|
|
||||||||
Departments of 1 Medicine and 2 Radiation Oncology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261
| |
ABSTRACT |
|---|
|
|
|---|
Urinary bladder cystitis occurs in patients receiving radiation therapy for pelvic tumors. Radiation-induced formation of superoxide radicals is believed to damage the urothelium, exposing the underlying bladder smooth muscle to urine, culminating in nerve irritation and muscle dysfunction. We tested whether overexpression of MnSOD could decrease superoxide levels and protect the bladder from radiation damage. Pelvic irradiation led to sloughing of urothelial umbrella cells, with decreased transepithelial resistance, increased water and urea permeabilities, and increased expression of inducible nitric oxide synthase. Six months after irradiation, cystometrograms showed elevated intravesical pressures and prolonged voiding patterns. However, urothelia transfected with the MnSOD transgene recovered from radiation injury more rapidly, and detrusor function was much closer to that of control bladders than irradiated bladders without the transgene. We conclude that MnSOD gene therapy is protective, which could lead to its use in mitigating radiation cystitis and preventing dysfunction of the urinary bladder.
radiation cystitis; urinary bladder; copper-zinc superoxide dismutase; magnesium superoxide dismutase; radioprotective gene therapy
| |
INTRODUCTION |
|---|
|
|
|---|
A LARGE NUMBER OF PATIENTS in the United States undergo irradiation for pelvic malignancies each year. However, the total allowable radiation dose is limited by the potential for developing irradiation-induced cystitis (35). Pathologically, irradiation damage to the bladder occurs in three distinct phases (36). Acute damage after a single dose consists of urothelial swelling, ulceration, and vascular endothelial cell damage. A subacute phase occurs within 4-6 days of radiotherapy, with infiltration of inflammatory cells (30). A third chronic phase is associated with collagen deposition and fibrosis, leading to a decrease in bladder compliance (30, 36). Clinically, the long-term side effects of radiation therapy include decreased bladder volume and increased frequency, urgency, and dysuria (7, 25).
A few studies have investigated the pathological changes associated with irradiation cystitis in animals and humans. In mice receiving <15 Gy (wherein Gy is the absorbed energy of 1 J/kg), 20% developed fibrotic bladders, while all the mice receiving 15-20 Gy exhibited increased frequency and decreased bladder volume (36). Rats irradiated with 20 Gy all exhibited small and contracted bladders 6 mo after treatment (19, 40). In human bladders, subepithelial fibrosis became more extensive with time after irradiation (1). The loss of bladder muscle and damage to vascular endothelial cells and bladder neurons was also evident (39). Thus irradiation may result in damage to multiple bladder cell types, including urothelium, nerve, and muscle. It is presently unclear whether nerve and muscle cell damage is related to the inflammation that accompanies disruption of the bladder permeability barrier.
Although little is known about the mechanism of radiation-induced
urinary bladder damage, ionizing radiation is known to increase formation of superoxide (O




The O



|
| |
METHODS |
|---|
|
|
|---|
Animal groups.
Female Sprague-Dawley rats were divided into five groups with the first
group consisting of control/nonirradiated rats. These rats were
anesthetized but were instilled with only vehicle. The second group
consisted of control/irradiated rats instilled with vehicle and
irradiated to 35 Gy to the bladder 24 h after instillation. A
third group was MnSOD/irradiated rats that were instilled with the
MnSOD-plasmid/liposome (PL) containing 500 µg of MnSOD plasmid DNA
and irradiated to 35 Gy to the bladder 24 h after instillation. The plasmid/liposome complex used in these experiments
contained the pRk5 MnSOD construct (Fig.
1a). A fourth
group consisted of rats instilled with the LacZ-PL in lieu of the
MnSOD-PL and were not irradiated. The fifth group were rats instilled
with a hemagglutin (HA) epitope-tagged MnSOD-PL (HA-MnSOD-PL) and were
also not irradiated.
|
Instillation of the MnSOD-PL and irradiation of the bladder. PL complexes were prepared by mixture of 56 µl of lipofectin liposomes with 600 µg of plasmid DNA in a volume of 200 µl of PBS, incubation at room temperature, and dilution to 600 µl. Female Sprague-Dawley rats were anesthetized with halothane (5% for induction and 2.5% for maintenance) in oxygen, and urethras were catheterized with a 3.5 French Tom Cat catheter. The bladder was then drained and irrigated with 0.5 ml of water to remove the urine, in which high-salt concentration can prevent the PL complex from binding to the umbrella or surface cells of the urothelium. Finally, 0.5 ml of the complex containing 500 µg of pRK5 MnSOD plasmid DNA containing the full human MnSOD transgene (Fig. 1a) was instilled and held in place in the bladder for 10 min to allow for transfection. Alternatively, vehicle alone was instilled for 10 min. The catheter was then removed and the rat was allowed to recover. At 24-h posttransfection, the rats were anesthetized with ketamine/xylazine and given a single dose of irradiation equivalent to 35 Gy. The irradiation was delivered by a 6 MeV Varian linear accelerator, which produces a beam of X-rays. The accelerator was configured to produce the designated output in a 1.5-cm region × 30-cm field at a depth of 100 cm to the skin. This region of the beam was set to encompass the bladder, assuring uniform irradiation. The rats were shielded so that only an area close to the bladder was exposed. Bladders were excised at times ranging from 1 h to 6 mo.
Histopathology for detection of plasmid expression. Rats were injected intravesically with LacZ-PL complexes as described above for MnSOD-PL. The rats were killed 24 h after instillation, and bladders were excised, cut longitudinally, pinned flat, and frozen in optimum cutting temperature embedding medium. Tissues were sectioned (10 µm thick) on a cryostat and stained for LacZ expression.
Confocal immunofluorescence microscopy. Rats were instilled with HA-MnSOD-PL or water only as described above for MnSOD-PL. The animals were killed 24 h later, and bladders were excised, frozen in optimum cutting temperature embedding medium, sectioned, and stained with FITC anti-HA antibodies. Studies were then performed as previously described (20, 22).
Nested RT-PCR for detection of human MnSOD transgene expression in bladder. Groups of rats were injected with MnSOD-PL complexes and killed 24, 48, or 72 h later, and bladders were excised and snap frozen in liquid nitrogen. Bladders were homogenized in 3 ml of TRIzol (GIBCO-BRL) by using a Polytron PT2000 homogenizer (Brinkman Instruments, Westbury, NY). The homogenized samples were incubated for 5 min at room temperature, followed by the addition of 0.6 ml of chloroform, mixed, and incubated at room temperature for 3 min. The samples were centrifuged at 12,000 rpm for 15 min at 4°C. The aqueous phase was removed and transferred to a new tube in which 1.5 ml of isopropyl alcohol was added and incubated at room temperature, followed by centrifugation at 12,000 rpm for 10 min at 4°C. The pellet was washed with 75% ethanol and centrifuged at 7,500 rpm for 5 min at 4°C, air dried, and resuspended in diethyl pyrocarbonate water. Two micrograms of each sample were used in the RT reaction by mixing the RNA with poly-dT, 10 µM mixture of dCTP, dATP, dTTP, and dGTP, and Superscript II RT (GIBCO-BRL). The tubes were incubated for 50 min at 42°C and 10 min at 95°C, followed by incubation at 4°C.
Nested PCR was used to amplify the human MnSOD transgene by using primers specific for the human MnSOD gene (9-11). For the nested reaction, 0.01 µl of the RT reaction was mixed with the first set of 5' and 3' oligonucleotide primers, 10 µM mixture of dATP, dCTP, dTTP, and dGTP, and 0.4 U Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN). The mixture was subjected to 20 cycles of 94, 60, and 72°C (30, 50, and 90 s, respectively) in a Perkin-Elmer (Foster City, CA) 9600 Gene Amp PCR system. A second round of PCR was performed using 1 µl of a 1:100 dilution of the first reaction mixed with 24 µl of the PCR mixture described above, except oligonucleotide primers, internal to the first set of primers and not overlapping in sequences, were used. Thermocycling was identical to the first PCR reaction, except the reaction was 35 cycles. Electrophoresis of the PCR products was carried out in a 1% agarose gel and stained with ethidium bromide. The first set of primers consisted of a 5' primer of CGGCGGCATCAGCGGTAAGCCAGCACTA (nucleotides 61-89) and a 3' primer of TGAGCCTTGGACACCAACAGATGCA (nucleotides 505- 529). The internal primers consisted of a 5' primer of GCTGGCTCCGGCTTTGGGGTATCTG (nucleotides 128-152) and a 3' primer of GCTGAGCTTTGTCCAGAAAATGCTC (nucleotides 388-412). The expected size of the PCR product was 284 bp.MnSOD biochemical activity.
Bladders were instilled with MnSOD-PL as described above. Those rats
were killed along with control/nonirradiated rats at 0-96 h, and
bladders were removed and snap frozen in liquid nitrogen. Bladders were
homogenized and sonicated, and MnSOD biochemical activity was analyzed
with an assay whereby samples having higher levels of MnSOD activity
exhibit a higher percentage of inhibition. Protein concentrations of 0, 75, and 100 µg were added to assay tubes containing 20 mM Tris (pH
7.6), 1 mM diethylenetriaminepentaacidic acid, 1 U of catalase,
5.6 × 10
8 M nitroblue tetarzolium (NBT), 0.1 mM
xanthine, 0.05 mM bathocuproine-disulfonic acid, 10 mg/ml defatted BSA,
and 5 mM sodium cyanide. The tubes were incubated for 45 min at room
temperature. Xanthine oxidase was added and the change in absorbance
was measured at 550 nM.
NO measurement from isolated bladder. In vitro measurement of NO production in isolated bladders was accomplished as previously described (3-5).
Diffusive permeability studies. The transepithelial resistance and [3H]water and [14C]urea permeabilities were measured with a specially designed Ussing chamber as previously described (22, 23, 26, 32, 42).
Scanning electron microscopy. Bladders were handled, fixed, and imaged as previously described (1, 2, 22).
Constant infusion cystometry. Rats were anesthetized with urethane (1.2 g/kg sc) (27-29), and their bladders were catheterized and drained (28, 29). Cystometry was performed as previously described (6, 8, 40), with a constant infusion of PBS to elicit repetitive voids (44, 45).
| |
RESULTS |
|---|
|
|
|---|
The efficiency of transfection of the PL complexes was demonstrated in the bladders of rats instilled with LacZ-PL vs. control/nonirradiated rats killed 24 h later. Bladders from LacZ-instilled rats showed positive LacZ staining that was restricted to the epithelial cell layer (Fig. 1b), whereas bladders from control/nonirradiated rats did not show LacZ staining (Fig. 1c). Rats instilled with the HA-MnSOD-PL also had their bladders removed 24 h after instillation. Immunohistochemical staining of the bladders of rats instilled with the HA-MnSOD-PL was demonstrated with an FITC conjugate antibody to HA and confocal microscopy. Umbrella cells in the bladders of the mice instilled with the HA-MnSOD-PL exhibited fluorescence throughout the cell, indicating the presence of MnSOD (Fig. 1d), whereas bladders of control rats exhibited little fluorescence (Fig. 1e). These results demonstrated that exposing the urothelium to the vector results in the expression of proteins encoded within it.
To determine whether the MnSOD construct leads to production of MnSOD
mRNA, we used nested RT-PCR to detect mRNA with primers specific for
the human MnSOD transgene. Human transgene expression was detected in
the bladders of 11 of 12 rats treated with the MnSOD-PL but none of the
control/nonirradiated rats (Fig.
2A). Human MnSOD transgene
expression was detected for 3 days after instillation. To determine
whether exposure to the MnSOD construct increased MnSOD enzymatic
activity, bladders were removed from rats at 0, 24, 48, and 72 h
after transfection, and the increase in MnSOD biochemical activity was
measured as the percentage of inhibition of the reduction of NBT by SOD
(the 72-h time point was omitted because MnSOD was back to control
levels) (Fig. 2B). In this inhibition assay, increased SOD
activity dismutates O
|
To determine the effects of irradiation and MnSOD transfection on NO
production in the bladder, we measured the free radical with a
prophyrinic microsensor positioned directly on the urothelial surface.
In control/nonirradiated bladders, NO was not basally produced, as
demonstrated by the lack of a baseline shift when the microsensor was
raised off the bladder surface (Fig.
3A). Previous studies have
demonstrated that when the microsensor is elevated >100 µm off the
bladder surface, the NO degrades before it can reach the sensor
(17). However, these bladders did transiently produce NO
in response to the vanilloid receptor agonist capsaicin (Fig.
3A). We have previously demonstrated that capsaicin evokes NO production in both intact urothelium and cultured urothelial cells
(3, 5). Alternatively, in 24-h control/irradiated bladders, there was basal NO production due to inducible nitric oxide
synthase (NOS) expression (Fig. 3B). Unlike the constitutive NOS isoforms, the inducible isoform does not require Ca2+
and thus produces NO constantly. These cells did not respond to
capsaicin. In 24-h MnSOD/irradiated bladders, similar to the control/nonirradiated bladders, the cells did not express inducible NOS
but transiently produced NO in response to capsaicin (Fig. 3C).
|
Transepithelial resistance is a measure of the ability of the
epithelium to prevent ionic movement across the tissue and represents a
critical component of urothelial barrier function. Permeabilities to
water and urea also relate to the integrity of the apical membrane and
tight junctions. To investigate changes in permeability, rats were
killed at 1, 48, and 96 h and 7 and 24 days after 35 Gy (Fig. 4,
A-C). MnSOD
treatment did not prevent the acute changes induced by
irradiation at 1-96 h but did allow transepithelial resistance and
water and urea permeabilities (Fig. 4, A-C,
respectively) to recover to near normal levels within 4 wk. These
barrier functions did not recover in control/irradiated animals.
|
The lowest epithelial resistances were recorded 1-96 h after
irradiation in both MnSOD/irradiated (0.96 ± 0.5 k
· cm2) and control/irradiated
(1.03 ± 0.7 k
· cm2) animals
(Fig. 4A). High resistance averaged 1.97 ± 0.9 k
· cm2 in control animals, with
similar values (1.97 ± 0.4 k
· cm2) being recorded in treated
(MnSOD) animals 1-4 wk after irradiation.
Scanning electron microscopy was used to examine the ultrastructure of
urothelial cells and to evaluate the changes that occur after ionizing
radiation. In control/nonirradiated bladders, the urothelium was intact
(Fig. 5A). However, 48 h
after irradiation (35 Gy), bladders showed areas of superficial
ulceration of the umbrella cells (Fig. 5B). The intermediate
cells can be clearly seen to have gaps in the junctions between cells.
However, the application of the human MnSOD transgene before
irradiation protected the urothelium, because it only showed minimal
ulceration (Fig. 5C). It is notable that irradiated
urothelium in which MnSOD had been induced revealed small surface
cells, indicating regeneration of the urothelium after injury. We have
observed a similar pattern of regeneration of rat urothelium after
selective injury of umbrella cells with protamine sulfate
(21).
|
To determine the effects of irradiation on detrusor function, slow
infusion cystometrograms were performed under urethane anesthesia,
which preserves the voiding function. The cystometrograms for
control/nonirradiated rats showed low baseline intravesical pressures
and even voiding patterns (Fig.
6A). The cystometrograms from
rats at 6 mo postirradiation (35 Gy) showed elevated baseline pressures, instability, and prolonged voiding patterns (Fig.
6B). However, the cystometrograms of rats that were
transfected with the MnSOD transgene showed similar baseline pressures
but more stable voiding patterns (Fig. 6C).
|
| |
DISCUSSION |
|---|
|
|
|---|
The bladder stores, for extended periods, urine that differs markedly in composition from the plasma. Because urine contains many substances that are noxious to normal cells (including high levels of potassium and ammonium, low pH, osmolalities that vary in humans from 50 to 1,200 mosmol/kgH2O, and other toxins), the integrity of the urothelial permeability barrier protects underlying bladder structures from damage and inflammation that would result from exposure to urine.
In the early period after irradiation, urothelial barrier function was compromised equally in bladders treated with MnSOD or with vehicle. However, at later time points, urothelia with enhanced MnSOD activity at the time of irradiation recovered barrier function, whereas those treated with vehicle did not. This difference was reflected as well in the scanning electron micrographs, which reveal much more integrity of the umbrella cell layer in urothelia pretreated with MnSOD transgene. Because MnSOD overexpression lasted only 48 h and the protective effect was noted many days later, it is possible to speculate that MnSOD protected intermediate and basal cells of the urothelium so that they were better able to regenerate umbrella cells in the days after irradiation.
Consistent with prior reports, we found that at 6 mo after irradiation, cystometrograms of irradiated bladders revealed elevated basal tone and irritability. Importantly, pretreatment of urothelium with MnSOD resulted in a more normal voiding at 6 mo than occurred when urothelium was not pretreated with MnSOD. However, baseline pressures remained elevated in MnSOD-treated bladders. Because the nerves innervating the bladder mediate voiding patterns and the compliance of the bladder smooth muscle is involved in baseline pressures, this suggests that exogenous MnSOD was more protective of the bladder nerves. We hypothesize that this is due to the closer proximity of the bladder nerves to the MnSOD-transfected urothelium. The nerves lay directly beneath the urothelium and above the detrusor.
These results provide direct evidence that reducing leakage through the urothelial permeability barrier exerts a long-term protective effect on the underlying bladder wall layers. Because the irradiation was delivered by a linear accelerator set to produce a 35-Gy beam of X-rays in a 1.5-cm-diameter × 30-cm-long field, we can discount the possibility that any portion of the bladder was not irradiated uniformly.
What is the mechanism of this apparent protective effect on urothelium
of enhanced MnSOD expression? Ionizing radiation has been shown to
produce O

On the basis of these results, it appears that MnSOD protects
urothelial cells from apoptotic cell death by reducing damage caused by radiation-induced O
The effectiveness of the MnSOD therapy in reducing the
O


The present data provide potential for translation of MnSOD-PL-based bladder radiation protection to clinical radiotherapy of cervix and vulvar cancer, particularly in patients with bulky disease who may require protracted courses of external beam radiotherapy and/or volumetric brachytherapy implants. Instillation of MnSOD-PLs to the bladder can be carried out 2 or 3 times/wk during a 7-wk course of fractionated radiotherapy. MnSOD-PL administration to the bladder could also be carried out 24 h before brachytherapy source placement, because most interstitial implants for these tumors require single or several fractions of high dose rate brachytherapy or a 2- to 3-day course of low dose rate brachytherapy implants usually lasting 50 h. In either situation, significant protection from acute cystitis and chronic radiation fibrosis might be expected.
With respect to basic radiation biology, the present data suggest that prevention of acute radiation cystitis by MnSOD-PL gene therapy, through mechanisms that block radiation apoptosis and decrease vascular and epithelial cell swelling, in this setting may translate to protection from late radiation fibrosis. The molecular and cellular mechanisms of linkage between the acute inflammatory reaction of cystitis and the late fibrotic reaction are not known. Interruption of the acute inflammatory response by this technique of gene therapy resulted in decreased fibrosis and suggests that the two are linked in ways that could be studied by using this animal model.
In summary, we have shown that radiation directly damages urothelium, leading to loss of its critical barrier function. By using a gene therapy approach, we successfully induced MnSOD selectively in urothelial cells. Induction of MnSOD did not prevent disruption of barrier function by irradiation but led to rapid regeneration of the urothelium and recovery of barrier function. This recovery was associated with reduced spasticity of detrusor function at 6 mo after the injury. We conclude that this gene therapy approach can protect urothelium from radiation damage. These results also provide strong evidence that other forms of chronic bladder dysfunction that may result from urothelial injury (e.g., chemical and chronic infectious cystitis) should respond to approaches that enhance the recovery of the urothelial permeability barrier.
| |
ACKNOWLEDGEMENTS |
|---|
The authors thank Dr. Andre Kalend (West Virginia University Medical School, Morgantown, WV) for assistance in setting up the rats for irradiation treatment and Valerie Dewalt (University of Pittsburgh Medical Center) for assistance in the use of the Radiation Unit.
| |
FOOTNOTES |
|---|
This research was funded by NIH Grants HL-57985 (A. J. Kanai), DK-43955 and DK-48217 (M. L. Zeidel), and HL-60132 (J. S. Greenberger).
Address for reprint requests and other correspondence: A. J. Kanai, Univ. of Pittsburgh School of Medicine, Renal Electrolyte Div., A1224 Scaife Hall, Pittsburgh, PA 15261 (E-mail: ajk5{at}pitt.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajprenal.00228.2002
Received 18 June 2002; accepted in final form 23 July 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Antonakopoulos, GN,
Hicks RM,
and
Berry RJ.
The subcellular basis of damage to the human urinary bladder induced by irradiation.
J Pathol
143:
103-116,
1984[Web of Science][Medline].
2.
Antonakopoulos, GN,
Hicks RM,
Berry RJ,
and
Hamilton E.
Early and late morphological changes (including carcinoma of the urothelium) induced by irradiation of the rat urinary bladder.
Br J Cancer
46:
403-416,
1982[Web of Science][Medline].
3.
Birder, LA,
Apodaca G,
de Groat WC,
and
Kanai AJ.
Adrenergic- and capsaicin-evoked nitric oxide release from urothelium and afferent nerves in urinary bladder.
Am J Physiol Renal Physiol
275:
F226-F229,
1998
4.
Birder LA, Kanai AJ, and de Groat WC. DMSO: effect on bladder
afferent neurons and nitric oxide release. Journal of
Urology 1989-1995, 1997.
5.
Birder, LA,
Kanai AJ,
de Groat WC,
Kiss S,
Nealen ML,
Burke NE,
Dineley KE,
Watkins SC,
Reynolds IJ,
and
Caterina MJ.
Vanilloid receptor expression suggests a sensory role for urinary bladder epithelial cells.
Proc Natl Acad Sci USA
98:
13396-13401,
2001
6.
Burnstock, G,
Cocks T,
Crowe R,
and
Kasakov L.
Purinergic innervation of the guinea-pig urinary bladder.
Br J Pharmacol
63:
125-138,
1978[Web of Science][Medline].
7.
Crane, CH,
Clark MM,
Bissonette EA,
and
Theodorescu D.
Prospective evaluation of the effect of ionizing radiation on the bladder tumor-associated (BTA) urine test.
Int J Radiat Oncol Biol Phys
43:
73-77,
1999[Web of Science][Medline].
8.
Crowe, R,
Vale J,
Trott KR,
Soediono P,
Robson T,
and
Burnstock G.
Radiation-induced changes in neuropeptides in the rat urinary bladder.
J Urol
156:
2062-2066,
1996[Web of Science][Medline].
9.
Epperly, MW,
Bray J,
Krager S,
Zwacka R,
Engelhardt JF,
Travis EL,
and
Greenberger JS.
Prevention of late effects of irradiation lung damage by manganese superoxide dismutase gene therapy.
Gene Ther
5:
196-208,
1998[Web of Science][Medline].
10.
Epperly, MW,
Bray JA,
Bash S,
Berry L,
and
Greenberger JS.
Human MnSOD transgene expression in 32D cl 3 murine hematopoietic progenitor cells protects against irradiation apoptosis through decreased capasase 3 and PARP activation.
Blood
92:
10,
1998.
11.
Epperly, MW,
Bray JA,
Escobar P,
Bigbee WL,
Watkins SC,
and
Greenberger JS.
Overexpression of the human MnSOD transgene in vitro protects 32D cl 3 murine hematopoietic progenitor cells from irradiation-induced apoptosis.
Int J Radiat Oncol Biol Phys
42:
1,
1998[Web of Science][Medline].
12.
Epperly, MW,
Bray JA,
Esocobar P,
Bigbee WL,
Watkins SC,
and
Greenberger JS.
Overexpression of the human MnSOD transgene subclones of murine hematopoietic progenitor cell line 32D cl 3 decreases irradiation-induced apoptosis but does not alter G2/M or G1/S phase arrest.
Radiat Oncol Investig
7:
331-342,
1999[Web of Science][Medline].
13.
Epperly, MW,
Bray JA,
Krager S,
Berry LM,
Gooding W,
Engelhardt JF,
Zwacka R,
Travis EL,
and
Greenberger JS.
Intratracheal injection of adenovirus containing the human MnSOD transgene protects athymic nude mice from irradiation-induced organizing alveolitis.
Int J Radiat Oncol Biol Phys
43:
169-181,
1999[Web of Science][Medline].
14.
Epperly, MW,
Gretton JA,
DeFilippi SJ,
Sikora CA,
Liggitt D,
Koe G,
and
Greenberger JS.
Modulation of radiation-induced cytokine elevation associated with esophagitis and esophageal strictures by manganese superoxide dismutase-plasmid/liposome (SOD-PL) gene therapy.
Radiat Res
155:
2-14,
2001[Web of Science][Medline].
15.
Epperly, MW,
Sikora CA,
DeFilippi SJ,
Gretton JA,
Zhan Q,
Kufe DW,
and
Greenberger JS.
Manganese superoxide dismutase (SOD2) inhibits irradiation-induced apoptosis by stabilization of the mitochondrial membrane.
Radiat Res
167:
71-73,
2002.
16.
Fridovich, I.
Superoxide radical and superoxide dismutases.
Annu Rev Biochem
64:
97-112,
1995[Web of Science][Medline].
17.
Kanai, AJ,
Pearce LL,
Clemens PR,
Birder LA,
VanBibber MM,
Choi SY,
deGroat WC,
and
Peterson J.
Identification of a neuronal nitric oxide synthase in isolated cardiac mitochondria using electrochemical detection.
Proc Natl Acad Sci USA
98:
14126-14131,
2001
18.
Klug-Roth, D,
Fridovich I,
and
Rabani J.
Pulse radiolytic investigations of superoxide catalyzed disproportionation. Mechanism for bovine superoxide dismutase.
J Am Chem Soc
95:
2786-2790,
1972.
19.
Knowles, JF.
Radiation-induced hydronephrosis in the rat: a new experimental model.
Int J Radiat Biol
48:
737-744,
1985.
20.
Lavelle, JP,
Apodaca G,
Meyers SA,
Ruiz WG,
and
Zeidel ML.
Disruption of guinea pig urinary bladder permeability barrier in noninfectious cystitis.
Am J Physiol Renal Physiol
274:
F205-F214,
1998
21.
Lavelle, JP,
Meyers SA,
Ramage R,
Bastacky S,
Doty D,
Apodaca G,
and
Zeidel ML.
Bladder permeability barrier: recovery from selective injury of surface epithelial cells.
Am J Physiol Renal Physiol
283:
F242-F253,
2002
22.
Lavelle, JP,
Meyers SA,
Ruiz WG,
Buffington CA,
Zeidel ML,
and
Apodaca G.
Urothelial pathophysiological changes in feline interstitial cystisis: a human model.
Am J Physiol Renal Physiol
278:
F540-F553,
2000
23.
Lavelle, JP,
Negrete HO,
Poland PA,
Kinlough CL,
Meyers SA,
Hughey RP,
and
Zeidel ML.
Low permeabilities of MDCK cell monolayers: a model barrier epithelium.
Am J Physiol Renal Physiol
273:
F67-F75,
1997
24.
Leach, JK,
Van Tuyle G,
Lin PS,
Schmidt-Ullrich R,
and
Mikkelsen RB.
Ionizing radiation-induced mitochondria-dependent generation of reactive oxygen/nitrogen.
Cancer Res
61:
3894-3901,
2001
25.
Levenback, C,
Eifel PJ,
Burke TW,
Morris M,
and
Gershenson DM.
Hemorrhagic cystitis following radiotherapy for stage 1b cancer of the cervix.
Gynecol Oncol
55:
206-210,
1994[Web of Science][Medline].
26.
Logue, JP,
Sharrock CL,
Cowan RA,
Read G,
Marrs J,
and
Mott D.
Clinical variability of target volume description in conformal radiotherapy planning.
Int J Radiat Oncol Biol Phys
41:
929-931,
1998[Web of Science][Medline].
27.
Maggi, CA,
and
Meli A.
Suitability of urethane for physiopharmacological investigations in various systems. Part 1: general considerations.
Experientia
42:
109-114,
1986[Web of Science][Medline].
28.
Maggi, CA,
and
Meli A.
Suitability of urethane anesthesia for physiopharmacological investigations in various systems. Part 2: cardiovascular system.
Experientia
42:
292-297,
1986[Web of Science][Medline].
29.
Maggi, CA,
and
Meli A.
Suitability of urethane anesthesia for physiopharmacological investigations. Part 3: other systems and conclusions.
Experientia
42:
531-537,
1986[Web of Science][Medline].
30.
McDonald, S,
Rubin P,
Phillips TL,
and
Marks LB.
Injury to the lung from cancer therapy; clinical syndromes, measurable endpoints, and the potential scoring systems.
Int J Radiat Oncol Biol Phys
31:
1187-1203,
1995[Web of Science][Medline].
31.
Mokotoff, M,
Swanson DP,
Jonnalagadda SS,
Epperly MW,
and
Brown ML.
Evaluation of laminin peptide fragments labeled with indium-111 for the potential imaging of malignant tumors.
J Pept Res
49:
510-516,
1997[Web of Science][Medline].
32.
Negrete, HO,
Lavelle JP,
Berg J,
Lewis SA,
and
Zeidel ML.
Permeability properties of the intact mammalian bladder epithelium.
Am J Physiol Renal Fluid Electrolyte Physiol
271:
F886-F894,
1996
33.
Pearce, LL,
Epperly MW,
Greenberger JS,
Pitt BR,
and
Peterson J.
Identification of respiratory complexes I and III as mitochondrial sites of damage following exposure to ionizing radiation and nitric oxide.
Nitric Oxide
5:
128-136,
2001[Web of Science][Medline].
34.
Pearce, LL,
Kanai AJ,
Birder LA,
Pitt BR,
and
Peterson J.
The catabolic fate of nitric oxide: the nitric oxide and peroxynitrite reductase activity of cytochrome oxidase.
J Biol Chem
277:
13556-13562,
2002
35.
Schellhammer, PF,
Jordan GH,
and
Mahdi AM.
Pelvic complications after interstitial and externam beam irradiation of urologic and gynecologic malignancy.
World J Urol
10:
259-268,
1986.
36.
Stewart, FA,
Lundbeck F,
Oussoren Y,
and
Luts A.
Acute and late radiation damage in mouse bladder: a comparison of urination frequency and cysotmetry.
Int J Radiat Oncol Biol Phys
21:
1211-1219,
1991[Web of Science][Medline].
37.
Stickle, RL,
Epperly MW,
and
Greenberger JS.
Plasmid/liposome delivery of the human MnSOD transgene to the murine esophagitis for prevention of irradiation-induced esophagitis.
Proc Am Soc Gene Therapy
60A:
238,
1998.
38.
Stickle, RL,
Epperly MW,
Klein E,
Bray JA,
and
Greenberger JS.
Prevention of irradiation-induced esophagitis by plasmid/liposome delivery of the human manganese superoxide dismutase transgene.
Radiat Oncol Investig
7:
204-217,
1999[Web of Science][Medline].
39.
Suresh, UR,
Smith VJ,
Lupton EW,
and
Haboubi NY.
Radiation disease of the urinary tract: histological features of 18 cases.
J Clin Pathol
46:
228-231,
1993
40.
Vale, JA,
Bowsher WG,
Liu K,
Tomlinson A,
Whitfield HN,
and
Trott KR.
Post-irradiation bladder dysfunction: development of a rat model.
Urol Res
21:
383-388,
1993[Web of Science][Medline].
41.
Wong, GHW
Protective roles of cytokines against radiation: induction of mitochondrial MnSOD.
Biochim Biophys Acta
1271:
205-209,
1995[Medline].
42.
Wu, XR,
and
Sun TT.
Molecular cloning of a 27 kDa tissue-specific and differentiations-dependent urothelial cell surface glycoprotein.
J Cell Sci
106:
31-43,
1993[Abstract].
43.
Yoneda, M,
Katsumata K,
Hayakawa M,
Tanaka M,
and
Ozawa T.
Oxygen stress induces an apoptotic cell death associated with fragmentation of mitochondrial genome.
Biochem Biophys Res Commun
209:
723-729,
1995[Web of Science][Medline].
44.
Yoshiyama, M,
Roppolo JR,
and
de Groat WC.
Effects of MK-801 on the micturition reflex in the rat-possible sites of action.
J Pharmacol Exp Ther
265:
844-850,
1993
45.
Yoshiyama, M,
Roppolo JR,
Thor KB,
and
de Groat WC.
The effects of LY-274614 on the micturition reflex in the urethane-anesthetized rat.
Br J Pharmacol
110:
77-86,
1993[Web of Science][Medline].
This article has been cited by other articles:
![]() |
W. Sun, A. L. Kalen, B. J. Smith, J. J. Cullen, and L. W. Oberley Enhancing the Antitumor Activity of Adriamycin and Ionizing Radiation Cancer Res., May 15, 2009; 69(10): 4294 - 4300. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Zabbarova and A. Kanai Targeted Delivery of Radioprotective Agents to Mitochondria Mol. Interv., December 1, 2008; 8(6): 294 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kanai, J. Roppolo, Y. Ikeda, I. Zabbarova, C. Tai, L. Birder, D. Griffiths, W. de Groat, and C. Fry Origin of spontaneous activity in neonatal and adult rat bladders and its enhancement by stretch and muscarinic agonists Am J Physiol Renal Physiol, March 1, 2007; 292(3): F1065 - F1072. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kanai, M. Epperly, L. Pearce, L. Birder, M. Zeidel, S. Meyers, J. Greenberger, W. de Groat, G. Apodaca, and J. Peterson Differing roles of mitochondrial nitric oxide synthase in cardiomyocytes and urothelial cells Am J Physiol Heart Circ Physiol, January 1, 2004; 286(1): H13 - H21. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |