|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Instituto Nazionale de Ricerca per gli Alimenti e la Nutrizione, 00178 Rome, Italy; and 2 Department of Medicine, University of Adelaide, The Queen Elizabeth Hospital, Woodville, South Australia 5011, Australia
| |
ABSTRACT |
|---|
|
|
|---|
Kidneys play a key role in zinc balance. The portion of Zn(II) that enters the glomerular filtrate is efficiently reabsorbed along the nephron through a mechanism yet to be identified. We used the Zn(II)-specific fluorophore Zinquin to visualize intracellular Zn(II) accumulated in the kidney epithelium and compared it with the intracellular localization of the vesicular zinc transporter ZnT4 both in vivo and in vitro. The Madin-Darby canine kidney (MDCK) cell line, stably overexpressing rat ZnT4, was used as a tissue culture model of the kidney epithelium. Zinquin labeling of MDCK cells revealed rapid internalization of Zn(II) and compartmentalization in intracellular bodies interspersed throughout the cytoplasm. In polarized kidney cells, ZnT4 protein was localized on the membrane of intracellular vesicles concentrated around the nucleus, mostly on the basal side. Results of double stainings demonstrated that ZnT4-containing vesicles do not overlap with Zn(II) bodies. Zinquin fluorescence, confirmed by autometallography in rat kidney, indicated that consistent with its physiological role, the central glomerulus was weakly stained, whereas the epithelium that lines convoluted tubules was strongly labeled. Double staining of rat kidney with Zinquin and anti-ZnT4 antibodies confirmed the in vitro observations, as Zinquin fluorescence appeared to be distinct from ZnT4 immunofluorescence. To gain further insight into which of the known zinc transporters might be involved in Zn(II) metabolism in the kidney, we have also characterized by RT-PCR the expression of other proteins involved in Zn(II) transport. All of the mRNAs examined [ZnT1, -T2, -T4, and human Zrt, Irt-like protein 1 (hZIP1)], with the exception of hZIP2, were present in adult rat kidney.
Zinquin; zinc transporter; polarized cells; zinc homeostasis; renal epithelium; Madin-Darby canine kidney cells
| |
INTRODUCTION |
|---|
|
|
|---|
ZINC IS AN ESSENTIAL DIETARY factor required for enzyme catalysis and as a structural element of metalloproteins. Adequate intake of this trace element is therefore required for normal functioning of cells and tissues. Zn(II) balance is obtained through a controlled rate of intestinal uptake as well as renal reabsorption.
Zn(II) is taken up from the diet and transported across the absorptive epithelium of the small intestine into the bloodstream. Intestinal absorption of all trace elements is tightly regulated, and excess Zn(II) is eliminated through the feces together with the endogenous Zn(II) contained in pancreatic secretions (5). Both saturable and nonsaturable components were shown to be involved in zinc uptake at the level of the intestinal mucosa (34), whereas zinc efflux into the bloodstream has not been fully characterized. The majority of Zn(II) in plasma is bound to albumin, while a small portion circulates, associated with amino acids. This latter portion enters the glomerular filtrate, becoming a source of Zn(II) destined for urinary excretion. Most of the filtered Zn(II) is reabsorbed along kidney proximal tubules; therefore, in nonpathological conditions its urinary loss is minimized. The onset of dietary zinc deficiency induces a decline in urinary Zn(II) concentrations, while plasma levels tend to be constant (2). On the contrary, renal insufficiency and other syndromes, such as diabetes, result in reduced serum Zn(II) concentrations and increased urinary excretion (Ref. 4 and references therein). These observations point to the kidney as being a major organ involved in zinc homeostasis in the body. Despite this, proteins involved in Zn(II) transport, excretion, and reabsorption have been poorly studied in this tissue (28).
Along with other metal ions, Zn(II) is highly charged and cannot cross biological membranes by passive diffusion. Intracellular homeostasis of this ion is achieved by the activity of specific proteins involved in its uptake, efflux, and intracellular compartmentalization. These transport systems are tightly regulated to avoid deficiency or overload. Insights into how cells handle Zn(II) are emerging after the recent cloning of genes encoding several mammalian Zn(II) transporters. Computer-aided analysis of protein sequences, derived both from cloned cDNAs and from genomic sequencing, indicates that Zn(II) transporters can be subdivided into two evolutionarily conserved families: the Zrt, Irt-like protein (ZIP) family, comprising zinc uptake transporters, and the cation diffusion facilitator family, which includes transporters involved in Zn(II) efflux and intracellular compartmentalization (14). Twelve ZIP-encoding genes have been identified in the human genome (12), and two of them, hZIP1 and hZIP2, have been characterized at the molecular level. They were both shown to localize to the plasma membrane and to be capable of Zn(II) uptake in K562 erythroleukemia cells (15, 16). A fourth member of the hZIP family was characterized very recently: it localizes to the apical membrane of enterocytes and was shown to represent the molecular basis of Acrodermatitis enteropathica, a genetic disease resulting in defective intestinal zinc absorption (21, 38). Thus hZIP proteins, which are predicted to have eight membrane-spanning domains, are likely to represent the zinc uptake transporters.
ZnT proteins belong to the cation diffusion facilitator family and
comprise six characterized members in mammals. All ZnTs, with the
exception of ZnT5, have six transmembrane domains, with NH2
and COOH termini located on the cytoplasmic side of the
membrane (reviewed in Ref. 8). They also contain a
conserved histidine-rich domain between transmembrane segments IV and V
that at least in the case of ZnT4, was shown to be capable of binding
metal ions (29). ZnT1 and ZnT2 are involved in Zn(II)
detoxification likely using different mechanisms, because ZnT1 is
localized at the plasma membrane whereas ZnT2 was visualized in the
membrane of intracellular vesicles (30, 32). The
expression of ZnT3 is restricted to the nervous system, and its
function is related to Zn(II) transport into synaptic vesicles
(6). ZnT4 is developmentally regulated in intestinal
epithelial cells (3) and represents the molecular basis of
the lethal milk (lm) mouse syndrome (18); dams
with the lm genotype produce milk with insufficient Zn(II)
content, and pups of any genotype suckling on lm dams die
within a few days (1, 13). Such a phenotype suggests an
important role for ZnT4 in Zn(II) secretion in the mammary epithelium.
Because the ZnT4 gene is ubiquitously expressed and the encoded protein is localized in the membrane of intracellular vesicles
(29), it is likely that this protein plays a broader role
in maintaining cellular zinc homeostasis, which is yet to be
elucidated. The recent isolation of ZnT5 has been independently
reported by two laboratories (10, 20). This protein is
longer than the other ZnTs, but only its COOH-terminal portion displays
homology to ZnT proteins. It appears to associate with secretory
granules in pancreatic
cells (20) and with the apical
membrane of intestinal enterocytes (10). The last ZnT
transporter to be described, ZnT6, has a vesicular localization in
normal rat kidney cells, partially overlapping with the Golgi apparatus
and becoming more peripheral after zinc addition to the culture media
(19).
Total cellular Zn(II) is decreased only slightly in the case of severe zinc deficiency, whereas cell function is deeply impaired. Cellular Zn(II) not tightly associated with metalloproteins is concentrated in discrete subcellular pools and plays a crucial role in a number of important biological processes, including gene expression, DNA synthesis, cell proliferation, and apoptosis (28, 37, 39). This important fraction of free or loosely bound Zn(II) is easily exchanged and can be revealed using ethyl-(2-methyl-8-p-toluenesulfonamido-6-quin-olyloxy) acetate (Zinquin), a specific probe that reacts with nanomolar concentrations of labile Zn(II), giving a strong fluorescent signal. Zinquin was employed to image intracellular pools of Zn(II) in several cell types and tissues, where it highlights the intracellular vesicles rich in this metal. The number and shape of such vesicles depend on cell type (37, 39, 40). An independent technique revealing labile pools of Zn(II) is autometallography (AMG). This method is an improved version of Timm's sulfide silver stain, in which zinc is specifically localized by formation of a complex with sodium selenite that is developed by silver staining (11). Understanding which set of proteins is involved in Zn(II) fluxes in different cell types, how they work to regulate intracellular Zn(II) levels, and how Zn(II) is delivered to metalloproteins is central to understanding the normal physiology of zinc, as well as the abnormalities that might arise in zinc-related diseases. Regulation of zinc transporter expression has been investigated in detail in the yeast Saccharomyces cerevisiae, but not as extensively in mammalian cells (reviewed in Ref. 14). The emerging picture points to both the transcriptional and the posttranscriptional level as key regulatory steps in the expression of proteins involved in zinc metabolism. Transcription of ZnT1 and ZnT2 mRNAs was shown to be upregulated in the small intestine, kidney, and liver by dietary zinc, as well as in response to short-term acute increases in zinc intake (24). ZnT1 transcription appears to depend on metallothionein transcription factor 1 (MTF1), a transcription factor that also regulates metallothionein transcription in response to zinc (22). In the case of ZnT1, however, the zinc-induced increase in mRNA level did not lead to a corresponding increase in protein level, which was only mildly induced in the small intestine (27). ZnT4 mRNA levels, on the contrary, were unchanged under the same experimental conditions (24). Constructs containing fragments up to 3 kb from the ZnT4 promoter region, driving expression of a reporter gene, are not regulated by zinc in transfected cells of different types (unpublished observations). However, recent reports indicate that zinc supplementation of cultured cells induces intracellular relocalization of endogenous ZnT4-containing vesicles from the Golgi apparatus to the cell periphery (Ref. 19 and unpublished observations). Zinc-dependent regulation of the expression of hZIP transporters has not yet been thoroughly characterized. The available data indicate that zinc uptake is a regulated process in some cell types, but only in the case of hZIP1 was a decrease in mRNA level demonstrated in zinc-supplemented cells (7).
In the present paper, we have characterized the expression of proteins involved in Zn(II) transport in rat kidney and have investigated Zn(II) distribution in renal tissue and in the Madin-Darby canine kidney (MDCK)-derived cell line. Comparison of the intracellular localization of the ZnT4 transporter, in relation to that of labile Zn(II) pools, indicates that the majority of ZnT4-containing vesicles are distinct from those containing free Zn(II) both in vivo and in vitro.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
RNA extraction and RT-PCR analysis. Kidneys were removed from adult Sprague-Dawley rats previously anesthetized by intraperitoneal injection of 20 mg/100 g body wt of Farmotal (Farmitalia-Carlo Erba, Milan, Italy). The dissected tissue was immediately frozen in liquid nitrogen, and RNA was extracted from pulverized tissue using TRIzol reagent (GIBCO BRL Life Technologies). Complementary DNA was prepared from 1 µg of total RNA using RT (M-MLV, Life Technologies) and random hexamer primers. First-strand cDNA was PCR amplified with polyTaq enzyme (Polymed), using the following oligonucleotides as primers: ZnT1: AGTAAGCTTGTTTCTCCACAGCGCCGCTCC (sense), ATTGCGGCCGCTGATTCGGGCTGTTTGTTTGGCAC (antisense); ZnT2: GCATGCTCATTAGTCTCTTCTCCCTCTGG (sense), TTCCGAGGGACCCTGGCACTCCTG (antisense); ZnT4: ATGGGCAGGGACGCGCCGGCCTG (sense), GGTACTGGAACTTTGACAATTTGCACA (antisense); hZIP1: TACAAGGAGCAGTCAGGGCCGTCA (sense), CTAGATTTGGATGAAGAGCTGGGCAGT (antisense); hZIP2: ACTTGGCTGCCTGTTTGCCCTGTTG (sense), CTAGCCGCATTCCTACACCAAACAC (antisense); and GADPH: AAACCCATCACCATCTTCCAG (sense), AGGGGCCATCCACAGTCTTCT (antisense).
PCR reactions were performed in a PerkinElmer Gene Amp PCR System 9700.Plasmid cDNA constructs, transfection, and cell culture. Full-length rat ZnT4-myc cDNA was excised from the pcDNA3 vector (Invitrogen, Groningen, The Netherlands) (29) by digestion with BamHI and XbaI and subcloned into the pTRE Not/hyg plasmid (kindly provided by Dr. Michael Francis, Oxford, UK). This vector, containing the tetracycline-responsive element, was modified from the original pTRE vector (Tet-Off system, Clontech Laboratories, Palo Alto, CA) by insertion of the hygromycin resistance gene into the NotI site. Plasmid pTRE-ZnT4-myc was transfected into a stable clone of Tet-off MDCK II cells, expressing the tTa tetracyline repressor (kindly provided by Dr. Keith Mostov, Univ. of California, San Francisco, CA). Cells were transfected using Transfast TM E2432 transfecting agent (Promega, Madison, WI) according to the manufacturer's instructions. Twenty-four hours after transfection, cells were split and selected with 0.2 mg/ml hygromycin B. Resistant colonies were isolated with glass cylinders and amplified. An aliquot of the selected clones was plated on glass coverslips in doxycycline-free medium, and positive clones expressing the ZnT4-myc protein were screened by immunofluorescence with anti-myc monoclonal antibodies (Sigma, St. Louis, MO). Expressing clones, corresponding to ~10% of hygromycin-resistant clones, were maintained in high-glucose DMEM supplemented with 10% FBS, 0.1 mg/ml hygromycin, and 20 ng/ml doxycycline. Transgene expression was turned on by passaging cells in fresh medium lacking doxycycline. Cells were subcultured twice a week at a split ratio of 1:20, and the culture medium was replaced every 2-3 days. As a negative control of Zinquin staining, cells were either incubated with the intracellular Zn(II) chelator [N,N,N',N'-tetrakis(2-pyridylmethyl)ethylendiamine] (TPEN; 25 µM; Sigma) at 37°C for 30 min in complete culture medium or starved overnight in DMEM without serum. Cells treated with TPEN for up to 2 h were stained with bisbenzimide (Roche, Basel, Switzerland). Zinc uptake was observed by incubating starved cells with increasing concentrations of ZnSO4, up to 100 µM, in Hanks' buffer (Flow Laboratories, Irvine, UK) at 37°C for 30 min.
Tissue processing, immunofluorescence, immunoblotting, and
antibodies.
Rats were killed by asphyxiation with CO2. For frozen
tissues, the entire kidney was excised and transverse sections of the tissue were quickly placed into plastic embedding trays containing OCT
and snap-frozen on dry ice. Tissue sections (5 µm) were left to
adhere on coated glass slides at room temperature for 20 min. Sections
were fixed in 100% chilled acetone for 10 min at room temperature
before tissue staining. Cells were grown on glass coverslips or on
transparent filters (Transwell-Clear; Corning Life Sciences) where
indicated. All methods for immunolocalization have been described
previously (29). Primary antibodies used in this study
were the following: mouse mAb anti-c-myc (1:200; clone 9E10 Sigma);
mouse mAb anti-ZO1 (1:300; Zymed Laboratories, South San Francisco,
CA); rat mAb anti-
6-integrin subunit (1:200; clone GoH3,
Pharmingen, San Diego, CA); rabbit polyclonal anti-c-myc (Santa Cruz,
CA). Polyclonal anti-ZnT4 was raised against a chimeric protein
consisting of bacterial glutathione-S-transferase, fused in-frame with the NH2 terminus (aa 1-116) of ZnT4,
expressed in the BL21 strain of Escherichia coli and
purified by agarose-glutathione affinity chromatography (Sigma). The
fusion protein was injected in rabbits, and antiserum was used at 1:200
dilution. ZnT4 anti-serum recognizes a single band of ~43 kDa on
Western blots containing lysates from ZnT4-overexpressing cells but no
reaction with lysates from untransfected MDCK cells (data not shown).
Preimmune serum fails to react with recombinant and endogenous ZnT4
both by Western blotting and by immunohistochemistry. All secondary
antibodies, labeled with either tetramethylrhodamine isothiocyanate or
FITC, were affinity purified and species specific (Jackson
ImmunoResearch Laboratories, West Grove, PA). Total protein extracts
from induced and uninduced cells were prepared by lysing the same
number of cells in 1% SDS, 5 mM Tris · HCl, pH 6.8 (26). Equal volumes of lysates were tested for protein
content, subjected to SDS-PAGE, and transferred to nitrocellulose
(Schleicher & Schuell, Dassel, Germany). Antigen-antibody complexes
were detected with horseradish peroxidase-conjugated secondary Abs by
enhanced chemiluminescence SuperSignal (Pierce, Rockford, IL).
Zinquin staining and AMG. Cells fixed in 4% paraformaldehyde for 15 min or cryostat sections were incubated for 30 min in 25 µM Zinquin (Dept. of Chemistry, Univ. of Adelaide, Adelaide, Australia), freshly diluted in 1× PBS. Where indicated, cells and tissue were processed for immunofluorescence before Zinquin staining. Fluorescence microscopy was performed on a Zeiss Axioskop II. A Bio-Rad MRC-1000 ultraviolet laser scanning confocal microscope system, equipped with ultraviolet-argon laser, was used in combination with a Nikon Diaphot 300 inverted microscope in fluorescence mode for Zinquin; fluorescence excitation was at 351/8 nm and emission at 460LP, whereas for FITC fluorescence excitation was at 488/10 nm and emission at 522/35. Images were collected using a ×40 water-immersion objective lens with a numerical aperture of 1.15. Each image was averaged over six scans by Kalman filtering. Where dual staining was performed, fluorescence images were merged using the Confocal Assistant (version 4.02) software package. For the AMG experiments, rats received either sodium selenite (20 mg/kg ip, Sigma) for 45 min or no treatment (control). Rats were anesthetized with Nembutal and then maintained on halothane. The abdomen was opened, and kidneys were fixed by retrograde perfusion via the aorta with 3% glutaraldehyde in 1× PBS. The kidneys were removed, postfixed for 1 h, cut into three pieces, and fixed further overnight at room temperature. Vibratome sections (100 µm) were cut and transferred to a beaker of 1× PBS and then distilled water, dipped in a 0.5% gelatin (Merck, Rahway, NJ) solution, placed in AMG developer (11), and developed floating in the developer. These were examined by light microscopy; brown staining indicates the presence of Zn(II).
| |
RESULTS |
|---|
|
|
|---|
Zn(II) distribution and expression of Zn(II) transporters in kidney
epithelium.
To image the pool of labile Zn(II), cryosections of rat kidney were
stained with Zinquin. Zinquin is a highly specific fluorescent probe
able to detect nanomolar concentrations of intracellular stores of
Zn(II). It has been used to map pools of labile Zn(II) in several cells
and tissues (9, 37). To date, there are no data reported
for the kidney intracellular Zn(II) store. The results in Fig.
1, A and B, show
that epithelial cells lining convoluted tubules are strongly positive
for Zinquin staining, consistent with the active role of these cells in
Zn(II) reabsorption. This pattern was confirmed using AMG (Fig.
1C), which also shows the lack of Zn(II) in the glomeruli.
Reabsorption of Zn(II) requires the activity of specialized proteins;
therefore, we next sought to determine which of the best characterized
proteins responsible for Zn(II) uptake and transport were expressed in
kidney cells. Four ZnT and three hZIP transporters have been
characterized in mammals, and we compared the expression of their
transcripts in the kidney by RT-PCR. The results in Fig. 1D
show that with the exception of hZIP2, all mRNAs examined (ZnT1, T2,
T4, and hZIP1) appear to be simultaneously expressed in the kidney.
ZnT3 was not tested as its expression is known to be restricted to
brain and testis (31).
|
Zn(II) transport and ZnT4 expression in MDCK cells.
The canine kidney cell line MDCK is a widely used tissue culture model
of kidney epithelium (25). To ascertain the feasibility of
this tissue culture model for our studies of zinc transport and ZnT4
expression, we initially investigated the main features of zinc
metabolism in this cell line. As shown in Fig.
2A, MDCK cells express
endogenous ZnT4, as determined by RT-PCR. We then used Zinquin staining
to study the distribution of intracellular labile Zn(II). Figure
2B shows a fluorescence microscopic image of the
characteristic starry sky pattern of Zinquin labeling in fully
differentiated MDCK cells. As shown in Fig, 2B,
left, significant amounts of intracellular labile Zn(II)
were concentrated within intracellular vesicles in these cells.
Treatment with the chelating agent TPEN, which tightly binds
intracellular Zn(II), resulted in almost a complete loss of Zinquin
fluorescence (Fig. 2B, middle), bisbenzimide
staining of nuclei assessed a lack of apoptosis in this
experimental condition (Fig. 2B, right). To
characterize Zn(II) uptake in these cells, Zinquin staining was
performed in Zn(II)-starved cells, before and after addition of
increasing concentrations of ZnSO4 within the physiological
range. Overnight incubation in medium lacking serum led to a dramatic
loss of fluorescence from zinc-containing vesicles (Fig. 2C,
left). Zn(II)-starved cells, incubated in HBSS buffer with
25 or 100 µM ZnSO4 for 30 min, efficiently accumulated
zinc in intracellular bodies, showing a concentration-dependent
increase in Zinquin fluorescence (Fig. 2C, middle
and right). Taken together, these results demonstrate that
MDCK cells are capable of efficient Zn(II) uptake, efflux, and
intracellular compartmentalization. Therefore, this cell line represents a good in vitro model for the study of Zn(II) metabolism in
kidney epithelium.
|
Creation of a stable MDCK cell line overexpressing ZnT4.
The transmembrane Zn(II) transporter ZnT4 localizes in the membrane of
intracellular vesicles of different cell types. The Zn(II) vesicular
pattern that we observed in these cells is closely reminiscent of the
vesicular distribution of ZnT4. Our laboratory and others have
previously shown by Northern hybridization that ZnT4 mRNA is expressed
in rat kidney (24, 29). Moreover, our results of RT-PCR
analysis show that the ZnT4 mRNA is transcribed in kidney-derived MDCK
cells (Fig. 2A). For these reasons, we sought to investigate
whether ZnT4 was involved in vesicular sequestration of Zn(II) and
whether its overexpression affects zinc homeostasis. Using a
constitutive expression vector driving ZnT4 transcription from a viral
promoter, we were unable to select stable transfectants expressing
ZnT4, suggesting that long-term overexpression of this transporter is
probably toxic to cells. To circumvent this problem, we resorted to an
inducible expression system, by placing the open reading frame of a
myc-tagged rat ZnT4 cDNA construct under the control of the bacterial
tetracycline promoter (17). This construct was transfected
into a clone of MDCK cells that stably expresses the bacterial
tetracycline repressor (MDCK Tet-off; kindly provided by Dr. Keith
Mostov). Several lines of stable clones were selected and monitored for
the expression of ZnT4. Figure 3 shows
how withdrawal or addition of the tetracycline analog doxycycline to
the culture medium tightly regulates ZnT4 expression in independent
clones of stably transfected MDCK Tet-off (ZnT4-myc) cells. Using
Western blotting (Fig. 3A) and indirect immunofluorescence
(Fig. 3B), we observed that addition of doxycycline completely abolishes the expression of the transfected cDNA. Anti-myc antibodies revealed the characteristic vesicular localization of ZnT4
(Fig. 3B) in expressing clones cultured without doxycycline. Ten independent subclones were screened both by Western blotting and by
immunofluorescence with anti-myc antibodies, and no significant differences were detected in the expression levels or in the
intracellular localization of the transfected protein. Therefore,
further experiments were carried out in three independent MDCK Tet-off
(ZnT4-myc) subclones.
|
ZnT4 accumulates in a perinuclear vesicular compartment.
We have previously demonstrated that in nondifferentiated epithelial
cells, ZnT4 is localized in a subset of endosomes also containing
transferrin receptor and the
-subunit of the clathrin adaptor
complexes AP-1/2 (29). To further investigate
whether such vesicles had a polarized distribution within the cell, we performed confocal laser scanning microscopy analysis in confluent, fully polarized MDCK subclones overexpressing ZnT4. The results shown
in Fig. 4 revealed that ZnT4-containing
vesicles were distributed around the nuclei, the majority of them being
clustered on the basal side. Figure 4A shows a basal
section of the cell monolayer with strongly stained vesicles
superimposed on a less intense signal of reticular appearence, most
likely representing endoplasmic reticular staining. Figure 4,
B-D, shows that in progression toward the
apical domain of the cells, vesicles tend to decrease in number while
concentrating around the nuclei. Such a distribution is clearly evident
in Fig. 4E, showing a vertical section of the monolayer
along the X-Z axis. Figure 5
shows the results of double-staining experiments performed using the
anti-myc antibody in combination with antibodies directed either
against the
6-integrin subunit, which is associated with
the basolateral plasma membrane, or against zonula occludens (ZO)-1, a
tight junction-specific protein (35, 36). In single
X-Y sections acquired with the confocal microscope, ZnT4-containing vesicles are visible at the level of both tight junctions (Fig. 5A) and basolateral membranes (Fig.
5B). The analysis along the X-Z axis of the
distribution of ZnT4 relative to the junctional marker ZO-1 confirms
that the majority of vesicles are concentrated at the basal side of
polarized MDCK cells (Fig. 5C).
|
|
ZnT4-containing vesicles are not superimposed on Zn(II)-containing
vesicles.
To assess whether MDCK cells concentrate labile Zn(II) in the same
vesicles that contain ZnT4, double-staining experiments were performed
with anti-myc antibodies (FITC immunofluorescence) and Zinquin
(ultraviolet fluorescence). The results are shown in Fig.
6 for both subconfluent, nonpolarized
cells (Fig. 6, A and B) and fully polarized cells
(Fig. 6, C-H). Although both Zinquin and
ZnT4 stainings showed a similar pattern of vesicular cytoplasmic
distribution, a close observation failed to reveal any extensive
overlapping of the two sets of vesicles when the only source of Zn(II)
was that normally present in complete culture medium (Fig. 6,
A-D). To verify whether depletion or
addition of zinc could affect ZnT4 localization relative to
Zn(II)-loaded vesicles, cells overexpressing ZnT4 were incubated
overnight in medium lacking serum. TPEN was not used to chelate Zn(II)
in this set of experiments because it interferes with Zinquin staining. Serum-starved cells were then incubated with 100 µM ZnSO4
to stimulate Zn(II) uptake. The results showed that neither Zn(II)
starvation (Fig. 6, E and F) nor Zn(II)
supplementation (Fig. 6, G and H) would induce
colocalization of ZnT4-containing vesicles with intracellular Zn(II)
bodies highlighted by Zinquin.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The kidney epithelium is the site of urinary zinc excretion and reabsorption. This tissue plays a key role in the maintenance of the homeostasis of this essential trace element in the body. The physiological role of renal epithelial cells within this context is zinc reabsorption from the glomerular filtrate to minimize body loss of this essential trace element. At the cellular level, this is achieved through the expression of proteins specifically involved in zinc uptake, intracellular compartmentalization, transport, and efflux, some of which have been cloned and characterized at the molecular level. In this paper, we attempt to answer some questions concerning the mechanism by which kidney epithelial cells handle intracellular Zn(II).
We initially sought to investigate which of the zinc transporters might be responsible for maintaining zinc homeostasis in kidney cells by performing an expression analysis of zinc transporters belonging to the ZnT and hZIP protein families in rat kidney. The results of RT-PCR analysis show that ZnT1, ZnT2, and ZnT4, as well as hZIP1, are all expressed in this tissue, whereas hZIP2 mRNA is not present. Coexpression of different ZnT proteins is not surprising, because, despite their high degree of sequence and structural homology, they display distinct intracellular localizations and are likely to play different roles in zinc handling. On the contrary, both hZIP1 and hZIP2 were shown to participate in cellular Zn(II) uptake (15, 16). The expression of hZIP2 in different tissues and cell lines was postulated to be either very low or absent as it was not possible to detect it by Northern hybridization (15). Our results, obtained with a more sensitive technique such as RT-PCR, indicate that hZIP2 mRNA is indeed absent in kidney cells. Therefore, it seems more likely that this gene is expressed only in a restricted number of tissues, whereas hZIP1 is ubiquitously expressed (16). The scenario that has emerged is that the apparent redundancy of zinc transport functions is probably counterbalanced by their distinct expression profiles in each tissue. Expression of the two vesicular transporters ZnT2 and ZnT4 overlaps only in a restricted number of cell types (31), and the same is true for hZIP1 and hZIP2, both responsible for Zn(II) uptake (16).
ZnT1 was localized to the plasma membrane and postulated to act as a zinc efflux transporter (27). On the contrary, both ZnT2 and ZnT4 appear to be inserted in the membrane of intracellular vesicular compartments (30). Moreover, ZnT4 represents the molecular basis of the lethal milk mouse phenotype (18), characterized by a zinc secretion defect in mammary epithelial cells (1, 23). Given the intracellular localization of ZnT2 and ZnT4, both transporters have been hypothesized to play a role in vesicular sequestration of excess cytoplasmic Zn(II). According to this model, zinc-loaded vesicles could eventually fuse with the plasma membrane and complete the detoxification process by extruding Zn(II) ions into the extracellular space. However, colocalization of ZnT4-containing vesicles with Zn(II) bodies was never demonstrated.
In this paper, we show that MDCK cells, derived from kidney epithelium, express ZnT4 mRNA. We have imaged the intracellular zinc pool in these cells using Zinquin, a fluorescent probe specific for Zn(II) ions. Zinquin binds free Zn(II) as well as Zn(II) loosely bound to proteins such as metallothionein (9). When compared with other cell types, including airway epithelial cells (37) and intestinal cells (unpublished observations), MDCK cells, cultured in standard medium without further zinc supplementation, show intense Zinquin staining concentrated in intracellular vesicles. This observation suggests the presence of a very efficient, constitutively expressed system for Zn(II) uptake and compartmentalization that could be further stimulated by the addition of 25-100 µM ZnSO4 to the culture medium. To compare these results with the in vivo distribution of free Zn(II), which had not been previously determined for the kidney, cryosections of rat tissue were stained with Zinquin. The results revealed a strong signal in the epithelium of the convoluted tubules, whereas the central glomerulus was only weakly labeled. This was shown independently by AMG staining. The ability of kidney tubule cells to accumulate free Zn(II) is consistent with their role in reabsorption of this ion from the glomerular filtrate. Overall, the results of Zn(II) imaging in vivo and in vitro show the ability of differentiated renal epithelial cells to accumulate free Zn(II) and store it in intracellular bodies dispersed throughout the cytoplasm.
In the past few years, our laboratory has been involved in cloning and in the molecular characterization of a rat ZnT4 cDNA (3, 33). In this paper, we sought to investigate whether there was a relationship between the vesicular pools of free Zn(II) and ZnT4 localization in this kidney-derived cell system. This question was approached by creating stably transfected clones of MDCK cells overexpressing a myc-tagged rat ZnT4 protein in a regulated fashion. Intracellular localization of free Zn(II) and of the ZnT4 protein was compared in the stably transfected subclones of MDCK cells overexpressing ZnT4. The experiments were conducted under different conditions of zinc loading to take into account a possible zinc-dependent regulation of Zn(II) bodies or ZnT4 localization. We have shown that in both fully polarized and in undifferentiated cells, Zn(II)-containing vesicles are interspersed within the cytoplasm with a pattern resembling that of ZnT4. Double staining with anti-myc antibodies and Zinquin, however, did not show extensive overlapping between the two sets of vesicles. This result was confirmed by double staining of kidney sections with Zinquin and anti-ZnT4 antibodies. Neither zinc depletion nor zinc loading of MDCK cells with up to 150 µM ZnSO4 affected ZnT4 distribution relative to Zn(II)-loaded vesicles.
In the MDCK Tet-off subclones, ZnT4 displays the same vesicular
localization that we had previously observed in Caco-2 and COS cells
(29). Our laboratory has also previously shown that ZnT4
partly colocalizes with the transferrin receptor and the
-subunit of
the clathrin adaptor complexes AP-1 and AP-2 in a subpopulation of
endosomal vesicles (29). Because in sections of rat small
intestine ZnT4 vesicles appear to concentrate in the basal side of
differentiated enterocytes, we have exploited the capacity of MDCK
cells to fully differentiate into a monolayer of polarized epithelium
to further investigate by confocal microscopy whether ZnT4-containing
vesicles were differentially distributed into the apical and the basal
domains in kidney epithelium. The position of ZnT4-containing vesicles
within polarized cells was assessed by confocal microscopic analysis of
double-stained cells with antibodies specifically recognizing ZnT4 and
the polarity markers ZO-1 (identifying apical tight junctions) or the
6-integrin subunit (identifying the basolateral plasma
membrane). These experiments have shown that the majority of
ZnT4-containing vesicles are found in the basal domain of polarized
cells, with perinuclear localization. Fewer vesicles appear scattered
throughout the cytoplasm up to the level of tight junctions. Such
intracellular distribution, which is compatible with a role in
basolateral secretion, does not rule out a function for ZnT4 in
regulating the intracellular distribution of Zn(II).
Overall, our results indicate that despite the apparently analogous vesicular localization of the two transporters, ZnT4 is distinct from ZnT2, which was shown to fully colocalize with free Zn(II) (30). It is interesting to note, however, that ZnT2 and ZnT4 are coexpressed in intestinal and kidney epithelial cells, whereas only ZnT4 is present in the mammary epithelium (24), where the most dramatic phenotype is manifested in the lethal milk mouse syndrome. From a functional viewpoint, the mammary gland-restricted phenotype in adult lm mice lacking a functional ZnT4 protein indicates that although the two vesicular transporters do not appear to colocalize in Zn(II)-loaded vesicles, they might still be able to play partially overlapping roles in handling the vesicular Zn(II) pool. However, while ZnT2 was shown to confer zinc resistance to transfected cells (30), overexpression of ZnT4 in our in vitro cell model did not alter the cell sensitivity to the addition of increasing Zn(II) concentrations to the culture medium. When ZnT4-transfected subclones and the parental cell line are compared for the effect of Zn(II) toxicity on tight junctional integrity (as measured by transepithelial electrical resistance and inulin passage) and cell survival (evaluated by neutral red uptake), no differences were detected (data not shown). A possible explanation for the lack of a zinc transport-related phenotype in ZnT4-transfected MDCK cells could be that overexpression of ZnT4 alone is not sufficient to enhance its function. In support of this latter hypothesis, we have previously demonstrated with pull-down experiments that the NH2-terminal segment of ZnT4 specifically interacts with at least one yet unknown partner that might be necessary for ZnT4 function and required at stoichiometric concentrations. Further research is presently ongoing in our laboratory to uncover the identity of the ZnT4-interacting protein(s).
Overall, the results of our study underline the key role of kidney cells in zinc metabolism, as we demonstrate very efficient Zn(II) uptake and intracellular accumulation both in vivo and in vitro. The fate of vesicular free Zn(II), once it has entered renal epithelial cells, as well as which of the zinc transporters might be responsible for delivery of vesicular zinc to the bloodstream remain to be established and will represent a challenge for future research in this field.
| |
ACKNOWLEDGEMENTS |
|---|
The authors thank K. Mostov and M. Francis for providing cells and plasmids used in this work. We are indebted to M. Molinari and S. Biocca for help with confocal microscopy. We also thank G. Danscher and M. Stoltenberg for assistance with the AMG studies and S. Frische for the kidney perfusion. We also thank P. Rami and R. Rami for taking care of the animals.
| |
FOOTNOTES |
|---|
This work was supported in part by the CNR Target Project on "Biotechnology." C. Murgia was the recipient of a short-term fellowship from the Human Frontier Science Project Organization.
Address for reprint requests and other correspondence: C. Murgia, INRAN, Via Ardeatina 546, 00178 Rome, Italy (E-mail: murgia{at}inran.it).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
August 13, 2002;10.1152/ajprenal.00094.2002
Received 11 March 2002; accepted in final form 30 July 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Ackland, ML,
and
Mercer JFB
The murine mutation, lethal milk, results in production of zinc-deficient milk.
J Nutr
122:
1214-1218,
1992
2.
Baer, M,
and
King J.
Tissue zinc levels and zinc excretion during experimental zinc depletion in young men.
Am J Clin Nutr
39:
556-570,
1984
3.
Barilà, D,
Murgia C,
Nobili F,
Gaetani S,
and
Perozzi G.
Subtractive hybridization cloning of novel genes differentially expressed during rat intestinal development.
Eur J Biochem
223:
701-709,
1994[Web of Science][Medline].
4.
Brandão-Neto, J,
Silva C,
Shuhama T,
Silva J,
and
Oba L.
Renal handling of zinc in insulin-dependent diabetes mellitus patients.
Biometals
14:
75-80,
2001[Web of Science][Medline].
5.
Brody, T.
Nutritional Biochemistry. San Diego, CA: Academy, 1994.
6.
Cole, T,
Wenzel H,
Kafer K,
Schwartzkroin P,
and
Palmiter RD.
Elimination of zinc from synaptic vesicles in the intact mouse brain by disruption of the ZnT3 gene.
Proc Natl Acad Sci USA
96:
1716-1721,
1999
7.
Costello, L,
Liu Y,
Zou J,
and
Franklin R.
Evidence for a zinc uptake transporter in human prostate cancer cells which is regulated by prolactin and testosterone.
J Biol Chem
274:
17499-17504,
1999
8.
Cousins, RJ,
and
McMahon RJ.
Integrative aspects of zinc transporters.
J Nutr
130:
1384S-1387S,
2000
9.
Coyle, P,
Zalewski P,
Philcox J,
Forbes I,
Ward A,
Lincoln S,
Mahadevan I,
and
Rofe A.
Measurement of zinc in hepatocytes using a fluorescent probe, Zinquin: relationship to metallothionein and intracellular zinc.
Biochem J
303:
781-786,
1994[Web of Science][Medline].
10.
Cragg, R,
Christie G,
Phillips S,
Russi R,
Küry S,
Mathers J,
Taylor P,
and
Ford D.
A novel zinc-regulated human zinc transporter, hZTL1, is localized to the enterocyte apical membrane.
J Biol Chem
277:
22789-22797,
2002
11.
Danscher, G.
The autometallographic zinc-sulphide method. A new approach involving in vivo creation of nanometer-sized zinc sulphide crystal lattices in zinc-enriched synaptic and secretory vesicles.
Histochem J
28:
361-373,
1996[Web of Science][Medline].
12.
Eng, BH,
Guerinot ML,
Eide D,
and
Saier MHJ
Sequence analyses and phylogenetic characterization of the ZIP family of metal ion transport proteins.
J Membr Biol
166:
1-7,
1998[Web of Science][Medline].
13.
Erway, LC,
and
Grider A.
Zinc metabolism in lethal-milk mice. Otolith, lactation, and aging effects.
J Hered
75:
480-484,
1984
14.
Gaither, L,
and
Eide D.
Eukaryotic zinc transporters and their regulation.
Biometals
14:
251-270,
2001[Web of Science][Medline].
15.
Gaither, L,
and
Eide D.
Functional expression of the human hZIP2 zinc transporter.
J Biol Chem
275:
5560-5564,
2000
16.
Gaither, L,
and
Eide D.
The hZIP1 transporter mediates zinc uptake in human K562 erythroleukemia cells.
J Biol Chem
276:
22258-22264,
2001
17.
Gossen, M,
and
Bujard H.
Tight control of gene expression in mammalian cells by tetracycline responsive promoters.
Proc Natl Acad Sci USA
89:
5547-5551,
1992
18.
Huang, L,
and
Gitschier J.
A novel gene involved in zinc transport is deficient in the lethal milk mouse.
Nat Genet
17:
292-297,
1997[Web of Science][Medline].
19.
Huang, L,
Kirschke C,
and
Gitschier J.
Functional characterization of a novel mammalian zinc transporter, ZnT6.
J Biol Chem
277:
26389-26395,
2002
20.
Kambe, T,
Narita H,
Yamaguchi-Iwai Y,
Hirose J,
Amano T,
Sugiura N,
Sasaki R,
Mori K,
Iwanaga T,
and
Nagao M.
Cloning and characterization of a novel mammalian zinc transporter, ZnT5, abundantly expressed in pancreatic
cells.
J Biol Chem
277:
19049-19055,
2002
21.
Küry, S,
Dréno B,
Bézieau S,
Giraudet S,
Kharfi M,
Kamoun R,
and
Moisan J.
Identification of SLC39A4, a gene involved in acrodermatitis enteropathica.
Nat Genet
31:
239-240,
2002[Web of Science][Medline].
22.
Langmade, S,
Ravindra R,
Daniels P,
and
Andrews G.
The transcription factor MTF-1 mediates metal regulation of the mouse ZnT1 gene.
J Biol Chem
275:
34803-34809,
2000
23.
Lee, DY,
Shay N,
and
Cousins R.
Altered zinc metabolism occurs in murine lethal milk syndrome.
J Nutr
122:
2233-2238,
1992
24.
Liuzzi, J,
Blanchard R,
and
Cousins R.
Differential regulation of zinc transporter 1, 2, and 4 mRNA expression by dietary zinc in rats.
J Nutr
131:
46-52,
2001
25.
Mc Roberts, JA,
Taub M,
and
Saier MH, Jr.
The Madin-Darby canine kidney (MDCK) cell line.
In: Functionally Differentiated Cell Lines, edited by Sata G.. New York: Liss, 1981, p. 117-139.
26.
McCarthy, K,
Francis S,
McCormack J,
Lai J,
Rogers R,
Skare I,
Lynch R,
and
Schneeberger E.
Inducible expression of claudin-1-myc but not occludin-VSV-G results in aberrant tight junction strand formation in MDCK cells.
J Cell Sci
113:
3387-3398,
2000[Abstract].
27.
McMahon, RJ,
and
Cousins RJ.
Regulation of the zinc transporter ZnT-1 by dietary zinc.
Proc Natl Acad Sci USA
95:
4841-4846,
1998
28.
Mills, CF.
Zinc in Human Biology. New York: Springer-Verlag, 1989.
29.
Murgia, C,
Vespignani I,
Cerase J,
Nobili F,
and
Perozzi G.
Cloning, expression, and vesicular localization of zinc transporter Dri 27/ZnT4 in intestinal tissue and cells.
Am J Physiol Gastrointest Liver Physiol
277:
G1231-G1239,
1999
30.
Palmiter, RD,
Cole TB,
and
Findley SD.
ZnT-2, a mammalian protein that confers resistance to zinc by facilitating vescicular sequestration.
EMBO J
15:
1784-1791,
1996[Web of Science][Medline].
31.
Palmiter, RD,
Cole TB,
Quaife CJ,
and
Findley SD.
ZnT-3, a putative transporter of zinc into synaptic vesicles.
Proc Natl Acad Sci USA
93:
14934-14939,
1996
32.
Palmiter, RD,
and
Findley SD.
Cloning and functional characterization of a mammalian zinc transporter that confers resistance to zinc.
EMBO J
14:
639-649,
1995[Web of Science][Medline].
33.
Perozzi, G,
Murgia C,
Barilà D,
Cerase J,
Felicioli F,
and
Lombardo F.
Molecular analysis of novel genes differentially expressed during gut development.
In: The Gut as a Model in Cell and Molecular Biology, edited by Halter F,
Winton D,
and Wright HW.. Lancaster, UK: Kluwer, 1997, p. 99-109.
34.
Reyes, JG.
Zinc transport in mammalian cells.
Am J Physiol Cell Physiol
270:
C401-C410,
1996
35.
Sonnenberg, A,
Linders CJT,
Daams JH,
and
Kennel SJ.
The alpha6 beta1 (VLA-6) and alpha6 beta4 protein complexes: tissue distribution and biochemical properties.
J Cell Sci
96:
207-217,
1990
36.
Stevenson, B,
Siliciano J,
Mooseker M,
and
Goodenough D.
Identification of ZO-1: a high molecular weight plypeptide associated with the tight junction (zonula occludens) in a variety of epithelia.
J Cell Biol
103:
755-766,
1986
37.
Truong-Tran, A,
Ruffin R,
and
Zalewski P.
Visualization of labile intracellular Zn and its role in apoptosis of primary ciliated airway epithelial cells and cell lines.
Am J Physiol Lung Cell Mol Physiol
279:
L1172-L1183,
2000
38.
Wang, K,
Zhou B,
Kuo YM,
Zemansky J,
and
Gitschier J.
A novel member of a zinc transporter family is defective in Acrodermatitis enteropathica.
Am J Hum Genet
71:
66-73,
2002[Web of Science][Medline].
39.
Zalewski, PD,
Forbes IJ,
and
Betts HW.
Correlation of apoptosis with change in intracellular labile Zn(II) using Zinquin [(2-methyl-8-p-toluenesulphonamido-6-quinolyxy)acetic acid], a new specific fluorescent probe for Zn(II).
Biochem J
296:
403-408,
1993[Web of Science][Medline].
40.
Zalewski, PD,
Forbes IJ,
Seamark RF,
Borlinghaus R,
Betts WH,
Lincoln SF,
and
Ward AD.
Flux of intracellular labile zinc during apoptosis (gene-directed cell death) revealed by a specific chemical probe, Zinquin.
Chem Biol
3:
153-161,
1994.
This article has been cited by other articles:
![]() |
C. Lang, C. Murgia, M. Leong, L.-W. Tan, G. Perozzi, D. Knight, R. Ruffin, and P. Zalewski Anti-inflammatory effects of zinc and alterations in zinc transporter mRNA in mouse models of allergic inflammation Am J Physiol Lung Cell Mol Physiol, February 1, 2007; 292(2): L577 - L584. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Ho, R. E. Ruffin, C. Murgia, L. Li, S. A. Krilis, and P. D. Zalewski Labile Zinc and Zinc Transporter ZnT4 in Mast Cell Granules: Role in Regulation of Caspase Activation and NF-{kappa}B Translocation J. Immunol., June 15, 2004; 172(12): 7750 - 7760. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |