
exposing these cells to hypertonicity, ranging from 400 to 675 mosmol/kgH2O, for 18 h. These experiments show that
the abundance of all three GADD45 mRNAs increases during hypertonicity.
The increase in GADD45 mRNA abundance is statistically significant for
all three GADD45 transcripts and highest when the hypertonic medium has
an osmolality of 600 mosmol/kgH2O (Fig. 1). GADD45
mRNA is induced 2.2-fold,
GADD45
mRNA is induced ~3.3-fold, and GADD45
mRNA is
induced 7.1-fold. Interestingly, we did not observe any significant
induction of any of the GADD45 transcripts during less severe
hypertonicity (400 and 500 mosmol/kgH2O), and the level of
induction was also less at 675 compared with 600 mosmol/kgH2O. Thus the maximum level of induction of all
three GADD45 transcripts coincides with the highest degree of acute, nonlethal hypertonicity that mIMCD-3 cells can tolerate.
|
The hypertonic induction of GADD45 transcripts is transient, but
GADD45 protein induction is more stable.
The kinetics of induction of GADD45 was determined for all three
transcripts, and for GADD45
and GADD45
also at the protein level,
to further our insight into their osmotic regulation and to correlate
GADD45 induction with other adaptive mechanisms utilized by mIMCD-3
cells during hypertonicity. Exposure of mIMCD-3 cells to
hypertonicity of 600 mosmol/kgH2O (NaCl
) causes a rapid
and transient increase of all three GADD45 transcripts, as determined by Northern blot analysis (Fig.
2A). This increase was maximal after 18-h exposure to hypertonicity. As seen also in Fig. 1, the
degree of hypertonic induction of the three GADD45 transcripts in
response to hypertonicity differed considerably, in particular for
GADD45
, which was induced much more strongly than GADD45
and
GADD45
. The kinetics of hypertonic GADD45 induction in p2mIME cells
is very similar to that in mIMCD-3 cells, even though it was analyzed
by RPA and not Northern blotting (Fig. 2B). Maximum levels
of induction were observed at 16 h for all three GADD45 transcripts. The only notable difference between the two cell types
concerns the lesser degree of GADD45
induction in p2mIME cells
compared with mIMCD-3 cells. We performed Western blot experiments for
GADD45
and GADD45
to complement the kinetic data on hypertonic GADD45 mRNA induction at the protein level. Western blot analysis of
these two GADD45 isoforms in mIMCD-3 cells revealed that the kinetics
of hypertonic induction of GADD45 protein lags behind that of the mRNA
induction (Fig. 2C). Even though this is expected, it was
unexpected to see the levels of GADD45
and GADD45
protein still
elevated at 36 h after the onset of hypertonicity, because the
corresponding mRNA levels had already declined to near baseline values
within 24 h (Fig. 2D). In addition, the maximal
hypertonic induction of GADD45
and GADD45
protein is 4.3- and
4.1-fold, respectively, which is almost twice that observed at the
level of mRNA abundance. Thus the increase in the abundance of these two GADD45 proteins appears to be more stable and mediated not only by
increased mRNA abundance but also by additional mechanisms. We did not
succeed in Western blot analysis of GADD45
because no suitable
antibodies were identified.
|
Osmotic regulation of GADD45 transcripts is specific to hypertonic
stress and not seen with urea-imposed hyperosmotic stress.
The next question we addressed was whether the hypertonic induction of
GADD45 transcripts was solute specific. We tested this by comparing
mRNA levels of GADD45 in mIMCD-3 cells after dosing these cells for
18 h in 600 mosmol/kgH2O hyperosmotic medium, created
by addition of NaCl, KCl, sorbitol, mannitol, or urea. Hypertonicity in
any of these forms (NaCl
, KCl
, sorbitol
, or mannitol
)
results in an induction of all three GADD45 mRNA transcripts, although
the degree of induction is variable to some extent (Fig. 3A). Sorbitol has the most
pronounced effect on the abundance of all three GADD45 transcripts. In
contrast, nonhypertonic hyperosmolality resulting from urea addition to
the medium does not induce any GADD45 transcript significantly (Fig.
3B). Surprisingly, the hypertonic induction of GADD45
and, to an even greater extent, GADD45
mRNA is not as strong during
hypertonicity in the form of KCl compared with hypertonicity in the
form of the other solutes tested (Fig. 3). The cause underlying this
effect is unknown. Nevertheless, these data clearly demonstrate that
hypertonicity (i.e., a change in cell volume or intracellular ionic
strength), and not just hyperosmolality per se, is the trigger for the
induction of all three GADD45 transcripts in mIMCD-3 cells.
|
Induction of GADD45 results from mRNA stabilization and not from
nascent mRNA synthesis.
The upregulation of GADD45 transcripts in response to hypertonicity
could be mediated either by increased transcription or by mRNA
stabilization. To differentiate between these two possible mechanisms,
we added actinomycin D to the cell culture medium during hypertonic
stress experiments. Actinomycin D is a commonly used blocker of
transcription that inhibits RNA synthesis. Addition of 10 µg/ml
actinomycin D to mIMCD-3 cells kept in isosmotic medium strongly
inhibits nascent mRNA synthesis of all three GADD45 transcripts. Using
Northern blot analysis, we demonstrate that the reduction of mRNA
abundance is 4-fold for GADD45
and nearly 10-fold for GADD45
and
GADD45
(Fig. 4, A-C,
respectively). For GADD45
and GADD45
, virtually no mRNA is detectable after mIMCD-3 cells are grown for 18 h in isosmotic medium in the presence of actinomycin D. In contrast to the dramatic inhibition of GADD45 mRNA synthesis in
mIMCD-3 cells grown in isosmotic medium, none of the three GADD45
transcripts shows diminished hypertonic induction after mIMCD-3 cells
were dosed in 600 mosmol/kgH2O medium (NaCl
) in the
presence of actinomycin D (Fig. 4). In fact, GADD45
and
GADD45
transcripts even significantly increase in the presence
of actinomycin D (Fig. 4, A and B) while
poly(A)+ RNA and c-abl levels decrease (Fig. 5,
A and B). These
data clearly indicate that the induction of all three mammalian GADD45
transcripts in response to hypertonicity is not a result of increased
nascent mRNA synthesis but instead is due to increased mRNA
stabilization. Because such stabilization of GADD45 transcripts is
absent in isosmotic medium, the mechanisms involved must be activated
by hypertonic stress.
|
|
GADD45 isoforms show distinct profiles of induction in response to
exposure of mIMCD-3 cells to various other stresses.
Because we have shown that all three GADD45 isoforms are induced in
response to hypertonic stress and because this response was found to be
solute specific (urea
did not elicit an increase in any GADD45
mRNA), we asked whether there are discernable differences among the
three isoforms regarding the pattern of GADD45 induction in response to
a whole array of cellular stresses. Thus we carried out a comprehensive
experiment in which mIMCD-3 cells were exposed for 18 h to 10 different stresses that are either known to have effects on cells
similar to those of osmotic stress or have previously been shown to be
genotoxic. We show that despite the uniform hypertonic induction of all
three GADD45 transcripts, there are clear differences with regard to
the stressor-specificity of induction for each GADD45 isoform (Fig.
6). This is particularly evident during
the cellular response to altered extracellular pH. In response to acid
stress (pH 5.5), GADD45
is strongly induced (3.5-fold), whereas
GADD45
is not much affected. In contrast, alkaline stress (pH 9.0)
induces GADD45
significantly (2-fold), whereas GADD45
is
unaffected. The mRNA abundance of GADD45
does not increase in
response to any pH change. mIMCD-3 cells subjected to heat shock
(42°C) respond by significant induction of all three GADD45 isoforms,
but the degree of induction of GADD45
transcript is higher (4-fold)
compared with GADD45
(1.5-fold) and GADD45
(2.6-fold). A cold
shock (2°C) only marginally induces GADD45
transcript (1.5-fold),
whereas the other two GADD45 transcripts do not increase significantly.
The response to UV irradiation (UV-C and UV-A/B) is not very pronounced
and is comparable to that during cold shock. For UV treatment,
cells were irradiated for 40 s at a dose of 500 J/m2
and allowed to recover for 18 h before they were analyzed.
Hydrogen peroxide has a more marked effect than UV radiation, leading
to the induction of all three GADD45 transcripts, although the degree of induction is strongest for GADD45
(2.5-fold) and less for GADD45
(1.6-fold) and GADD45
(1.4-fold). In response to heavy metal toxicity, GADD45
is induced far more potently than the other
two isoforms (Hg2+ stress, 17-fold; Cd2+
stress, 11-fold), although such stress also results in significant induction of GADD45
(Hg2+ stress, 4-fold;
Cd2+ stress, 2.8-fold) and GADD45
(Hg2+
stress, 2-fold; Cd2+ stress, 1.5-fold). Thus GADD45
is
mostly induced during hypertonic, alkaline, heat, hydrogen peroxide,
and heavy metal stress, whereas GADD45
is only induced appreciably
during hypertonic and acid stress and, to some extent, also during heat
and heavy metal stress (Fig. 6). GADD45
is the most strongly induced
isoform during hypertonic and heavy metal stress and is also induced by
heat and H2O2 stress. Clearly, there is overlap
with regard to stressor specificity of particular GADD45 isoforms, but
it is also evident from these data that the induction profile of GADD45
transcripts is far from identical when comparing cellular responses to
various stresses. These data should facilitate the discovery of
biological functions of individual GADD45 isoforms.
|
| |
DISCUSSION |
|---|
|
|
|---|
The ability of renal IM cells to adapt to a severely hyperosmotic
milieu and wide osmotic fluctuations is essential for the renal
concentrating mechanism. Therefore, it is important to understand the
nature of the osmotic threat that these cells face routinely and to
investigate the hypertonic stress phenotype that serves to alleviate
such a threat. Our laboratory previously reported that mIMCD-3 cells
suffer DNA damage during acute hypertonicity (19). This
observation may explain the activation of cell cycle checkpoints and
the p53 pathway in mIMCD-3 cells exposed to hypertonicity (8,
19). In addition, hypertonicity causes induction of GADD45
protein in mIMCD-3 cells (20) and GADD45
mRNA in ML-1
myeloid leukemia cells (33). GADD45 proteins have been
implicated in multiple aspects of cellular stress adaptation that could
be of critical importance during hypertonicity, including DNA repair (29, 30), regulation of cell growth (15),
modulation of chromatin compactness (5), and
apoptosis (28). Despite these potentially critical
functions of GADD45 proteins in hypertonically stressed IM cells, it
was not known before the present study which GADD45 proteins contribute
the most to the hypertonic stress phenotype of renal IM cells and how
the GADD45 isoforms are regulated by hypertonicity.
Our results demonstrate that all three GADD45 transcripts are induced
during hypertonicity in mIMCD-3 cells and in p2mIME cells. We report
different degrees of induction of individual GADD45 isoforms
(GADD45
> GADD45
> GADD45
), which could be reflective of varying significance during hypertonic stress adaptation. GADD45
, which was not previously known to be osmoregulated, is induced most potently by hypertonicity (7-fold) and may be the most
important. The kinetics of GADD45 induction is similar for all three
isoforms and suggests that these proteins are involved in adaptive
events taking place during later stages, i.e., 18-24 h after the
onset of hypertonicity. At this time, most of the increase in mRNA and
protein levels of all three GADD45 isoforms is observed. Such kinetics
does not support a role for any of the GADD45 isoforms in the onset of
cell cycle arrest. Conversely, the kinetics of hypertonic
GADD45 induction supports a role for these proteins in DNA repair after
hypertonicity, which does not have a significant effect until 24 h
after the onset of hypertonicity (19). In this regard, it
is interesting that the amount of all GADD45 transcripts increases up
to 600 mosmol/kgH2O in mIMCD-3 cells but starts to decline
if these cells are exposed to higher osmolalities. We have previously
shown that the same pattern of osmolality dependence applies to the
tumor suppressor protein p53 and to cell survival in mIMCD-3 cells
(8). Apoptosis is much more prevalent in mIMCD-3
cells when the acute hypertonicity exceeds 600 mosmol/kgH2O
(22, 27). In addition, high urea does not cause DNA
double-strand breaks and fails to induce GADD45 or p53. Any increase in
extracellular osmolality that is mediated by nonpermeable solutes
causes hypertonicity (cell shrinkage and increased intracellular ionic
strength) and triggers DNA damage and the induction of GADD45 and p53.
Collectively, these observations suggest that all three GADD45 proteins
may be involved in DNA repair or chromatin modulation rather than
having antiproliferative effects or being proapoptotic during
hypertonicity. Abcouwer et al. (1) suggest that GADD45
could be functionally analogous to traditional stress response genes
such as molecular chaperones, which protect cells from stress-induced
damage and aid in the recovery of cell function after stress.
Hypertonic induction of all three mammalian GADD45 transcripts
apparently is not dependent on nascent mRNA synthesis but is mediated
by means of mRNA stabilization, evidenced by lack of prevention by the
universal transcription inhibitor actinomycin D. Thus the mechanism of
osmotic regulation of GADD45 transcripts differs from that of other
hypertonically regulated genes, most of which are transcriptionally
induced (4). For some of these osmoregulated genes,
including BGT1 and aldose reductase, it is known
that their hypertonic induction is mediated by tonicity-responsive enhancer elements in the 5'-flanking region, named tonicity-responsive enhancers (34) or osmotic response elements
(11). Our finding that actinomycin D blocks nascent GADD45
synthesis in isotonic medium is not surprising and verifies the
well-documented property of actinomycin D to be a universal blocker of
transcription in mIMCD-3 cells. However, we find that actinomycin D
does not elicit any decrease in GADD45 mRNA levels in hypertonic
medium. This observation is consistent with increased mRNA stability of
all three GADD45 transcripts in response to hypertonic stress.
Stabilization of GADD45
mRNA is also seen in Chinese hamster ovary
cells exposed to methyl methanesulfonate and UV irradiation
(17) and in human breast cell lines deprived of glutamine
(1). Interestingly, hypertonicity and actinomycin D have a
synergistic effect on the abundance of GADD45
and GADD45
transcripts in mIMCD-3 cells. This apparent paradox may have its roots
in slight interference of actinomycin D with the RNA degradation
machinery (10). Such interference could be potentiated
during hypertonicity and limit the production of labile regulatory
factors, resulting in enhanced mRNA stability. However, it is unlikely
that such interference is dominant because, unlike in GADD45 genes,
actinomycin D potently inhibits the hypertonic induction of many other
genes, including ATA2, BGT1, and
Cox-2, and the
- and
-subunits of
Na+-K+-ATPase (3, 7, 23, 36). In
addition, our data on actinomycin D effects on overall
poly(A)+ mRNA content and an osmoregulated control
transcript (c-abl tyrosine kinase) illustrate that hypertonicity does
not lead to nonspecific mRNA stabilization but that GADD45 transcripts
are stabilized selectively in hypertonic medium, whereas most other
mRNAs are reduced under these conditions (Fig. 5). Of great interest,
increases in GADD45
and GADD45
protein levels may result in part
from protein stabilization that parallels the mRNA stabilization. Two arguments support this speculation. First, increases in GADD45
and
GADD45
protein abundance (ca. 4-fold) exceed the increases in their
mRNAs (~2- to 3-fold). Second, and perhaps more importantly, both
GADD45 proteins continue to increase in abundance 36 h after the
onset of hypertonicity, when the corresponding transcript levels have
already returned to baseline. An increase in GADD45 stability during
hypertonicity is unusual because most proteins are destabilized by
hypertonicity (31). Nevertheless, the aquaporin 1 protein,
for which hypertonic induction is physiologically relevant, is also
stabilized during hypertonicity (21). In this case, stabilization results from a phosphorylation-dependent decrease in
aquaporin 1 ubiquitination during hypertonicity.
Our laboratory previously provided evidence that GADD45
protein
induction during hypertonicity depends in part on the p38 MAPK pathway
(20). Furthermore, inhibition of p38 MAPK by a specific
inhibitor (25 µM SB-203580) results in partial (50%) suppression of
the hypertonic induction of GADD45
and GADD45
transcripts (data
not shown). Thus proteins involved in GADD45 mRNA stabilization may be
hypertonically induced by means of the p38 MAPK cascade.
We have compared the degree of hypertonic induction for all three
GADD45 transcripts with that in response to other stresses to obtain
information about the relative significance of the three GADD45
isoforms during exposure of mIMCD-3 cells to various insults. These
experiments suggest that although all three GADD45 isoforms are induced
during hypertonic, heat, and heavy metal stress, the degree of
induction differs greatly. In addition, individual GADD45 isoforms show
discernable patterns of specificity with regard to additional types of
stress. GADD45
is involved in adaptation to alkali, cold shock, UV
irradiation, and hydrogen peroxide stress. In contrast, only GADD45
is induced significantly in response to acid stress. The pattern of
stressor specificity of GADD45
induction is dominated by its strong
responsiveness to hypertonic and heavy metal stress. In fact, our study
shows that mercury-induced GADD45
induction represents the highest
degree of induction of any GADD45 transcript under any of the
conditions tested (17-fold). Overall, the hypertonic induction profile
of GADD45 isoforms is most similar to that seen in response to heat
shock and heavy metal stress. This may indicate that induction of all
three GADD45 proteins is critical for cell functions that are common
during adaptation to triple-H stress (hypertonicity, heat, and heavy metal stress). These cell functions remain to be determined. On the
other hand, the relative ineffectiveness of UV radiation for inducing
the GADD45 transcripts may point to the possible involvement of GADD45
in cell functions that are poorly or not at all affected by UV
radiation stress in mIMCD-3 cells. Alternatively, higher doses of UV
radiation may be required to induce an adaptive response. We view the
latter possibility as unlikely because mIMCD-3 cells showed signs of
massive apoptotic cell death in response to the doses of UV
radiation that were used in our study (unpublished observations). UV radiation leads to a special form of DNA
damage, the formation of pyrimidine dimers, suggesting that GADD45 may not be involved in the recognition or repair of this form of DNA damage
in kidney cells. Nevertheless, the GADD45 transcripts are induced by UV
radiation in skin fibroblasts, which in contrast to kidney cells are
exposed to UV radiation under physiological conditions. Thus the
contingencies involved in GADD45 induction and maintenance of genomic
integrity may be cell type specific and reflect the physiological
relevance of a particular stressor.
In summary, we have shown that all three GADD45 isoforms are part of the hypertonic stress phenotype of renal IM cells. Their induction kinetics support a possible involvement in DNA repair and/or chromatin regulation. The induction of GADD45 is dependent on hypertonicity, not seen during isovolumetric hyperosmolality, and is based on mRNA stabilization of all three transcripts. Because the pattern of hypertonic GADD45 induction most closely resembles that seen in response to heat and heavy metal stress, it is likely that these proteins are involved in cell functions that are common for adaptation to these three types of stress. In contrast, individual GADD45 isoforms may be involved in other aspects of cell adaptation during pH, oxidative, and ionizing radiation stress.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by the National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-59470.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: D. Kültz, Dept. of Animal Sciences, Univ. of California, Meyer Hall, 1 Shields Ave., Davis, CA 95616-8521 (E-mail: dkueltz{at}ucdavis.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
July 2, 2002;10.1152/ajprenal.00118.2002
Received 25 March 2002; accepted in final form 27 June 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abcouwer, SF,
Schwarz C,
and
Meguid RA.
Glutamine deprivation induces the expression of GADD45 and GADD153 primarily by mRNA stabilization.
J Biol Chem
274:
28645-28651,
1999
2.
Abdollahi, A,
Lord KA,
Hoffman-Liebermann B,
and
Liebermann DA.
Sequence and expression of a cDNA encoding MyD118: a novel myeloid differentiation primary response gene induced by multiple cytokines.
Oncogene
6:
165-167,
1991[Web of Science][Medline].
3.
Alfieri, RR,
Petronini PG,
Bonelli MA,
Caccamo AE,
Cavazzoni A,
Borghetti AF,
and
Wheeler KP.
Osmotic regulation of ATA2 mRNA expression and amino acid transport System A activity.
Biochem Biophys Res Commun
283:
174-178,
2001[Web of Science][Medline].
4.
Burg, MB,
Kwon ED,
and
Kültz D.
Regulation of gene expression by hypertonicity.
Annu Rev Physiol
59:
437-455,
1997[Web of Science][Medline].
5.
Carrier, F,
Georgel PT,
Pourquier P,
Blake M,
Kontny HU,
Antinore MJ,
Gariboldi M,
Myers TG,
Weinstein JN,
Pommier Y,
and
Fornace AJJ
Gadd45, a p53-responsive stress protein, modifies DNA accessibility on damaged chromatin.
Mol Cell Biol
19:
1673-1685,
1999
6.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
7.
De Angelis, E,
Petronini PG,
Borghetti P,
Borghetti AF,
and
Wheeler KP.
Induction of betaine-gamma-aminobutyric acid transport activity in porcine chondrocytes exposed to hypertonicity.
J Physiol
518:
187-194,
1999
8.
Dmitrieva, N,
Kültz D,
Michea L,
Ferraris JD,
and
Burg MB.
p53 activation by hypertonicity in renal inner medullary epithelial cells (mIMCD3) protects them from apoptosis.
J Biol Chem
275:
18243-18247,
2000
9.
Dmitrieva, NI,
Bulavin DV,
Fornace AJJ,
and
Burg MB.
Rapid activation of G2/M checkpoint after hypertonic stress in renal inner medullary epithelial (IME) cells is protective and requires p38 kinase.
Proc Natl Acad Sci USA
99:
184-189,
2002
10.
Edwards, DR,
and
Mahadevan LC.
Protein synthesis inhibitors differentially superinduce c-fos and c-jun by three distinct mechanisms: lack of evidence for labile repressors.
EMBO J
11:
2415-2424,
1992[Web of Science][Medline].
11.
Ferraris, JD,
Williams CK,
Jung KY,
Bedford JJ,
Burg MB,
and
Garcia-Perez A.
ORE, a eukaryotic minimal essential osmotic response element. The aldose reductase gene in hyperosmotic stress.
J Biol Chem
271:
18318-18321,
1996
12.
Fornace, AJ, Jr,
Alamo IJ,
and
Hollander MC.
DNA damage-inducible transcripts in mammalian cells.
Proc Natl Acad Sci USA
85:
8800-8804,
1988
13.
Galloway, SM,
Deasy DA,
Bean CL,
Kraynak AR,
Armstrong MJ,
and
Bradley MO.
Effects of high osmotic strength on chromosome aberrations, sister-hromatid exchanges and DNA strand breaks, and the relation to toxicity.
Mutat Res
189:
15-25,
1987[Web of Science][Medline].
14.
Handler, JS,
and
Kwon HM.
Kidney cell survival in high tonicity.
Comp Biochem Physiol A Physiol
117:
301-306,
1997[Medline].
15.
Hollander, MC,
and
Fornace AJ, Jr.
Cell cycle checkpoints and growth-arrest genes activated by genotoxic stress.
In: DNA Repair Mechanisms: Impact on Human Diseases and Cancer, edited by Vos JM-H.. Georgetown, TX: Landes, 1995, p. 219-237.
16.
Hollander, MC,
Sheikh MS,
Bulavin DV,
Lundgren K,
Augeri-Henmueller L,
Shehee R,
Molinaro TA,
Kim KE,
Tolosa E,
Ashwell JD,
Rosenberg MP,
Zhan Q,
Fernandez-Salguero PM,
Morgan WF,
Deng CX,
and
Fornace AJJ
Genomic instability in Gadd45
-deficient mice.
Nat Genet
23:
176-184,
1999[Web of Science][Medline].
17.
Jackman, J,
Alamo IJ,
and
Fornace AJJ
Genotoxic stress confers preferential and coordinate messenger RNA stability on the five gadd genes.
Cancer Res
54:
5656-5662,
1994
18.
Kojima, S,
Mayumi-Matsuda K,
Suzuki H,
and
Sakata T.
Molecular cloning of rat GADD45
, gene induction and its role during neuronal cell death.
FEBS Lett
446:
313-317,
1999[Web of Science][Medline].
19.
Kültz, D,
and
Chakravarty D.
Hyperosmolality in the form of elevated NaCl but not urea causes DNA damage in murine kidney cells.
Proc Natl Acad Sci USA
98:
1999-2004,
2001
20.
Kültz, D,
Madhany S,
and
Burg MB.
Hyperosmolality causes growth arrest of murine kidney cells: induction of GADD45 and GADD153 by osmosensing via stress-activated protein kinase 2.
J Biol Chem
273:
13645-13651,
1998
21.
Leitch, V,
Agre P,
and
King LS.
Altered ubiquitination and stability of aquaporin-1 in hypertonic stress.
Proc Natl Acad Sci USA
98:
2894-2898,
2001
22.
Michea, L,
Ferguson DR,
Peters EM,
Andrews PM,
Kirby MR,
and
Burg MB.
Cell cycle delay and apoptosis are induced by high salt and urea in renal medullary cells.
Am J Physiol Renal Physiol
278:
F209-F218,
2000
23.
Muto, S,
Ohtaka A,
Nemoto J,
Kawakami K,
and
Asano Y.
Effects of hyperosmolality on Na, K-ATPase gene expression in vascular smooth muscle cells.
J Membr Biol
162:
233-245,
1998[Web of Science][Medline].
24.
Nakayama, K,
Hara T,
Hibi M,
Hirano T,
and
Miyajima A.
A novel oncostatin M-inducible gene OIG37 forms a gene family with MyD118 and GADD45 and negatively regulates cell growth.
J Biol Chem
274:
24766-24772,
1999
25.
Rauchman, MI,
Nigam SK,
Delpire E,
and
Gullans SR.
An osmotically tolerant inner medullary collecting duct cell line from an SV40 transgenic mouse.
Am J Physiol Renal Fluid Electrolyte Physiol
265:
F416-F424,
1993
26.
Sambrook, J,
and
Russell PW.
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001.
27.
Santos, BC,
Chevaile A,
Hebert MJ,
Zagajeski J,
and
Gullans SR.
A combination of NaCl and urea enhances survival of IMCD cells to hyperosmolality.
Am J Physiol Renal Physiol
274:
F1167-F1173,
1998
28.
Sheikh, MS,
and
Fornace AJJ
Death and decoy receptors and p53-mediated apoptosis.
Leukemia
14:
1509-1513,
2000[Web of Science][Medline].
29.
Smith, ML,
Ford JM,
Hollander MC,
Bortnick RA,
Amundson SA,
Seo YR,
Deng CX,
Hanawalt PC,
and
Fornace AJJ
p53-mediated DNA repair responses to UV radiation: studies of mouse cells lacking p53, p21, and/or gadd45 genes.
Mol Cell Biol
20:
3705-3714,
2000
30.
Smith, ML,
Kontny HU,
Zhan Q,
Sreenath A,
O'Connor PM,
and
Fornace AJJ
Antisense GADD45 expression results in decreased DNA repair and sensitizes cells to u. v-irradiation or cisplatin.
Oncogene
13:
2255-2263,
1996[Web of Science][Medline].
31.
Somero, GN,
and
Yancey P.
Osmolytes and cell volume regulation: physiological and evolutionary principles.
In: Handbook of Cell Physiology, edited by Hoffmann JF,
and Jamieson JD.. Oxford, UK: Oxford University Press, 1997, p. 441-484.
32.
Suzuki, M,
Watanabe TK,
Fujiwara T,
Nakamura Y,
Takahashi E,
and
Tanigami A.
Molecular cloning, expression, and mapping of a novel human cDNA, GRP17, highly homologous to human gadd45 and murine MyD118.
J Hum Genet
44:
300-303,
1999[Web of Science][Medline].
33.
Takekawa, M,
and
Saito H.
A family of stress-inducible GADD45-like proteins mediate activation of the stress-responsive MTK1/MEKK4 MAPKKK.
Cell
95:
521-530,
1998[Web of Science][Medline].
34.
Takenaka, M,
Preston AS,
Kwon HM,
and
Handler JS.
The tonicity-sensitive element that mediates increased transcription of the betaine transporter gene in response to hypertonic stress.
J Biol Chem
269:
29379-29381,
1994
35.
Timasheff, SN.
The control of protein stability and association by weak interactions with water: how do solvents affect these processes?
Annu Rev Biophys Biomol Struct
22:
67-97,
1993[Web of Science][Medline].
36.
Zhang, F,
Warskulat U,
Wettstein M,
Schreiber R,
Henninger HP,
Decker K,
and
Häussinger D.
Hyperosmolarity stimulates prostaglandin synthesis and cyclooxygenase-2 expression in activated rat liver macrophages.
Biochem J
312:
135-143,
1995[Web of Science][Medline].
37.
Zhang, W,
Bae I,
Krishnaraju K,
Azam N,
Fan W,
Smith K,
Hoffman B,
and
Liebermann DA.
CR6: a third member in the MyD118 and Gadd45 gene family which functions in negative growth control.
Oncogene
18:
4899-4907,
1999[Web of Science][Medline].
38.
Zhang, Z,
Cai Q,
Michea L,
Dmitrieva N,
Andrews P,
and
Burg MB.
Proliferation and osmotic tolerance of renal inner medullary epithelial cells in vivo and in cell culture.
Am J Physiol Renal Physiol
283:
F302-F308,
2002
This article has been cited by other articles:
![]() |
M. B. Burg, J. D. Ferraris, and N. I. Dmitrieva Cellular Response to Hyperosmotic Stresses Physiol Rev, October 1, 2007; 87(4): 1441 - 1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Stubbe, K. Madsen, F. T. Nielsen, O. Skott, and B. L. Jensen Glucocorticoid impairs growth of kidney outer medulla and accelerates loop of Henle differentiation and urinary concentrating capacity in rat kidney development Am J Physiol Renal Physiol, October 1, 2006; 291(4): F812 - F822. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Cai, N. I. Dmitrieva, J. D. Ferraris, L. F. Michea, J. M. Salvador, M. C. Hollander, A. J. Fornace Jr., R. A. Fenton, and M. B. Burg Effects of expression of p53 and Gadd45 on osmotic tolerance of renal inner medullary cells Am J Physiol Renal Physiol, August 1, 2006; 291(2): F341 - F349. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. I. Dmitrieva, M. B. Burg, and J. D. Ferraris DNA damage and osmotic regulation in the kidney Am J Physiol Renal Physiol, July 1, 2005; 289(1): F2 - F7. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Hasler, M. Vinciguerra, A. Vandewalle, P.-Y. Martin, and E. Feraille Dual Effects of Hypertonicity on Aquaporin-2 Expression in Cultured Renal Collecting Duct Principal Cells J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1571 - 1582. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Lamitina and K. Strange Transcriptional targets of DAF-16 insulin signaling pathway protect C. elegans from extreme hypertonic stress Am J Physiol Cell Physiol, February 1, 2005; 288(2): C467 - C474. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaur, O. Norkina, D. Ziemer, L. C. Samuelson, and R. C. De Lisle Acidic duodenal pH alters gene expression in the cystic fibrosis mouse pancreas Am J Physiol Gastrointest Liver Physiol, August 1, 2004; 287(2): G480 - G490. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. I. Dmitrieva, D. V. Bulavin, and M. B. Burg High NaCl causes Mre11 to leave the nucleus, disrupting DNA damage signaling and repair Am J Physiol Renal Physiol, August 1, 2003; 285(2): F266 - F274. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |