AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 284: F189-F198, 2003. First published August 13, 2002; doi:10.1152/ajprenal.00245.2002
0363-6127/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/1/F189    most recent
00245.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Storm, R.
Right arrow Articles by Maric, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Storm, R.
Right arrow Articles by Maric, K.
Vol. 284, Issue 1, F189-F198, January 2003

Osmolality and solute composition are strong regulators of AQP2 expression in renal principal cells

R. Storm1, E. Klussmann1, A. Geelhaar1, W. Rosenthal1,2, and K. Maric1

1 Forschungsinstitut für Molekulare Pharmakologie, Campus Berlin-Buch, 13125 Berlin; and 2 Freie Universität Berlin, Institut für Pharmakologie, 14195 Berlin, Germany


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The water permeability of the renal collecting duct is regulated by the insertion of aquaporin-2 (AQP2) into the apical plasma membrane of epithelial (principal) cells. Using primary cultured epithelial cells from the inner medulla of rat kidney (IMCD cells), we show that osmolality and solute composition are potent regulators of AQP2 mRNA and protein synthesis, as well as the classical cAMP-dependent pathway, but do not affect the arginine vasopressin-induced AQP2 shuttle. In the presence of the cAMP analog dibutyryl cAMP (DBcAMP, 500 µM), NaCl and sorbitol, but not urea, evoked a robust increase of AQP2 expression in IMCD cells, with NaCl being far more potent than sorbitol. cAMP-responsive element-binding protein phosphorylation increased with DBcAMP concentrations but was not altered by changes in osmolality. In the rat and human AQP2 promoter, we identified a putative tonicity-responsive element. We conclude that, in addition to the arginine vasopressin/cAMP-signaling cascade, a further pathway activated by elevated effective osmolality (tonicity) is crucial for the expression of AQP2 in IMCD cells, and we suggest that the effect is mediated via the tonicity-responsive element.

osmolality; aquaporin-2; kidney; gene regulation; toxicity responsive enhancer


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE WATER CHANNEL aquaporin-2 (AQP2), expressed in epithelial (principal) cells of renal collecting ducts, is required for the vasopressin-dependent concentration of urine (7). AQP2 abundance increases from the kidney cortex to the inner region of the kidney medulla (29), as does osmolality. The water permeability of the inner medullary collecting duct (IMCD) is rapidly regulated (within minutes) by the antidiuretic hormone arginine vasopressin (AVP), which binds to heptahelical vasopressin V2 receptors (V2R), located mainly in the basolateral plasma membrane of principal cells. Activation of the V2R causes stimulation of adenylyl cyclase via the G protein GS, leading to elevation of cAMP. The subsequent activation of protein kinase A (PKA) initiates the translocation of AQP2-bearing vesicles from the cytosol to the plasma membrane, in which AQP2 is inserted by an exocytosis-like process (short-term regulation) (D. Lorenz, A. Krylov, V. Hagen, J. Zipper, W. Rosenthal, P. Pohl, and K. Maric, unpublished observations; 30). In addition, the signaling cascade described above governs the expression of AQP2 (long-term regulation) by PKA-mediated phosphorylation of the transcription factor cAMP-responsive element (CRE)-binding protein (CREB) (13, 16). Given the fact that AQP2 biosynthesis is usually shut off shortly after IMCD cells are established in primary culture (10), most studies on AQP2 long-term regulation have been performed using animal models (29, 37). We recently established primary cultured IMCD cells as a model system (17, 18, 21, 22). These cells exhibit sustained AQP2 expression when grown in hyperosmotic medium (600 mosmol/l) in the presence of 500 µM dibutyryl cAMP (DBcAMP). Thus this cell model allows the investigation of isolated aspects of kidney function: the short- and/or long-term regulation of AVP-mediated water reabsorption in IMCD cells endogenously expressing AQP2.

Several studies have provided evidence for a V2R/cAMP-independent regulation of AQP2 expression. In rats the downregulation of AQP2 expression by V2R antagonist treatment was reversed by subjecting the animals to thirst (24). In addition, senescent (30-mo-old) rats exhibited a significantly decreased AQP2 expression and papillary osmolality compared with younger (10-mo-old) animals, while papillary cAMP remained unaffected (32).

Taking advantage of our cell culture system, we investigated the role of extracellular osmolality and solute composition in the long-term regulation of AQP2. We examined whether these effects are mediated by the transcription factor CREB or whether other, possibly cAMP-independent, pathways are involved.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. IMCD primary cultures were prepared as described previously (21). Renal inner medullae of Wistar rats (2-3 mo old; both sexes) were the source of primary cultured IMCD cells. All media were based on Dulbecco's modified Eagle's medium (containing 110 mmol/l NaCl and 300 mosmol/l) routinely supplemented with 500 µM DBcAMP, 4.5% glucose, and 1% serum substitute Ultroser (Life Technologies, Karlsruhe, Germany) instead of 10% FCS. This basic medium, termed 300N, contained 500 µM DBcAMP (if not indicated otherwise) for the maintenance of AQP2 expression. Media of elevated osmolalities (600 and 900 mosmol/kgH2O after equimolar addition of NaCl and urea) were termed 600N and 900N, respectively, or, if sorbitol was used to elevate osmolality, 600S and 900S. Media elevated to 600 mosmol/kgH2O with different concentrations of NaCl and/or urea were termed 600U 0/300, 600NaCl/U 50/200, and 600NaCl 150/0 [numbers before and after the slashes indicate concentrations (in mM) of NaCl and urea, respectively, added to 300N]. When only NaCl was used to elevate medium osmolality, the amounts of NaCl added to 300N and the osmolality of the medium are indicated. The cells were seeded at a density of ~105/cm2 in 600N to select for IMCD cells. At 1 day after seeding, this routine culture medium was replaced by the desired culture medium. Confluent cells were harvested for diverse analysis 6-7 days later. WT-10 cells [Madin-Darby canine kidney (MDCK) cells that were stably transfected with AQP2 construct, driven by cytomegalovirus (CMV) promoter (6)] were cultured without DBcAMP in 300N with 5% FCS and passaged every 4-5 days. At 6 days before membrane preparation, WT-10 cells were split 1:10 and seeded on culture dishes in 300N or 600N.

Protein preparations and Western blot analysis. All procedures were performed at 4°C. Cells cultured in 60-mm-diameter culture dishes were rinsed twice with ice-cold phosphate-buffered saline (PBS), scraped off the culture dishes, and homogenized in 1.5 ml of ice-cold PBS with a glass-Teflon homogenizer (10 strokes, 750 rpm). For membrane preparations, the homogenates were centrifuged at 800 g for 5 min to remove nuclei and debris; the supernatant was centrifuged at 200,000 g for 1 h, and the resulting pellet (membrane fraction) was resuspended in ice-cold PBS. Samples (15 µg) were subjected to SDS-PAGE (12% acrylamide in separating gels). Cells grown on 24-well plates (2 cm2/well) were rinsed twice with ice-cold PBS and lysed in modified Laemmli buffer [40 µl/well; 4% (wt/vol), instead of 2%, SDS] by incubation at room temperature for 18 h. The solubilized material was then sonicated (Sonopuls UW 2070, Bandelin Electronic, Berlin, Germany) for 5 s at 40% power to shear chromosomal DNA and subjected to SDS-PAGE (total homogenate from 1 cm2 of confluent cell monolayer was loaded per lane onto 12% SDS-polyacrylamide gels). Size-separated proteins were transferred to nitrocellulose filters (Optitran, Schleicher & Schuell, Dassel, Germany). Protein transfer and equal loading were verified by Ponceau red staining (not shown).

Filters were blocked for 1 h in blocking buffer [Tris-buffered saline + Tween (TBST) containing 5% (wt/vol) low-fat dry milk], incubated with the desired primary antibodies, and subsequently washed in TBST (5 times for 8 min each). As primary antibodies, rabbit polyclonal antiserum against AQP2 (20), which, in addition to AQP2, also detects the histone H2A1 (14), was used at a dilution of 1:1,500 in blocking buffer for 1 h at room temperature, and rabbit polyclonal antiserum against phosphorylated CREB diluted 1:500 in TBST containing 5% BSA (New England Biolabs, Frankfurt am Main, Germany) was used overnight at 4°C. As secondary antibodies, peroxidase-coupled goat anti-rabbit F(a/b) fragments (Dianova, Hamburg, Germany) were used (1:2,000 in blocking buffer, 1 h at room temperature). Blots were washed five times for 8 min each in TBST and then incubated for 5 min in Lumi-Light solution (Roche Diagnostics, Mannheim, Germany). Chemiluminescence was visualized and band densities were quantified using a Lumi-Imager F1 (Roche Diagnostics, Mannheim, Germany). Results (means ± SE) are expressed as percentage of control signal intensity. Statistical evaluation was carried out by ANOVA, using GraphPad Prism software (GraphPad Software, San Diego, CA). GraphPad Prism software was also used to perform nonlinear regression analysis on the data obtained in time-course experiments.

Northern blot analysis. Total RNA was prepared from IMCD cells grown in 60-mm culture dishes using TRIzol reagent (GIBCO-BRL, Karlsruhe, Germany). Northern blot analysis with 15 µg of total RNA was essentially performed as described previously (12). Hybridization was carried out using 32P-labeled rat AQP2 cDNA (labeled according to the manufacturer's instructions; Megaprime DNA Labeling Kit, Amersham Pharmacia Biotech, Freiburg, Germany). For standardization of AQP2 mRNA signals, blots were rehybridized with a 32P-labeled (44-bp) cDNA fragment specific for rat 18S rRNA (5' ACGAATGCCCCCGGCCGTCCCTCTTAATCATGGCCTCAGT TCCG 3'; terminal transferase end-labeled according to manufacturer's instructions; Boehringer, Mannheim, Germany). Signals were visualized using a STORM 830 PhosphorImager and quantified using Image Quant 5.1 software (Amersham Pharmacia Biotech). For semiquantitative analysis, band densities for AQP2 mRNA were standardized to the corresponding 18S rRNA signals. Standardized signals (means ± SE) are expressed as percentage of control signal intensity (IMCD cells cultivated in 600N) for each set of experiments. Statistical evaluation was carried out by ANOVA using GraphPad Prism software.

Sequence searches and alignments. DNA sequences for the human and rat AQP2 promoters were obtained by using the National Center for Biotechnology Information nucleotide search. Alignments were performed using GeneTool software (version 1.0, BioTools).

Immunofluorescence studies. Immunofluorescence experiments for the detection of AQP2 in IMCD cells was essentially performed as previously described (21). AQP2 was detected by fluorescence microscopy (Leica DMLB microscope with Sensicam 12 Bitled charge-coupled device camera, Bensheim, Germany) using rabbit polyclonal anti-AQP2 antibodies and Cy3-conjugated anti-rabbit secondary antibodies (Dianova).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

AQP2 protein expression is stimulated by DBcAMP. Figure 1A shows a representative AQP2 immunoblot analysis of total homogenates derived from IMCD cells cultured for 6 days in 24-well plates. The analysis of total homogenates derived from IMCD cells grown in 24-well plates was favored over membrane preparations, because the latter require 10 times more cells and, thus, animals. Another advantage to using total homogenates is that histone H2A1, a nuclear protein detected therein by the anti-AQP2 antiserum (14), can be used as a marker to compare cell numbers and amounts of protein loaded per lane. Cells were grown in 600N supplemented with 5 µM, 50 µM, 200 µM, 500 µM (control), 2 mM, and 5 mM DBcAMP, a membrane-permeable cAMP analog. The results are summarized in Fig. 1B. DBcAMP stimulated AQP2 expression in a dose-dependent manner; its maximum effect was at 200 and 500 µM. Higher concentrations led to a decrease in AQP2 expression, while cell morphology, assessed by transmission microscopy, remained unchanged (not shown). These findings suggest that DBcAMP can affect AQP2 expression bidirectionally in IMCD cells grown in 600N. DBcAMP at 500 µM, also used in previous studies (17, 18, 21, 22), yielded maximal AQP2 expression in IMCD cells grown in 600N and was therefore routinely employed in experiments designed to identify pathways other than the cAMP-dependent pathway.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of dibutyryl cAMP (DBcAMP) on aquaporin-2 (AQP2) protein levels in inner medullary collecting duct (IMCD) cells. IMCD cells were cultured for 6 days in 24-well plates containing medium in which osmolality was elevated to 600 mosmol/kgH2O with NaCl and urea (600N) supplemented with 5 µM, 50 µM, 200 µM, 500 µM (control), 2 mM, and 5 mM DBcAMP. A: AQP2 [glycosylated (g) and nonglycosylated (ng)] and histone H2A1 detected by immunoblotting with anti-AQP2 antiserum. Per lane of an SDS-polyacrylamide gel, total homogenate (protein) from 1-cm2 confluent cell monolayer was loaded. B: densitometric analysis of AQP2 protein levels (glycosylated and nonglycosylated). Values are means ± SE (n = 4). *P < 0.05 vs. control.

AQP2 protein expression is dependent on elevated osmolality and altered by solute composition. Increased AQP2 expression in rats is induced by water deprivation, despite chronic administration of V2R antagonists (24, 30), possibly as a consequence of increased medullary osmolality derived from urea and NaCl. We therefore tested whether cAMP-stimulated AQP2 expression is altered by increased medium osmolality derived from elevated NaCl, urea, or sorbitol concentration. Media supplemented solely with sorbitol were used to distinguish the effects of elevated osmolality from the effects of NaCl and urea. Figure 2A shows a representative AQP2 immunoblot analysis of total homogenates from IMCD cells cultured in 24-well plates for 6 days in 300N, 600S, 600N (control), 900S, and 900N. The results are summarized in Fig. 2B. For IMCD cells cultivated in 300N, only weak AQP2 signals were detectable. An elevation of medium osmolality to 600 mosmol/kgH2O by the addition of sorbitol (600S) clearly increased AQP2 protein expression. Maximal AQP2 expression, however, was achieved when equimolar NaCl and urea were used to elevate medium osmolality to 600 mosmol/kgH2O (as in 600N). A further elevation of the osmolality to 900 mosmol/kgH2O by sorbitol (900S) drastically reduced AQP2 expression, whereas AQP2 expression was only slightly reduced when NaCl and urea were employed (900N). These results indicate that osmolality and a specific action of NaCl and urea determine the level of AQP2 protein expression in IMCD cells.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Dependence of AQP2 expression on elevated osmolality and solute composition. IMCD cells were cultured for 6 days in 24-well plates in the presence of 500 µM DBcAMP in basal medium (300N), medium in which osmolality was elevated to 600 mosmol/kgH2O with sorbitol (600S), 600N (control), medium in which osmolality was elevated to 900 mosmol/kgH2O with sorbitol (900S), and medium in which osmolality was elevated to 900 mosmol/kgH2O with NaCl and urea (900N). A: AQP2 and histone H2A1 detected by immunoblotting with anti-AQP2 antiserum. Per lane of an SDS-polyacrylamide gel, total homogenate (protein) from 1-cm2 confluent cell monolayer was loaded. B: densitometric analysis of AQP2 protein levels (glycosylated and nonglycosylated). Values are means ± SE (n = 8). *P < 0.05 vs. control.

Osmolality changes do not influence AQP2 protein expression in WT-10 cells stably transfected with AQP2. MDCK cells stably expressing human AQP2 under the control of a CMV promoter (WT-10 cells) (6) and IMCD cells were exposed to 300N and 600N. Figure 3A shows a representative immunoblot of total membrane preparations derived from WT-10 and IMCD cells. The results are summarized in Fig. 3B. The data indicate that the CMV promoter-governed expression of AQP2 in WT-10 cells is not affected by changes in osmolality. In contrast, AQP2 expression in IMCD cells increased with increasing osmolality (Fig. 2). These findings suggest that the AQP2 gene's natural promoter is required for an effect of osmolality on AQP2 expression.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   Comparison of the effect of osmolality and solute composition on Madin-Darby canine kidney (MDCK1) cells stably expressing AQP2 (WT-10 cells) and IMCD cells. WT-10 cells are stably transfected with AQP2; its expression is controlled by a cytomegalovirus (CMV) promoter (6). Cells were cultured for 6 days in 300N or 600N (control). A: AQP2 detected by immunoblotting with anti-AQP2 antiserum in membrane preparations. Per lane of an SDS-polyacrylamide gel, 15 µg of membrane protein were loaded. B: densitometric analysis of AQP2 protein levels of WT-10 (n = 3) and IMCD (n = 6) cells. Values are means ± SE. *P < 0.05 vs. control.

AQP2 mRNA expression is regulated by osmolality and solute composition. To investigate whether the above-described changes in AQP2 protein levels result from corresponding changes in AQP2 mRNA levels, Northern blot experiments were performed. We used RNA preparations from IMCD cells cultured in 300N, 600S, 600N (control), 900N (Fig. 4A), and 900S (Fig. 4B). Figure 4C summarizes AQP2 mRNA signals. The changes in the mRNA level correspond closely to the changes in the protein level. Thus osmolality and solute composition regulate AQP2 expression, most likely on the transcriptional level.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4.   Regulation of AQP2 mRNA expression by osmolality and solute composition in IMCD cells. IMCD cells were cultured for 6 days in the presence of 500 µM DBcAMP and 300N, 600S, 600N (control), or 900N (A) and 600N (control) or 900S (B). Total RNA was isolated, and Northern blots (15 µg of total RNA per lane) were performed. AQP2 mRNA was detected with 32P-labeled AQP2 cDNA. Blots were stripped and reprobed with a 32P-labeled cDNA fragment specific for 18S rat rRNA for detection of 18S rRNA. Results are from 2 independent experiments per culture condition. C: densitometric analysis of AQP2 mRNA levels from 4 independent experiments. Values for AQP2 mRNA signals (means ± SE; n = 4) were standardized to corresponding 18S rRNA signals. *P < 0.05 vs. control.

CREB phosphorylation is stimulated by DBcAMP. The promoter region of the AQP2 gene contains a CRE, known to be involved in the AVP-induced AQP2 expression (13, 25). CREB, once phosphorylated at Ser133 (pCREB) by PKA, binds to the CRE and, thereby, presumably stimulates AQP2 transcription. We performed Western blot experiments to examine whether DBcAMP increases the level of pCREB in IMCD cells. Cells were cultured for 6 days in 600N supplemented with 5 µM, 50 µM, 500 µM (control), 2 mM, and 5 mM DBcAMP. Figure 5A shows a representative Western blot analysis of total homogenates of IMCD cells probed with a specific antiserum against pCREB and the same blot probed for the histone H2A1. The results are summarized in Fig. 5B. The level of pCREB in IMCD cells increased with DBcAMP concentrations in the culture medium.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of DBcAMP on phosphorylation of cAMP-responsive element-binding protein (CREB) in IMCD cells. IMCD cells were cultured for 6 days in 24-well plates containing 600N supplemented with 5 µM, 50 µM, 200 µM, 500 µM (control), 2 mM, and 5 mM DBcAMP. A, top: Ser133-phosphorylated CREB (pCREB) detected by immunoblotting with anti-pCREB antiserum. Per lane of an SDS-polyacrylamide gel, total homogenate (protein) from 1-cm2 confluent cell monolayer was loaded. A, bottom: histone H2A1 detected by incubation with anti-AQP2 antiserum. B: densitometric analysis of pCREB protein levels. Values are means ± SE (n = 4).

DBcAMP-induced CREB phosphorylation is not affected by changes in osmolality and solute composition. We next assessed whether osmolality and solute composition alter the amount of pCREB in IMCD cells grown for 6 days in the presence of 500 µM DBcAMP, thereby regulating the expression of AQP2. Figure 6A shows a representative Western blot analysis of total homogenates of IMCD cells probed with a specific antiserum against pCREB and the same blot probed for the histone H2A1. The results are summarized in Fig. 6B. No significant effects of osmolality or solute composition on phosphorylation of CREB were observed.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6.   Independence of DBcAMP-induced CREB phosphorylation by alterations in osmolality and solute composition. IMCD cells were cultured for 6 days in 24-well plates containing 300N, 600S, 600N (control), 900S, and 900N in the presence of 500 µM DBcAMP. A, top: pCREB detected by immunoblotting with anti-pCREB antiserum. Per lane of an SDS-polyacrylamide gel, total homogenate (protein) from 1-cm2 confluent cell monolayer was loaded. A, bottom: histone H2A1 detected by incubation with anti-AQP2 antiserum. B: densitometric analysis of pCREB protein levels. Values are means ± SE (n = 8). Values were not statistically different from controls.

Kinetics of AQP2 regulation in response to hyper- and hyposmotic challenge provide evidence for an involvement of a tonicity enhancer element identified in the AQP2 promoter. To show that the effects of hyper- and hyposmotic challenge on AQP2 expression are reversible and to assess the time courses of increase and decrease in AQP2 expression, we performed the experiments described below. To analyze the time course of upregulation in response to a hyperosmotic challenge, IMCD cells were seeded in 600N that was changed 24 h later to 300N (except for controls). Starting 72 h after the shift, cells were exposed to 600N for 72, 48, 24, and 6 h before lysis. Figure 7A shows the densitometric analysis of AQP2 expression levels as measured by Western blot analysis. Nonlinear regression analysis suggests that the AQP2 expression started to increase with a lag time of ~15 h after exposure to hyperosmolality. The AQP2 expression level of IMCD cells kept for 72 h in 300N (see also Fig. 7B) increased in 600N within 72 h to ~75% of that of controls (cells continuously cultured in 600N, 168-h time point). To analyze the time course of AQP2 downregulation in response to hyposmotic challenge, cells were seeded in 600N that was changed to 300N (except for controls) for 144, 72, 48, 24, 6, and 3 h before lysis. Figure 7B shows the densitometric analysis of AQP2 expression levels as detected by Western blot analysis. A downregulation of AQP2 protein expression in response to hyposmolality was detectable after 6 h. Thereafter, AQP2 expression continued to decrease and dropped to baseline levels 72 h after exposure to 300N (Fig. 7B).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7.   Kinetics of AQP2 regulation in response to hyper- and hyposmotic challenge provide evidence for involvement of a tonicity enhancer element identified in the AQP2 promoter. IMCD cells were cultured for a total of 168 h (6 days) in 24-well plates in the presence of 500 µM DBcAMP. A: cells were seeded in 600N, which was changed 24 h later to 300N to induce a downregulation of AQP2. Medium osmolality was not changed in the case of controls (cells continuously grown in 600N; 168-h time point). Upregulation of AQP2 was induced by changing medium to 600N for 72, 48, 24, and 6 h before cell lysis and Western blot analysis (not shown). AQP2 was detected and quantified as described in Figs. 1, 2, and 8. Values from densitometric analysis of AQP2 protein (glycosylated and nonglycosylated) are means ± SE; 8 > n > 10. Graph was obtained by performing nonlinear regression analysis [GraphPad Prism; R2 (unweighted) = 0.9999]. B: cells were seeded in 600N. Downregulation of AQP2 was induced by changing culture medium to 300N (except controls; 0-h time point) for 144, 72, 48, 24, 6, and 3 h before cell lysis (168 h after seeding) and Western blot analysis (not shown). AQP2 was detected and quantified as described in Figs. 1, 2, and 8. Values from densitometric analysis of AQP2 protein (glycosylated and nonglycosylated) are means ± SE; n = 4. Graph was obtained by performing nonlinear regression analysis [GraphPad Prism; R2 (unweighted) = 0.9990]. C: rat and human AQP promoter regions. TonE consensus sequence (27, 34), as well as TonE elements found in promoters, is shown. Arrowheads, transcription initiation sites.

Within the promoter of the AQP2 gene we located a regulatory element that could potentially mediate the effects of osmolality changes on AQP2 expression. Figure 7C shows that the rat and human AQP2 promoter [National Center for Biotechnology Information accession nos. D87128 (33) and U30469 (13)] contain elements matching the consensus sequence for the tonicity responsive enhancer (TonE) (26, 34). The TonE consensus sequence is recognized by the recently identified transcription factor TonE-binding protein (TonEBP) (27, 36). In agreement with the present data, activation of TonEBP in response to a hypertonic challenge requires >10 h (27), whereas a hypotonic challenge rapidly decreases TonEBP activity (27, 38).

Hypertonic challenge, and not urea, promotes AQP2 protein expression. To discriminate further between the effects of NaCl and urea on AQP2 protein expression in IMCD cells, a set of experiments was performed using media elevated to 600 mosmol/kgH2O with different concentrations of either solute. Figure 8A shows two representative AQP2 immunoblots obtained with total homogenates from IMCD cells cultured for 6 days in the indicated media. The results are summarized in Fig. 8B. Culture media with a high effective osmolality (tonicity) derived from weakly membrane-permeating solutes as in 600N (NaCl) and 600S (sorbitol) promote AQP2 expression. In contrast, culture media with a high osmolality derived from the membrane-permeating compound urea (600U) yield a very faint AQP2 expression, comparable to the AQP2 expression observed in IMCD cells cultured in 300N (Figs. 2 and 3). An increase in the NaCl concentration by just 50 mmol/l (600NaCl/U 50/200) is almost sufficient for maximal stimulation of AQP2 expression. The complete omission of urea (600NaCl) yielded nearly maximal AQP2 protein levels, suggesting that elevation of the NaCl concentration alone is the relevant stimulus. In accordance with the findings shown in Fig. 6, the level of pCREB was not altered under the conditions in the experiments shown here (data not shown).


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 8.   Hypertonic challenge, and not urea, promotes AQP2 protein expression. IMCD cells were cultured for 6 days in 24-well plates in the presence of 500 µM DBcAMP in 600N 100/100 (control), 600S, or 600U 0/300 (left) and 600 NaCl/U 50/200, 600N 100/100 (control), or 600NaCl 150/0 (right). Numbers in front of and behind slash indicate added concentrations (to 300N medium) of NaCl and urea (in mM), respectively. A: AQP2 and histone H2A1 detected by immunoblotting with anti-AQP2 antiserum. Per lane of an SDS-polyacrylamide gel, total homogenate (protein) from 1-cm2 confluent cell monolayer was loaded. B: densitometric analysis of AQP2 protein levels (glycosylated and nonglycosylated). Values are means ± SE (4 > n > 8). *P < 0.05 vs. control.

AQP2 protein expression depends on elevated extracellular NaCl. The effect of different NaCl concentrations on DBcAMP-dependent AQP2 expression was further analyzed (Fig. 9). For this purpose, IMCD cells were seeded in 600N and grown for 6 days in 300N with 10, 20, 35, 50, 100, 150, 200, 250, and 300 mM NaCl. AQP2 protein expression of the cells was analyzed by Western blot analysis. A representative set of experiments is shown in Fig. 9A. The results are summarized in Fig. 9B. The expression of AQP2 was increased when up to 150 mM NaCl was added and appeared to decrease when higher concentrations of NaCl were used. These findings underline the assumption that NaCl concentration is a key component in mediating hypertonic induction of AQP2 expression.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 9.   AQP2 protein expression correlates with extracellular NaCl concentrations. IMCD cells were cultured for 6 days in 24-well plates containing 600N (control) and 300N elevated to indicated osmolalities with 0 mM (300N), 10 mM, 20 mM, 35 mM, 50 mM, 100 mM, 150 mM, 200 mM, 250 mM, and 300 mM NaCl. A: AQP2 and histone H2A1 detected by immunoblotting with anti-AQP2 antiserum. Per lane of an SDS-polyacrylamide gel, total homogenate (protein) from 1-cm2 confluent cell monolayer was loaded. B: densitometric analysis of AQP2 protein levels. Values are means ± SE (7 > n > 12). *P < 0.05 vs. control (CTRL).

Osmolality and solute composition do not interfere with the short-term regulation of AQP2. Immunofluorescence microscopy studies were performed to investigate whether medium osmolality and solute composition alter the AVP-dependent AQP2 translocation from intracellular stores to the plasma membrane, i.e., the short-term regulation of AQP2. As shown in Fig. 10, AQP2 was localized intracellularly in unstimulated IMCD cells and translocated to the plasma membrane in response to AVP stimulation (21). The AQP2 shuttle was observed under all conditions tested. These findings indicate that osmolality and solute composition do not influence the AVP-induced translocation of AQP2. In addition, they show that IMCD cells are viable under the different conditions tested.


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 10.   Osmolality and solute composition have no effect on hormone-stimulated trafficking of AQP2 in IMCD cells. Cells were cultured for 6 days in 300N, 600S, 600N (control), 900S, and 900N and deprived of DBcAMP 18 h before experiments. Top: unstimulated IMCD cells. Bottom: IMCD cells stimulated with 100 nM AVP for 30 min before fixation. AQP2 was detected with a specific anti-AQP2 antiserum. Cy3-conjugated goat anti-rabbit antibodies were used as a secondary antibody.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In the present study we show that, in the continuous presence of DBcAMP (500 µM), the levels of AQP2 mRNA (Fig. 4C) and protein (Fig. 2B) in primary cultured IMCD cells are strongly increased by an increase in osmolality and influenced by solute composition (NaCl and urea vs. sorbitol). The CMV promoter-governed AQP2 expression in stably transfected MDCK cells (WT-10 cells) (6) was not influenced, suggesting that, in IMCD cells, osmolality and solute composition act on AQP2 transcription, rather than affect AQP2 mRNA or protein stability (Fig. 3). Addition of DBcAMP to the cell culture medium increased the phosphorylation of the transcription factor CREB dose dependently, whereas osmolality and solute composition did not influence CREB phosphorylation (Figs. 5 and 6). The effects of hypo- and hyperosmotic challenge on AQP2 expression were reversible (Fig. 7). Hyperosmolarity increased AQP2 expression by one-half within 2 days (Fig. 7A), whereas hyposmotic challenge reduced expression by one-half within ~18 h (Fig. 7B). The promoters of the rat and human AQP2 gene each contain a binding site for the transcription factor TonEBP (Fig. 7C), which may mediate the effects of osmolality and solute composition on AQP2 expression. A further analysis of the influence of NaCl and/or urea on AQP2 expression revealed that NaCl is a key component in promotion of AQP2 expression, acting in a dose-dependent manner (Figs. 8 and 9). Elevated osmolality by urea alone had no promoting effect on AQP2 expression (Fig. 8), but the effect of NaCl appeared to be enhanced when urea was present.

In vivo, the high interstitial inner medullary osmolality is mainly derived from equiosmolar urea and NaCl concentrations. The concentrations of NaCl and urea gradually increase from the kidney cortex to the tip of the medulla, thus creating an osmotic gradient required for water reabsorption. The osmotic gradient is maintained even during diuresis, and its magnitude is increased during antidiuresis. The concentration of NaCl in the rat renal medulla varies between 140 mM in hydrated animals and 400 mM in dehydrated animals (3). Whereas urea concentrations equilibrate between the interstitium and the interior of the cell, extracellular NaCl is balanced by intracellular accumulation of organic osmolytes such as sorbitol, betaine, glycerophosphocholine, inositol, and taurine (2). These nonperturbing osmolytes have stabilizing effects on protein function and, thus, counteract the denaturing effect of urea (39). In the renal medulla, the transcription of several genes encoding for proteins involved in the intracellular accumulation of organic osmolytes is induced by hypertonicity (11). We show that elevated NaCl concentrations are also required for a sustained expression of AQP2 in IMCD cells. The increase in AQP2 expression from kidney cortex to inner medulla (29) suggests that NaCl-derived tonicity also controls AQP2 expression in vivo.

It is widely accepted that cAMP is an important factor in the expression (25) and trafficking of AQP2 in principal cells (30). There is also multiple, but mechanistically unexplained, evidence for an AVP-independent regulation of the water permeability of principal cells in the intact animal (30). Decreased AQP2 expression without changes in AVP or cAMP levels was observed in fasting and protein-deprived rats and humans (1, 35). Water deprivation increased AQP2 expression in rats chronically given V2R antagonists (24), indicating that the effect of water deprivation on AQP2 expression is not solely due to AVP-elicited cAMP accumulation. Water loading decreased AQP2 expression, despite chronic administration of the V2R-specific agonist desmopressin (8).

Studies have been conducted to investigate the effect of hypertonicity on AQP2 expression, but the results are unclear. Furuno et al. (10) reported a small increase in AQP2 mRNA in cultured mouse outer medullary collecting duct cells bathed for 24 h in hypertonic medium. The finding that a 5-day AVP infusion in rats subjected to thirst increased AQP2 expression to a similar extent in renal cortex (low osmolality) and medulla (high osmolality) favored the assumption that only cAMP, and not tissue osmolality or ionic strength, regulates AQP2 expression (37). No decrease in AQP2 expression was observed after medullary osmolyte washout in rats treated with furosemide for 4-5 days (23, 37). A stimulatory effect of osmolality on AQP2 protein levels in vivo has been suggested by Preisser et al. (32), who found a reduced AQP2 expression in senescent rats, which also exhibited a reduced medullary osmolality in the kidney, while papillary cAMP levels remained unchanged.

We observed that NaCl stimulated the expression of AQP2 in a dose-dependent manner when the cAMP-dependent pathway was stimulated (Fig. 9). This raises the question as to whether 4-5 days of furosemide treatment (see above) lowers the interstitial medullary NaCl concentration below a threshold presumably required for AQP2 expression. It is also possible that elevation of AVP, or other factors, compensates for the effect of decreased tonicity. Further evidence for a promoting influence of medullary osmolality is provided by a recent study (5a) in which it was found that AQP2 protein expression increases in senescent rats when medullary osmolality is restored. We suggest that NaCl-derived hypertonicity, which stimulated AQP2 expression in a dose-dependent manner, is a key factor leading to increased AQP2 expression (Fig. 9).

In the present study, elevation of medium osmolality from 300 to 600 mosmol/kgH2O by urea alone had no stimulatory effect on AQP2 expression (Fig. 8). Nevertheless, AQP2 expression was increased when IMCD cells were grown in medium containing 50 mM NaCl and 200 mM urea (Fig. 8, 600 NaCl/U 50/200) compared with cells grown without urea in the presence of 50 mM NaCl (Fig. 9). The importance of urea in the urine-concentrating mechanism, however, was first reported decades ago. Protein deprivation leads to a decreased urine-concentrating ability in animals and humans, which can be restored by urea infusion (5, 19, 31). More recently, the protein deprivation-induced decrease in urine-concentrating ability has been linked to a decrease in AQP2 protein expression in the tip of the inner medulla (30). Our findings indicate that urea itself has no effect on AQP2 expression but, instead, enhances the stimulatory effect of elevated NaCl concentrations.

Considering that osmolality and solute composition did not affect CREB phosphorylation, we assume that the effect of media osmolality and solute composition on AQP2 expression is not mediated by cAMP but is achieved via an alternative pathway. The observation that >500 µM DBcAMP reduces AQP2 protein levels but increases CREB phosphorylation suggests that higher DBcAMP levels activate factors repressing AQP2 transcription, AQP2 translation, or protein stability. Taken together, our data indicate that, in addition to elevated cAMP, NaCl-derived hypertonicity is required for sustained expression of AQP2.

A number of genes coding for proteins involved in the accumulation of osmoprotective solutes in the kidney, such as aldose reductase, sodium-myo-inositol cotransporter, and glycine-betaine transporter, have recently been shown to be regulated by tonicity. The regulatory element involved is the tonicity (osmolality)-responsive enhancer element TonE/ORE (9, 26, 28). On increases in tonicity, TonEBP abundance is upregulated and TonEBP translocates to the nucleus, where it activates tonicity-responsive genes. Miyakawa et al. (27) reported that full activation of TonEBP in response to hypertonicity required >10 h, which is consistent with the time required for a detectable increase in AQP2 expression elicited by hypertonicity (Fig. 7). Nuclear abundance and overall expression of TonEBP are rapidly decreased by hypotonic challenge (27, 38). As reported for AQP2 (24, 37), dehydration increases the sodium-myo-inositol cotransporter mRNA expression in rat renal medulla, whereas water loading decreases it. This response is presumably due to alterations in the amount of TonEBP present in the nucleus (4). The conservation of the TonE element within the rat and human AQP2 promoter (Fig. 7C) supports the idea that this element is most likely relevant to the genes' transcriptional regulation.

Altered TonEBP activity, due to altered medullary tonicity, might be responsible for AVP/cAMP-independent changes in AQP2 expression observed in water loading and thirsting (8, 24). The increase in AQP2 expression from kidney cortex to inner medulla (29) is also well explained by an increasing activity of TonEBP from kidney cortex to medulla. Thus the tonicity and the solute composition within a particular region of the renal collecting duct could limit the range of the effect of AVP/cAMP on the expression of AQP2 in vivo.


    ACKNOWLEDGEMENTS

We thank P. Deen for providing WT-10 cells. We are indebted to John Dickson (deceased December 2001) for invaluable help.


    FOOTNOTES

This work was supported by Deutsche Forschungsgemeinschaft Grant Ro 597/6, EV contract No. GLK-CT-2001-00987, and a grant from the Fond der Chemischen Industrie.

R. Storm is a Ph.D. student at the Freie Universität Berlin, Fachbereich Biologie, Chemie, Pharmazie, Takustr. 3, 14195 Berlin, Germany.

Present address of K. Maric: Bundesministerium für Gesundheit, Am Propsthof 78a, 53121 Bonn, Germany.

Address for reprint requests and other correspondence: R. Storm, Forschungsinstitut für Molekulare Pharmakologie, Campus Berlin-Buch, Robert-Rössle-Str. 10, 13125 Berlin, Germany (E-mail: storm{at}fmp-berlin.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

August 13, 2002;10.1152/ajprenal.00245.2002

Received 8 July 2002; accepted in final form 5 August 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Amlal, H, Chen Q, Habo K, Wang Z, and Soleimani M. Fasting downregulates renal water channel AQP2 and causes polyuria. Am J Physiol Renal Physiol 280: F513-F523, 2001[Abstract/Free Full Text].

2.   Bagnasco, S, Balaban R, Fales HM, Yang YM, and Burg M. Predominant osmotically active organic solutes in rat and rabbit renal medullas. J Biol Chem 261: 5872-5877, 1986[Abstract/Free Full Text].

3.   Beck, F, Dorge A, Rick R, and Thurau K. Intra- and extracellular element concentrations of rat renal papilla in antidiuresis. Kidney Int 25: 397-403, 1984[Web of Science][Medline].

4.   Cha, JH, Woo SK, Han KH, Kim YH, Handler JS, Kim J, and Kwon HM. Hydration status affects nuclear distribution of transcription factor tonicity responsive enhancer binding protein in rat kidney. J Am Soc Nephrol 12: 2221-2230, 2001[Abstract/Free Full Text].

5.   Crawford, JD, Doyle AP, and Probst H. Service of urea in renal water conservation. Am J Physiol 196: 545-548, 1959[Abstract/Free Full Text].

5a.   Combet, S, Geoffrey N, Berthonaud V, Dick B, Teillet L, Verbavatz JM, Corman B, and Trinh-Trang-Tan MM. Correction of age-related polyuria by DDAVP: molecular analysis of aquaporins and urea transporters. Am J Physiol Renal Physiol 284: F199-F208, 2002[Abstract/Free Full Text].

6.   Deen, PM, Rijss JP, Mulders SM, Errington RJ, van Baal J, and van Os CH. Aquaporin-2 transfection of Madin-Darby canine kidney cells reconstitutes vasopressin-regulated transcellular osmotic water transport. J Am Soc Nephrol 8: 1493-1501, 1997[Abstract].

7.   Deen, PM, Verdijk TMAJ, Knoers NVAM, Wieringa B, Monnens LAH, van Os CH, and van Oost BA. Requirement of aquaporin-2 for vasopressin-dependent concentration of urine. Science 264: 92-95, 1994[Abstract/Free Full Text].

8.   Ecelbarger, CA, Nielsen S, Olson BR, Murase T, Baker EA, Knepper MA, and Verbalis JG. Role of renal aquaporins in escape from vasopressin-induced antidiuresis in rat. J Clin Invest 99: 1852-1863, 1997[Web of Science][Medline].

9.   Ferraris, JD, Williams CK, Jung KY, Bedford JJ, Burg MB, and Garcia-Perez A. ORE, a eukaryotic minimal essential osmotic response element. The aldose reductase gene in hyperosmotic stress. J Biol Chem 271: 18318-18321, 1996[Abstract/Free Full Text].

10.   Furuno, M, Shinichi U, Fumiaki M, and Sasaki S. Repressive regulation of the aquaporin-2 gene. Am J Physiol Renal Fluid Electrolyte Physiol 271: F854-F860, 1996[Abstract/Free Full Text].

11.   Handler, JS, and Kwon JM. Cell and molecular biology of organic osmolyte accumulation in hypertonic renal cells. Nephron 87: 106-110, 2001[Web of Science][Medline].

12.   Hanski, C, Klussmann E, Wang J, Böhm C, Ogorek D, Hanski ML, Krüger-Krasagakes S, Eberle J, Schmitt-Gräff A, and Riecken EO. Fucosyltransferase III and sialyl-Lex expression correlate in cultured colon carcinoma cells but not in human colon carcinoma tissue. Glycoconj J 13: 1-7, 1996[Web of Science][Medline].

13.   Hozawa, S, Holtzman EJ, and Ausiello DA. cAMP motifs regulating transcription in the aquaporin 2 gene. Am J Physiol Cell Physiol 270: C1695-C1702, 1996[Abstract/Free Full Text].

14.   Jo, I, Nielsen S, and Harris HW. The 17 kD band identified by multiple anti-aquaporin antisera in rat kidney medulla is a histone. Biochim Biophys Acta 1324: 91-101, 1997[Medline].

15.   Klussmann, E, Edemir B, Pepperle B, Tamma G, Henn V, Klauschenz E, Hundsrucker C, Maric K, and Rosenthal W. Ht31: the first protein kinase A anchoring protein to integrate protein kinase A and Rho signaling. FEBS Lett 507: 264-268, 2001[Web of Science][Medline].

16.   Klussmann, E, Maric K, and Rosenthal W. The mechanisms of aquaporin control in the renal collecting duct. Rev Physiol Biochem Pharmacol 141: 33-95, 2000[Web of Science][Medline].

17.   Klussmann, E, Maric K, Wiesner B, Beyermann M, and Rosenthal W. Protein kinase A anchoring proteins are required for vasopressin-mediated translocation of aquaporin-2 into cell membranes of renal principal cells. J Biol Chem 274: 4934-4938, 1999[Abstract/Free Full Text].

18.   Klussmann, E, Tamma G, Lorenz D, Wiesner B, Maric K, Hofmann F, Aktories K, Valenti G, and Rosenthal W. An inhibitory role of Rho in the vasopressin-mediated translocation of aquaporin-2 into cell membranes of renal principal cells. J Biol Chem 276: 20451-20457, 2001[Abstract/Free Full Text].

19.   Levinsky, NG, and Berliner RW. The role of urea in the urine concentrating mechanism. J Clin Invest 38: 741-748, 1959[Web of Science][Medline].

20.   Liebenhoff, U, and Rosenthal W. Identification of Rab3-, Rab5a- and synaptobrevin II-like proteins in a preparation of rat kidney vesicles containing the vasopressin-regulated water channel. FEBS Lett 365: 209-213, 1995[Web of Science][Medline].

21.   Maric, K, Oksche A, and Rosenthal W. Aquaporin-2 expression in primary cultured rat inner medullary collecting duct cells. Am J Physiol Renal Physiol 275: F796-F801, 1998[Abstract/Free Full Text].

22.   Maric, K, Wiesner B, Lorenz D, Klussmann E, Betz T, and Rosenthal W. Cell volume kinetics of adherent epithelial cells measured by laser scanning reflection microscopy: determination of water permeability changes of renal principal cells. Biophys J 80: 1783-1790, 2001[Web of Science][Medline].

23.   Marples, D, Froekiaer J, Dorup J, Knepper MA, and Nielsen S. Hypokalemia-induced downregulation of aquaporin-2 water channel expression in rat kidney medulla and cortex. J Clin Invest 97: 1960-1968, 1996[Web of Science][Medline].

24.   Marples, D, Moenster Christensen B, Froekiaer J, Knepper MA, and Nielsen S. Dehydration reverses vasopressin antagonist-induced diuresis and aquaporin-2 downregulation in rats. Am J Physiol Renal Physiol 275: F400-F409, 1998[Abstract/Free Full Text].

25.   Matsumura, Y, Uchida S, Rai T, Sasaki S, and Marumo FS. Transcriptional regulation of aquaporin-2 water channel gene by cAMP. J Am Soc Nephrol 8: 861-867, 1997[Abstract].

26.   Miyakawa, H, Woo SK, Chen CP, Dahl SC, Handler JS, and Kwon HM. Cis- and trans-acting factors regulating transcription of the BGT1 gene in response to hypertonicity. Am J Physiol Renal Physiol 274: F753-F761, 1998[Abstract/Free Full Text].

27.   Miyakawa, H, Woo SK, Dahl SC, Handler JS, and Kwon HM. Tonicity-responsive enhancer binding protein, a Rel-like protein that stimulates transcription in response to hypertonicity. Proc Natl Acad Sci USA 96: 2538-2542, 1999[Abstract/Free Full Text].

28.   Moriyama, T, Garcia-Perez A, and Burg MB. Osmotic regulation of aldose reductase protein synthesis in renal medullary cells. J Biol Chem 264: 16810-16814, 1989[Abstract/Free Full Text].

29.   Nielsen, S, DiGiovanni SR, Christensen EI, Knepper MA, and Harris HW. Cellular and subcellular immunolocalization of vasopressin-regulated water channel in rat kidney. Proc Natl Acad Sci USA 90: 11663-11667, 1993[Abstract/Free Full Text].

30.   Nielsen, S, Frokiaer J, Marples D, Kwon TH, Agre P, and Knepper MA. Aquaporins in the kidney: from molecules to medicine. Physiol Rev 28: 205-244, 2002.

31.   Pennell, JP, Sanjana V, Frey NR, and Jamison RL. The effect of urea infusion on the urinary concentrating mechanism in protein-depleted rats. J Clin Invest 55: 399-409, 1975[Web of Science][Medline].

32.   Preisser, L, Teillet L, Aliotti S, Gobin R, Berthonaud V, Chevalier J, Corman B, and Verbavatz JM. Downregulation of aquaporin-2 and -3 in aging kidney is independent of V2 vasopressin receptor. Am J Physiol Renal Physiol 279: F144-F152, 2000[Abstract/Free Full Text].

33.   Rai, T, Uchida S, Marumo F, and Sasaki S. Cloning of rat and mouse aquaporin-2 gene promoters and identification of a negative cis-regulatory element. Am J Physiol Renal Physiol 273: F264-F273, 1997[Abstract/Free Full Text].

34.   Rim, JS, Atta MG, Dahl SC, Berry GT, Handler JS, and Kwon HM. Transcription of the sodium/myo-inositol cotransporter gene is regulated by multiple tonicity-responsive enhancers spread over 50 kilobase pairs in the 5'-flanking region. J Biol Chem 273: 20615-20621, 1998[Abstract/Free Full Text].

35.   Sands, JM, Naruse M, Jacobs JD, Wilcox JN, and Klein JD. Changes in aquaporin-2 protein contribute to the urine concentrating defect in rats fed a low-protein diet. J Clin Invest 97: 2807-2814, 1996[Web of Science][Medline].

36.   Stroud, JC, Lopez-Rodriguez C, Rao A, and Chen L. Structure of a TonEBP-DNA complex reveals DNA encircled by a transcription factor. Nat Struct Biol 9: 2, 2002[Web of Science][Medline].

37.   Terris, J, Ecelbarger CA, Nielsen S, and Knepper MA. Long-term regulation of four renal aquaporins in rats. Am J Physiol Renal Fluid Electrolyte Physiol 271: F414-F422, 1996[Abstract/Free Full Text].

38.   Woo, SK, Dahl SC, Handler JS, and Kwon HM. Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity. Am J Physiol Renal Physiol 278: F1006-F1012, 2000[Abstract/Free Full Text].

39.   Yancey, PH, Clark ME, Hand SC, Bowlus RD, and Somero GN. Living with water stress: evolution of osmolyte systems. Science 217: 1214-1222, 1982[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 284(1):F189-F198
0363-6127/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
U. Hasler, V. Leroy, P.-Y. Martin, and E. Feraille
Aquaporin-2 abundance in the renal collecting duct: new insights from cultured cell models
Am J Physiol Renal Physiol, July 1, 2009; 297(1): F10 - F18.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
M. S. Kwon, S. W. Lim, and H. M. Kwon
Hypertonic Stress in the Kidney: A Necessary Evil
Physiology, June 1, 2009; 24(3): 186 - 191.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
U. Hasler
Controlled aquaporin-2 expression in the hypertonic environment
Am J Physiol Cell Physiol, April 1, 2009; 296(4): C641 - C653.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Izumi, Y. Nakayama, H. Memetimin, T. Inoue, Y. Kohda, H. Nonoguchi, and K. Tomita
Regulation of V2R transcription by hypertonicity and V1aR-V2R signal interaction
Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1170 - F1176.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
T. Saito, T. Saito, K. Kasono, H. Tamemoto, M. Kawakami, S. Sasaki, and S.-e Ishikawa
Hypotonicity reduces the activity of murine aquaporin-2 promoter induced by dibutyryl cAMP
Exp Physiol, October 1, 2008; 93(10): 1147 - 1156.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Combet, S. Gouraud, R. Gobin, V. Berthonaud, G. Geelen, B. Corman, and J.-M. Verbavatz
Aquaporin-2 downregulation in kidney medulla of aging rats is posttranscriptional and is abolished by water deprivation
Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1408 - F1414.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. B. Burg, J. D. Ferraris, and N. I. Dmitrieva
Cellular Response to Hyperosmotic Stresses
Physiol Rev, October 1, 2007; 87(4): 1441 - 1474.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Vossenkamper, P. I. Nedvetsky, B. Wiesner, J. Furkert, W. Rosenthal, and E. Klussmann
Microtubules are needed for the perinuclear positioning of aquaporin-2 after its endocytic retrieval in renal principal cells
Am J Physiol Cell Physiol, September 1, 2007; 293(3): C1129 - C1138.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
D. Kim, M. Wang, Q. Cai, H. Brooks, and G. R. Dressler
Pax Transactivation-Domain Interacting Protein Is Required for Urine Concentration and Osmotolerance in Collecting Duct Epithelia
J. Am. Soc. Nephrol., May 1, 2007; 18(5): 1458 - 1465.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S.-Z. Li, B. W. McDill, P. A. Kovach, L. Ding, W. Y. Go, S. N. Ho, and F. Chen
Calcineurin-NFATc signaling pathway regulates AQP2 expression in response to calcium signals and osmotic stress
Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1606 - C1616.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
B. Zhou, D. K. Ann, X. Li, K.-J. Kim, H. Lin, P. Minoo, E. D. Crandall, and Z. Borok
Hypertonic induction of aquaporin-5: novel role of hypoxia-inducible factor-1{alpha}
Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1280 - C1290.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
V. Bahr, N. Franzen, W. Oelkers, A. F H Pfeiffer, and S. Diederich
Effect of exogenous glucocorticoid on osmotically stimulated antidiuretic hormone secretion and on water reabsorption in man
Eur. J. Endocrinol., December 1, 2006; 155(6): 845 - 848.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. H. Robben, N. V. A. M. Knoers, and P. M. T. Deen
Cell biological aspects of the vasopressin type-2 receptor and aquaporin 2 water channel in nephrogenic diabetes insipidus.
Am J Physiol Renal Physiol, August 1, 2006; 291(2): F257 - F270.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. L. Gooch, R. L. Guler, J. L. Barnes, and J. J. Toro
Loss of calcineurin A{alpha} results in altered trafficking of AQP2 and in nephrogenic diabetes insipidus
J. Cell Sci., June 15, 2006; 119(12): 2468 - 2476.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
U. Hasler, U. S. Jeon, J. A. Kim, D. Mordasini, H. M. Kwon, E. Feraille, and P.-Y. Martin
Tonicity-Responsive Enhancer Binding Protein Is an Essential Regulator of Aquaporin-2 Expression in Renal Collecting Duct Principal Cells
J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1521 - 1531.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
U. Hasler, M. Vinciguerra, A. Vandewalle, P.-Y. Martin, and E. Feraille
Dual Effects of Hypertonicity on Aquaporin-2 Expression in Cultured Renal Collecting Duct Principal Cells
J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1571 - 1582.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Rojek, J. Nielsen, H. L. Brooks, H. Gong, Y.-H. Kim, T.-H. Kwon, J. Frokiaer, and S. Nielsen
Altered expression of selected genes in kidney of rats with lithium-induced NDI
Am J Physiol Renal Physiol, June 1, 2005; 288(6): F1276 - F1289.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. Pihakaski-Maunsbach, S. Tokonabe, H. Vorum, C. J. Rivard, J. M. Capasso, T. Berl, and A. B. Maunsbach
The {gamma}-subunit of Na-K-ATPase is incorporated into plasma membranes of mouse IMCD3 cells in response to hypertonicity
Am J Physiol Renal Physiol, April 1, 2005; 288(4): F650 - F657.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Bustamante, U. Hasler, O. Kotova, A. V. Chibalin, D. Mordasini, M. Rousselot, A. Vandewalle, P.-Y. Martin, and E. Feraille
Insulin potentiates AVP-induced AQP2 expression in cultured renal collecting duct principal cells
Am J Physiol Renal Physiol, February 1, 2005; 288(2): F334 - F344.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/1/F189    most recent
00245.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Storm, R.
Right arrow Articles by Maric, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Storm, R.
Right arrow Articles by Maric, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online