|
|
||||||||
1 Departments of Medicine and 2 Integrative Biology and Pharmacology, University of Texas Medical School at Houston, Houston, Texas 77030; 3 Genome Technology Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892; and 4 Department of Medicine, University of Florida College of Medicine, Gainesville, Florida 32610
| |
ABSTRACT |
|---|
|
|
|---|
Pendrin is an anion exchanger expressed in type B intercalated cells of the cortical collecting duct (CCD). Whether pendrin localizes to other nephron segments with intercalated cells is unknown. Moreover, whether pendrin is expressed in proximal tubule is debated. Thus the distribution of pendrin mRNA and protein expression in mouse kidney was investigated by using light and electron microscopic immunohistochemistry and quantitative real-time PCR. We observed that pendrin mRNA is expressed mainly in cortex. Within cortex, pendrin mRNA is at least fivefold higher in CCD and the connecting tubule (CNT) than in the other segments. Pendrin protein was observed in a subset of cells within the distal convoluted tubule as well as in type B and in non-A-non-B intercalated cells of the CNT and CCD. In type B intercalated cells, pendrin immunoreactivity was highest in apical cytoplasmic vesicles with little immunolabel along the apical plasma membrane. In non-A-non-B intercalated cells, intense pendrin immunoreactivity was detected along the apical plasma membrane. These differences in the subcellular distribution of pendrin immunolabel were confirmed by morphometric analysis. In conclusion, pendrin is expressed in the mouse distal convoluted tubule, CCD, and CNT along the apical plasma membrane of non-A-non-B intercalated cells and in subapical cytoplasmic vesicles of type B intercalated cells.
intercalated cell; distal convoluted tubule; cortical collecting duct; connecting tubule; anion exchange
| |
INTRODUCTION |
|---|
|
|
|---|
INTERCALATED CELLS
MEDIATE transepithelial transport of net H+
equivalents along the collecting duct (24), a process
mediated largely through vacuolar H+- ATPase. However,
Brown et al. (3) observed that H+-ATPase has
opposite polarity within subpopulations of intercalated cells. Thus
these cells are thought to either secrete or absorb net H+
equivalents depending on whether H+-ATPase localizes to the
apical or the basolateral plasma membrane. Intercalated cells are
classified as type A, B, or non-A-non-B from immunological and
ultrastructural characteristics (30). The
immunohistochemical classification of these cells is based on the
presence or absence of AE1 immunoreactivity and the distribution of
H+-ATPase within the cell (16, 24, 30). The
distribution and expression of each of these transporters in
each intercalated cell subtype is displayed in Fig.
1. The ultrastructure of each cell type (A, B, and non-A-non-B) has been characterized
(30). Type A intercalated cells have a centralized
nucleus, prominent apical plasma membrane microprojections, and
prominent apical cytoplasmic membrane tubulovesicles. In the type A
intercalated cell, H+-ATPase is expressed on the apical
cytoplasmic vesicles and the apical plasma membrane, where it functions
in series with the Cl
/HCO
|
The non-A-non-B intercalated cell has been described in mice and rats (1, 16, 30). Non-A-non-B cells have a very high mitochondrial density, prominent apical plasma membrane microprojections, and sparse apical cytoplasmic vesicles (30). Similar to type A intercalated cells, this cell type has H+-ATPase in both the apical plasma membrane and in apical cytoplasmic vesicles; however, it does not express kAE1 (1, 16, 30). The physiological role of non-A-non-B intercalated cells in the regulation of acid-base homeostasis is, however, unknown (30).
Type B intercalated cells are distinguished from other intercalated
cell subtypes ultrastructurally by the presence of a relatively smooth
apical plasma membrane, an eccentric nucleus, clustered mitochondria,
and cytoplasmic vesicles distributed throughout the cell. In the type B
intercalated cell, H+-ATPase is expressed on the
basolateral plasma membrane and in cytoplasmic vesicles throughout the
cell (1, 16, 30). Type B intercalated cells are thought to
mediate HCO
/HCO

AE4 is an Na+-independent
Cl
/HCO
Pendrin represents another Na+-independent
Cl
/HCO
The distribution of pendrin in the mammalian kidney has been debated. Light and fluorescent microscopic immunolocalization studies of Royaux et al. (20) reported that pendrin protein is highly expressed in the apical region of a subpopulation of cells within the CCD of mice, rats, and humans in which H+-ATPase is either basolateral or apical (Fig. 1) but not in cells that express kAE1. Thus pendrin protein is expressed in the apical region of non-A intercalated cells. Localization of pendrin to the apical region of the type B intercalated cell raises the possibility that this transporter represents the putative apical anion exchanger of this cell type. However, other laboratories have reported a different distribution of pendrin expression within the cortex. Soleimani et al. (28) have investigated the distribution of pendrin mRNA and protein expression in rat kidney by using RT-PCR of individual nephron segments and immunoblots of brush-border membrane vesicles. They observed that pendrin message and protein are highly expressed not only in the CCD but also along the brush border of the proximal tubule. Pendrin mRNA expression was not measured in the other segments of the cortex. Localization of pendrin to the brush border suggests a different functional role for the transporter than is suggested with localization of the transporter to the apical membrane of the type B intercalated cell. The purpose of the present study was therefore to explore the cellular and subcellular distribution of pendrin message and protein in mouse kidney in greater detail.
| |
METHODS |
|---|
|
|
|---|
Animals. Nonalbino Swiss mice weighing 20-30 g were studied (Harlan, Ardmore, TX). Mice consumed a balanced rodent diet (Zeigler Brothers, Gardners, PA) and tap water. Mice were anesthetized with 100% O2 at 1 l/min with 4% isofluorane before death.
Dissection of tubules.
Mice were injected with 1.5 mg furosemide ip 30 min before death. The
kidney was perfused initially with 10 ml of ice-cold dissection
solution and then with 20 ml of the same solution containing 1 mg/ml
collagenase B (0.2 U/mg; Roche, Indianapolis, IN) and 1 mg/ml BSA
(Sigma). The dissection solution contained (in mM) 144 NaCl, 5 KCl, 1 Na2HPO4, 1.2 MgSO4, 2 CaCl2, 5.5 glucose, and 10 HEPES, pH 7.4. The kidneys were
removed, and a coronal section was made that contained the entire
corticopapillary axis. The cortex was separated from the rest of the
section and incubated in collagenase solution for 5 min at 37°C. The
tissue was transferred to the dissection solution with 1 mg/ml albumin
but without collagenase. Tissue was dissected at 4°C for not more
than 30 min. Nephron segments from the cortex were dissected as
described previously (22). Cortical thick ascending limbs
(cTALs), proximal straight tubules, and CCDs were dissected from the
medullary rays. CCD segments were at least 0.5 mm in length, had no
branched points, and displayed the typical "cobblestone"
appearance. Proximal convoluted tubules, glomeruli, and connecting
tubules (CNTs) were dissected from the cortical labyrinth. CNTs also
displayed the typical cobblestone appearance and were cut to span two
branched points. The distal convoluted tubule (DCT) was dissected
between its juncture with the macula densa and the beginning of the
CNT. Tubule length was measured with a calibrated optical micrometer.
The tubules were then transferred to an Eppendorf tube containing 0.5 ml dissection solution plus 10 µl RNAlater (Qiagen, Valencia, CA) but
without collagenase or albumin. Transfer of tubules was accomplished by using glass tubing coated with dissection solution containing 1%
albumin and connected to a Hamilton syringe with Silastic tubing. Samples were centrifuged at 11,750 g for 1 min at 4°C. The
supernatant was removed. The tissue was then snap frozen in liquid
nitrogen and stored at
80°C.
Preparation of total RNA from kidney slices.
After death, the left kidneys were excised from the mice and coronal
slices were made. Each slice was cut into three regions: cortex, outer
medulla, and inner medulla. Each piece was snap frozen in liquid
nitrogen and then weighed. Isolation of total RNA was performed by
using an RNeasy minikit (Qiagen). The kidney tissue was placed in RLT
buffer (20 ml buffer/g kidney tissue) with 10 µl/ml
-mercaptoethanol, homogenized (Omni tissue homogenizer, Omni/Tech
Quest, Warrenton, VA) at 15,000 rpm for 40 s, and placed on ice. A
600-µl aliquot of the lysate was centrifuged at 16,000 g
for 3 min. Six hundred microliters of 70% ethanol were added to the
supernatant and mixed. The resulting solution was then added directly
to an RNeasy spin column, and total RNA was isolated with a kit,
following the manufacturer's instructions (Qiagen). Total RNA (3.125 µg) was added to 125 µl diethyl pyrocarbonate-treated water
containing 0.016 U/µl RNAse-free DNase I, 4.2 mM MgCl2, 1 mM KCl, and 0.3 mM Tris, pH 8.4. The mixture was incubated at 37°C
for 30 min and then at 75°C for 10 min and then placed on ice and
stored at
80°C.
Preparation of total RNA from individual tubules.
Total RNA was prepared from individual nephron segments by using the
Epicentre Kit (Epicentre Technologies, Madison, WI) following the
instructions of the manufacturer with minor modifications. Cell lysis
solution (150 µl) with 25 µg proteinase K was added to each sample.
Samples were incubated at 65°C for 30 min while being vortexed for
5 s every 10 min and then placed on ice for 3-5 min.
MasterPure complete protein precipitation reagent (75 µl) was added
to each lysed sample, vortexed for 10 s, and then centrifuged at
10,000 g for 10 min. Ice-cold isopropanol (250 µl)
was added to the supernatant of each sample. Samples were then inverted
30-40 times and centrifuged at 10,000 g for 10 min at
4°C. The isopropanol was decanted, and the pellet was rinsed twice
with ice-cold 75% ethanol and then resuspended in 65 µl diethyl
pyrocarbonate-treated water with 4 mM MgCl2, 1 mM KCl, 0.3 mM Tris, pH 8.4, and 0.016 U/µl DNAse I. The samples were vortexed
and incubated at 37°C for 30 min. The DNase I reaction was stopped by
transferring the samples to 75°C for 10 min. Samples were then stored
at
80°C.
Quantitative real-time RT-PCR.
Quantitative real-time PCR was performed in the Quantitative Genomics
Core Laboratory in the Department of Integrative Biology and
Pharmacology utilizing a 7700 Sequence Detector (Applied Biosystems, Foster City, CA) (4, 15). Specific quantitative assays for mouse pendrin and
-actin were developed by using Primer Express software (Applied Biosystems) following the recommended guidelines on
the basis of sequences from GenBank: 1) mouse pendrin
qRT-PCR assay (accession no. AF-1674110), 1483(+): GCTGGCCTCATCTCAGCTG, 1552(
): GCAAGGGTTCCAGAAGCCT, 1504(+):
6-carboxyfluorescein (FAM)/ 6-carboxy-tetramethylrhodamine
(TAMRA): ATTGTGATGGTTGCCATCGTTGCC; and 2) mouse
-actin
qRT-PCR assay (accession no. X03672), 1035(+): GCTCTGGCTCCTAGCACCAT,
1108(
): CCACCGATCCACACAGAGTAC, 1059(+): FAM/TAMRA: ATCAAGATCATTGCTCCTCCTGAGCGC.
-actin transcript levels were measured in
each sample assayed for pendrin mRNA.
-Actin and pendrin mRNA are
expressed as pendrin transcript per millimeter tubule (or per 10 glomeruli).
Antibody. The primary anti-pendrin antibody was a polyclonal antibody raised in rabbit that recognizes amino acids 766-780 of the human pendrin protein sequence. This antibody has been characterized previously and used for immunolocalization of pendrin in normal mouse kidney (20). For immunohistochemical localization of the thiazide-sensitive Na-Cl cotransporter (TSC), we used a polyclonal antibody raised in rabbit against a 110-amino acid segment of the NH2 terminus of rTSC1, which corresponds to amino acids 2-112 of the rat rTSC1. This antibody has been characterized previously (18) and was a gift from Dr. Steven C. Hebert (Yale University School of Medicine, New Haven, CT).
Tissue preparation for light microscopy. For light microscopic studies, ~2-mm-thick transverse sections of kidney from each animal were embedded in polyester wax (polyethylene glycol 400 distearate, Polysciences, Warrington, PA), and 5-µm-thick sections were cut and mounted on gelatin-coated glass slides.
Colocalization of pendrin and TSC immunoreactivity. Colocalization of pendrin and thiazide-sensitive cotransporter immunoreactivity was accomplished by using sequential immunoperoxidase procedures. Five-micrometer sections were dewaxed in ethanol, rehydrated, and then rinsed in PBS. Endogenous peroxidase activity was blocked by incubation of the sections in 0.3% H2O2 for 30 min. The sections were rinsed in PBS, treated for 20 min with 5% goat serum in PBS, and then incubated at 4°C overnight with the anti-pendrin antibody diluted 1:1,000 in PBS. The sections were washed twice in PBS for 5 min and then incubated for 30 min with peroxidase-conjugated goat anti-rabbit F(ab)2 secondary antibody (Jackson Immunoresearch, West Grove, PA) diluted 1:200 in PBS and then washed with PBS. The sections were then exposed to diaminobenzidine (peroxidase substrate kit, Vector Laboratories, Burlingame, CA). The sections were washed in glass-distilled water and then in PBS and incubated in 0.3% H2O2 for 30 min. The sections were again washed in PBS and incubated for 20 min with 5% normal goat serum in PBS. The sections were treated for 60 min with the anti-TSC antibody diluted 1:8,000 in PBS, washed in PBS, incubated for 30 min with the peroxidase-conjugated anti-rabbit secondary antibody, and then again washed with PBS. For detection of TSC immunoreactivity, Vector SG (Vector Laboratories) was used as the chromogen to produce a blue label. This label was easily distinguishable from the brown label produced by the diaminobenzidine used for detection of pendrin immunoreactivity. The sections were washed with glass-distilled water, dehydrated with xylene, mounted with Permount (Fisher Scientific, Fair Lawn, NJ), and observed by light microscopy. In each colocalization experiment, three control slides were included in which PBS only was substituted for the anti-pendrin primary antibody, the anti-TSC primary antibody, or both primary antibodies.
Tissue processing for immunoelectron microscopy. Mice were anesthetized and the kidneys were preserved by in vivo cardiac perfusion with 3% paraformaldehyde, 0.12% picric acid in PBS, pH 7.4, followed by overnight immersion at 4°C. The tissue was rinsed in PBS, and samples from the outer and inner cortex were immersed in 0.1 M NH4Cl for 1 h at 4°C. The tissue samples were then dehydrated in a graded series of alcohols and processed and embedded in Lowicryl K4M (Electron Microscopy Sciences, Ft. Washington, PA). Lowicryl polymerization was carried out under ultraviolet light for 24 h at 20°C and then for 48 h at room temperature. Samples containing well-preserved connecting segment and collecting duct were selected after light microscopic examination of 1-µm-thick sections stained with toluidine blue. Ultrathin sections of these were mounted on Formvar/carbon-coated nickel grids for immunogold cytochemistry.
Immunogold labeling. Briefly, the immunogold labeling procedure was performed by exposure of the ultrathin tissue sections to the primary antibody and then to a goat anti-rabbit IgG secondary antibody conjugated to 0.8-nm colloidal gold particles (Aurion UltraSmall gold conjugate, Electron Microscopy Sciences), followed by silver enhancement (Aurion R-Gent SE-EM, Electron Microscopy Sciences). Unless noted otherwise, all steps were done by floating the grids on droplets of solution at room temperature. The following solutions were used: incubation solution, 0.2% acetylated BSA (Aurion BSA-c, Electron Microscopy Sciences) and 10 mM NaN3, in PBS, pH 7.4; and blocking solution, 5% BSA, 0.1% cold-water fish-skin gelatin, and 5% normal goat serum, in PBS. The sections were exposed to 0.05 mM glycine in PBS for 15 min, incubated with the blocking solution for 30 min, washed with incubation solution, and then incubated in a humidified chamber overnight at 4°C with the primary antibody diluted 1:1,000 in incubation solution. The sections were then washed with incubation solution and incubated for 1.5 h with the secondary antibody diluted 1:100 in incubation solution. The sections were washed with incubation buffer, washed with PBS, postfixed with 1.25% glutaraldehyde in PBS, washed with PBS, and finally washed with glass-distilled water. The sections were then exposed to the silver- enhancement reagent for 40 min, washed with glass-distilled water, and counterstained with saturated uranyl acetate and lead citrate. Each group of sections subjected to the immunogold procedure included a control section that was exposed to incubation buffer in place of the primary antibody.
Electron microscopy. Ultrathin sections were examined with a Zeiss-EM10 transmission electron microscope. The CCD was identified by its characteristic heterogeneous epithelial cell population, which included principal cells and intercalated cells, and its location parallel to a cTAL of Henle's loop in the medullary ray. Connecting segments and initial collecting tubules (ICTs) were located in the cortical labyrinth between medullary rays. ICTs were identified by their epithelial cell morphology, which is similar to that described for the CCD. Connecting segments were distinguished from ICTs by the increased height of the epithelial cells and presence of tall vertical mitochondria in the connecting segment cells.
The mouse CCD and CNT contain at least three morphologically distinct intercalated cell subtypes: type A, type B, and a third cell type that has been identified in both rat and mouse kidney and referred to as non-A-non-B (30). The morphological characteristics used to identify these intercalated cell subtypes were established in morphological and immunocytochemical studies of both rat and mouse collecting duct (16, 30). Type A intercalated cells typically contain a centralized nucleus, mitochondria that are distributed throughout the cell, moderate apical plasma membrane microprojections, and prominent apical cytoplasmic membrane tubulovesicles that have relatively electron-dense limiting membranes. Type B intercalated cells typically exhibit a rounded cell outline, eccentric nucleus, clustered mitochondria, relatively smooth apical plasma membrane, and cytoplasmic vesicles throughout the cell. The cytoplasmic vesicles of type B intercalated cells are typically smaller in profile, and the limiting membranes are less electron dense than those in type A intercalated cells. Type B interalated cells frequently exhibit a vesicle-free band of cytoplasm along the apical plasma membrane. The third intercalated cell subtype, non-A-non-B, has distinctive morphological features, including a very high mitochondrial density, prominent apical plasma membrane microprojections, and relatively few cytoplasmic vesicles, which are apical.Morphometric analysis. The boundary length of the apical plasma membrane, cytoplasm area, number of gold particles along the apical plasma membrane, and number of gold particles over the cytoplasm, including cytoplasmic vesicles, were quantified in type B and non-A-non-B intercalated cells (34) in three individual mice. A minimum of five of each intercalated cell type in each animal were selected randomly and photographed at a primary magnification of ×6,200. Individual photomicrographs were examined at a final magnification of approximately ×23,400. The exact magnification was calculated by using a calibration grid with 1,134 lines/mm.
The boundary length of the apical plasma membrane was determined by intersection counting using the Merz curvilinear test grid with a distance of 20 mm between the points corresponding to 0.856 µm (D) (34). The boundary length (B) was calculated from the equation
|
|
Statistical analysis. For the RT-PCR, data comparisons among three or more groups were made by using ANOVA with Tukey's posttest. For comparisons of gold label density, repeated-measures ANOVA with Tukey's posttest was used. Statistical significance was achieved with a P < 0.05. Data are displayed as means ± SE.
| |
RESULTS |
|---|
|
|
|---|
Distribution of pendrin message in mouse kidney.
Pendrin message abundance was examined in the cortex, outer medulla,
and inner medulla of mouse kidney. As shown in Fig.
2, expression of pendrin relative to
-actin mRNA was low in both the outer and the inner medulla.
However, pendrin transcript expression was 6- to 10-fold higher in the
cortex than in the medulla, similar to previously published results in
rats (28). However,
-actin mRNA/100 ng total RNA was
the same in all three regions of the kidney (Fig. 2). Because pendrin
mRNA is highly expressed in mouse cortex, the distribution of pendrin
message within this region of the kidney was studied in greater detail.
|
-actin mRNA abundance was measured in each sample studied.
In contrast to the distribution of pendrin expression,
-actin
message was not lower in glomeruli, cTAL, and proximal tubule than in
CCD and CNT (Fig. 3). Therefore the relatively low levels of pendrin
mRNA detected in glomeruli and proximal tubule were not the result of
RNA degradation. We conclude that nephron segments containing type B
intercalated cells, such as CNT and CCD, express high levels of pendrin
mRNA.
|
Light and electron microscopic immunolocalization of pendrin
protein in mouse kidney cortex.
Because pendrin protein and mRNA (20, 28) are most highly
expressed in cortex, the distribution of pendrin immunoreactivity in
mouse cortex was studied in greater detail by using light microscopic immunohistochemistry of mouse kidney cortex labeled for pendrin. We
observed that within the mouse kidney, the distribution of pendrin
protein was similar to the distribution of pendrin mRNA described
above. As reported previously (20), pendrin
immunoreactivity was not observed in the glomerulus, proximal tubule,
or thick ascending limb of Henle's loop (Fig.
4). Figure 4 shows labeling of a subset
of cells within the collecting duct, as described previously
(20). Because the DCT contains intercalated cells (16), pendrin expression in this segment was explored. To
determine whether pendrin is expressed in the DCT, sections were
labeled with antibodies specific for pendrin and for the TSC, a marker of DCT. Although the majority of DCT profiles did not exhibit pendrin-positive cells, a minority of cells with pendrin
immunoreactivity were present in occasional tubules that expressed TSC
(Fig. 4). In rare profiles, continuous apical TSC
immunoreactivity was interrupted by a few pendrin-positive cells (Fig.
4d). Thus pendrin is expressed in a subset of cells within
the DCT. Furthermore, some tubule profiles were observed that contained
the transition from the DCT to the CNT (Fig. 4b). In these
tubules, the DCT portion contained nearly continuous apical TSC
immunoreactivity with rare pendrin-positive cells, whereas the CNT
portion contained primarily cells that were negative for TSC
immunoreactivity and a minority of cells with apical pendrin
immunoreactivity (Fig. 4b). In addition, occasional CNT
profiles were observed that had negative cells, pendrin-positive cells,
and TSC-positive cells interspersed (Fig. 4c).
|
|
|
|
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The kidney has a tremendous capacity to excrete alkaline loads.
For example, after drinking hypertonic NaHCO3 for 5-8
days, rats develop only a mild metabolic alkalosis (14).
During metabolic alkalosis apical
Cl
/HCO
equivalents along the CCD
(29). Thus determination of the gene product responsible
for apical anion exchange represents an important issue in renal physiology.
Apical anion exchange in the CCD has been well studied by using
isolated CCD tubules perfused in vitro. During metabolic alkalosis, the
CCD secretes HCO
present in
the luminal fluid but is Na+ independent and
electroneutral, consistent with Na+-independent
Cl
/HCO
/HCO
transport function for each
intercalated cell subtype.
Because pendrin mediates Cl
/OH
,
Cl
/HCO
/formate
exchange in heterologous
expression systems (26, 28) and because it localizes to
the apical membrane of type B intercalated cells, pendrin represents a
candidate gene for the putative apical anion exchanger of the type B
intercalated cell (20). Pendrin could mediate
HCO

or
formate
. However, the physiological role of pendrin may
be more for regulation of halide balance, such as Cl
or
I
, rather than for regulation of acid-base balance.
Pendrin is expressed in type B cells, the predominant non-A
intercalated cell of the mouse CCD (30). Thus both pendrin
and apical Na+-independent
Cl
/HCO


/
), absorbed HCO

In mice, cells with the morphological characteristics of intercalated
cells of the B type express H+-ATPase along the basolateral
plasma membrane and diffusely within cytoplasmic vesicles
(30). The presence of pendrin in the subapical space of
cells known to express H+-ATPase within the cytoplasm
raises the question of whether these cells have the capacity to up- or
downregulate transepithelial transport of net H+ or
OH
equivalents or Cl
through trafficking of
these transporters between the cytosol and the plasma membrane
following changes in acid-base balance. These questions, however,
will remain the subject of future studies.
As described previously in ultrastructural studies of the mouse (30), we observed that non-A-non-B cells are most prevalent in the CNT, less frequently observed in the ICT, and not detected in the CCD. The subcellular distribution of pendrin differs markedly in type B vs. non-A-non-B cells. In non-A-non-B cells, pendrin protein is highly expressed along the apical plasma membrane. These observations predict that in mice under basal conditions, apical anion exchange, due to pendrin, occurs to a greater extent in non-A-non-B cells than in type B cells. Thus in untreated mice, pendrin-mediated anion exchange is likely greater in the CNT than in the CCD. However, this hypothesis cannot be tested directly because the CNT is not easily perfused in vitro.
Occasional intercalated cells are found in the late DCT of mouse kidney (16). In the DCT, the vast majority of non-A intercalated cells in mouse DCT are non-A-non-B intercalated cells (16). Because pendrin labeling was observed by light microscopic immunohistochemistry in a subset of cells within occasional DCT profiles, it is likely that pendrin is expressed in non-A-non-B intercalated cells. However, this could not be confirmed by ultrastructural observation because DCT profiles containing intercalated cells were not observed by electron microscopy. The failure to observe by electron microscopy DCT profiles containing intercalated cells is not surprising, because the great majority of DCT profiles did not contain pendrin-positive cells.
In mice, intercalated cells that display the morphological
characteristics of non-A-non-B intercalated cells express
H+-ATPase in the apical plasma membrane and diffusely
within cytoplasmic vesicles (30). Expression of both
pendrin and H+-ATPase along the apical plasma membrane of
non-A-non-B cells is surprising because pendrin is thought to mediate
HCO

transport.
We observed the distribution of pendrin protein and mRNA to be similar in mouse kidney. Previous studies have detected pendrin mRNA in proximal tubule and CCD of rats by using Northern blots and RT-PCR (28). Use of quantitative real-time PCR has the advantage over Northern blots and other RT-PCR techniques in that it allows pendrin mRNA expression to be quantified over a 5-log range (4, 15). Using this technique, we observed expression of pendrin in the proximal tubule and the CCD, as reported by Soleimani et al. (28). However, in mice, pendrin mRNA expression is more than fivefold higher in CNT and CCD than in both proximal tubule and cTAL.
In conclusion, pendrin is highly expressed in the CNT and the CCD of mouse kidney. Pendrin is expressed in intercalated cells in a minority of DCT profiles, likely in the late portion of the DCT. Pendrin protein and mRNA expression are lower in the other structures of the mouse cortex. Expression of pendrin in the apical plasma membrane is greater in non-A-non-B intercalated cells than in type B intercalated cells. The observed differences in the subcellular distribution of pendrin immunoreactivity in type B intercalated cells and non-A-non-B intercalated cells suggest that under the conditions of these experiments, non-A-non-B intercalated cells are more actively involved in pendrin-mediated anion exchange than are type B intercalated cells. However, the presence of pendrin immunoreactivity in the apical cytoplasmic vesicles in both type B and non-A-non-B intercalated cells suggests that vesicle trafficking may occur in both cell types to regulate pendrin-mediated anion exchange under different physiological conditions.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Mae De la Caldenza and Michael P. Fischer (Department of Medicine, University of Texas Medical School, Houston, TX) and Melissa A. Lewis, Lauren DeWitt, and Dr. Sharon W. Matthews (University of Florida College of Medicine, Electron Microscopy Core Facility, Gainesville, FL) for technical assistance. We thank Dr. Mark Knepper for helpful suggestions.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-52935 (S. M. Wall).
1
In mouse DCT, we observed pendrin mRNA per
millimeter tubule length to be 61,417 ± 47,769 (n = 3) vs. 145,433 ± 79,892 (n = 3) for
-actin.
However, it is not possible to identify dissected DCT unambiguously in
mouse kidney (5).
Address for reprint requests and other correspondence: S. M. Wall, Renal Division, Emory University School of Medicine, WMRB, Rm. 338, 1639 Pierce Dr. NE, Atlanta, GA 30322.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
August 27, 2002;10.1152/ajprenal.00147.2002
Received 17 April 2002; accepted in final form 20 August 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alper, SL,
Natale J,
Gluck S,
Lodish HF,
and
Brown D.
Subtypes of intercalated cells in rat kidney collecting duct defined by antibodies against erythroid band 3 and renal vacuolar H+-ATPase.
Proc Natl Acad Sci USA
86:
5429-5433,
1989
2.
Bastani, B,
Purcell H,
Hemken P,
Trigg D,
and
Gluck S.
Expression and distribution of renal vacuolar proton-translocating adenosine triphosphatase in response to chronic acid and alkali loads in the rat.
J Clin Invest
88:
126-136,
1991[Web of Science][Medline].
3.
Brown, D,
Hirsch S,
and
Gluck S.
Localization of a proton-pumping ATPase in rat kidney.
J Clin Invest
82:
2114-2126,
1988[Web of Science][Medline].
4.
Bustin, SA.
Absolute quantification of mRNA using real-time reverse transcriptase polymerase reaction assay.
J Mol Endocrinol
25:
169-193,
2000[Abstract].
5.
Ciampolillo, F,
McCoy DE,
Green RB,
Karlson KH,
Dagenais A,
Molday RS,
and
Stanton BA.
Cell-specific expression of amiloride-sensitive, Na+-conducting ion channels in the kidney.
Am J Physiol Cell Physiol
271:
C1303-C1315,
1996
6.
Drenckhahn, D,
Schluter K,
Allen DP,
and
Bennett V.
Colocalization of band 3 with ankyrin and spectrin at the basal membrane of intercalated cells in the rat kidney.
Science
230:
1287-1289,
1985
7.
Elkjaer, ML,
Hager H,
Ishibashi K,
Muallem S,
Frokier J,
and
Nielsen S.
Laser confocal microscopical and immunoelectron microscopical localization of anion exchanger AE4 in rat kidney (Abstract).
J Am Soc Nephrol
12:
3A,
2001.
8.
Emmons, C.
Functional characterization of anion exchange in mouse cortical collecting duct (CCD) intercalated cells (ICs) (Abstract).
J Am Soc Nephrol
8:
5A,
1997.
9.
Emmons, C.
Transport characteristics of the apical anion exchanger of rabbit cortical collecting duct b-cells.
Am J Physiol Renal Physiol
276:
F635-F643,
1999
10.
Emmons, C,
and
Kurtz I.
Functional characterization of three intercalated cell subtypes in the rabbit outer cortical collecting duct.
J Clin Invest
93:
417-423,
1994[Web of Science][Medline].
11.
Everett, LA,
Glaser B,
Beck JC,
Idol JR,
Buchs A,
Heyman M,
Adawi F,
Hazani E,
Nassir E,
Baxevanis AD,
Sheffield VC,
and
Green ED.
Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS).
Nat Genet
17:
411-422,
1997[Web of Science][Medline].
12.
Fejes-Toth, G,
Chen WR,
Rusvai E,
Moser T,
and
Naray-Fejes-Toth A.
Differential expression of AE1 in renal HCO
13.
Gluck, S,
Kelly S,
and
Al-Awqati Q.
The proton translocating ATPase responsible for urinary acidification.
J Biol Chem
257:
9230-9233,
1982
14.
Good, DW.
Adaptation of HCO

15.
Heid, CA,
Stevens J,
Livak KJ,
and
Williams PM.
Real time quantitative PCR.
Genome Res
6:
986-994,
1996
16.
Kim, J,
Kim YH,
Cha JH,
Tisher CC,
and
Madsen KM.
Intercalated cell subtypes in connecting tubule and cortical collecting duct of rat and mouse.
J Am Soc Nephrol
10:
1-12,
1999
17.
Kudrycki, KE,
and
Shull GE.
Primary structure of the rat kidney band 3 anion exchange protein deduced from a cDNA.
J Biol Chem
264:
8185-8192,
1989
18.
Plotkin, MD,
Kaplan MR,
Verlander JW,
Lee WS,
Brown D,
Poch E,
Gullans SR,
and
Hebert SC.
Localization of the thiazide sensitive Na-Cl cotransporter, rTSC1 in the rat kidney.
Kidney Int
50:
174-183,
1996[Web of Science][Medline].
19.
Royaux, IE,
Suzuki K,
Mori A,
Katoh R,
Everett LA,
Kohn LD,
and
Green ED.
Pendrin, the protein encoded by the pendred syndrome gene (PDS), is an apical porter of iodide in the thyroid and is regulated by thyroglobulin in FRTL-5 cells.
Endocrinology
141:
839-845,
2000
20.
Royaux, IE,
Wall SM,
Karniski LP,
Everett LA,
Suzuki K,
Knepper MA,
and
Green ED.
Pendrin, encoded by the pendred syndrome gene, resides in the apical region of renal intercalated cells and mediates bicarbonate secretion.
Proc Natl Acad Sci USA
98:
4221-4226,
2001
21.
Sabolic, I,
Brown D,
Gluck SL,
and
Alper SL.
Regulation of AE1 anion exchanger and H+-ATPase in rat cortex by acute metabolic acidois and alkalosis.
Kidney Int
51:
125-137,
1997[Web of Science][Medline].
22.
Sands, JM,
Terada Y,
Bernard LM,
and
Knepper MA.
Aldose reductase activities in microdissected rat renal tubule segments.
Am J Physiol Renal Fluid Electrolyte Physiol
256:
F563-F569,
1989
23.
Schuster, VL.
Bicarbonate reabsorption and secretion in the cortical and outer medullary collecting tubule.
Semin Nephrol
10:
139-147,
1990[Web of Science][Medline].
24.
Schuster, VL.
Function and regulation of collecting duct intercalated cells.
Annu Rev Physiol
55:
267-288,
1993[Web of Science][Medline].
25.
Schuster, VL,
Fejes-Toth G,
Naray-Fejes-Toth A,
and
Gluck S.
Colocalization of H+-ATPase and band 3 anion exchanger in rabbit collecting duct intercalated cells.
Am J Physiol Renal Fluid Electrolyte Physiol
260:
F506-F517,
1991
26.
Scott, DA,
and
Karniski LP.
Human pendrin expressed in Xenopus laevis oocytes mediates chloride/formate exchange.
Am J Physiol Cell Physiol
278:
C207-C211,
2000
27.
Scott, DA,
Wang R,
Kreman TM,
Sheffield VC,
and
Karniski LP.
The pendred syndrome gene encodes a chloride-iodide transport protein.
Nat Genet
21:
440-443,
1999[Web of Science][Medline].
28.
Soleimani, M,
Greeley T,
Petrovic S,
Wang Z,
Amlal H,
Kopp P,
and
Burnham CE.
Pendrin: an apical Cl
/OH
/HCO
29.
Star, RA,
Burg MB,
and
Knepper MA.
Bicarbonate secretion and chloride absorption by rabbit cortical collecting ducts: role of chloride/bicarbonate exchange.
J Clin Invest
76:
1123-1130,
1985[Web of Science][Medline].
30.
Teng-ummnuay, P,
Verlander JW,
Yuan W,
Tisher CC,
and
Madsen KM.
Identification of distinct subpopulations of intercalated cells in the mouse collecting duct.
J Am Soc Nephrol
7:
260-274,
1996[Abstract].
31.
Tsuganezawa, H,
Kobayashi K,
Iyori M,
Araki T,
Koizumi A,
Watanabe SI,
Kaneko A,
Fukao T,
Monkawa T,
Yoshida T,
Kim DK,
Kanai Y,
Endou H,
Hayashi M,
and
Saruta T.
A new member of the HCO
32.
van Adelsberg, JS,
Edwards JC,
and
Al-Awqati Q.
The apical Cl/HCO3 exchanger of b intercalated cells.
J Biol Chem
268:
11283-11289,
1993
33.
Verlander, JW,
Madsen KM,
Cannon JK,
and
Tisher CC.
Activation of acid-secreting intercalated cells in rabbit collecting duct with ammonium chloride loading.
Am J Physiol Renal Fluid Electrolyte Physiol
266:
F633-F645,
1994
34.
Weibel, ER,
and
Bolender RP.
Stereological techniques for electron microscopic morphometry.
In: Principles and Techniques of Electron Microscopy, edited by Hayat MA.. New York: Van Nostrand Reinhold, 1973, p. 237-296.
35.
Weiner, ID,
Weill AE,
and
New AR.
Distribution of Cl
/HCO
This article has been cited by other articles:
![]() |
Y. H. Kim, T. D. Pham, W. Zheng, S. Hong, C. Baylis, V. Pech, W. H. Beierwaltes, D. B. Farley, L. E. Braverman, J. W. Verlander, et al. Role of pendrin in iodide balance: going with the flow Am J Physiol Renal Physiol, October 1, 2009; 297(4): F1069 - F1079. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Kim, J. W. Verlander, J. M. Bishop, B. D. Cain, K.-H. Han, P. Igarashi, H.-W. Lee, M. E. Handlogten, and I. D. Weiner Basolateral expression of the ammonia transporter family member Rh C glycoprotein in the mouse kidney Am J Physiol Renal Physiol, March 1, 2009; 296(3): F543 - F555. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hafner, R. Grimaldi, P. Capuano, G. Capasso, and C. A. Wagner Pendrin in the mouse kidney is primarily regulated by Cl- excretion but also by systemic metabolic acidosis Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1658 - C1667. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Fioravante, R.-Y. Liu, and J. H. Byrne The Ubiquitin-Proteasome System Is Necessary for Long-Term Synaptic Depression in Aplysia J. Neurosci., October 8, 2008; 28(41): 10245 - 10256. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Schliebe, R. Strotmann, K. Busse, D. Mitschke, H. Biebermann, L. Schomburg, J. Kohrle, J. Bar, H. Rompler, J. Wess, et al. V2 vasopressin receptor deficiency causes changes in expression and function of renal and hypothalamic components involved in electrolyte and water homeostasis Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1177 - F1190. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Adler, E. Efrati, and I. Zelikovic Molecular mechanisms of epithelial cell-specific expression and regulation of the human anion exchanger (pendrin) gene Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1261 - C1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Lynch, A. Rudin, S.-L. Xia, L. R. Stow, G. E. Shull, I. D. Weiner, B. D. Cain, and C. S. Wingo Impaired acid secretion in cortical collecting duct intercalated cells from H-K-ATPase-deficient mice: role of HK{alpha} isoforms Am J Physiol Renal Physiol, March 1, 2008; 294(3): F621 - F627. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pech, W. Zheng, T. D. Pham, J. W. Verlander, and S. M. Wall Angiotensin II Activates H+-ATPase in Type A Intercalated Cells J. Am. Soc. Nephrol., January 1, 2008; 19(1): 84 - 91. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lang, V. Vallon, M. Knipper, and P. Wangemann Functional significance of channels and transporters expressed in the inner ear and kidney Am J Physiol Cell Physiol, October 1, 2007; 293(4): C1187 - C1208. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. H. Kim, V. Pech, K. B. Spencer, W. H. Beierwaltes, L. A. Everett, E. D. Green, W. Shin, J. W. Verlander, R. L. Sutliff, and S. M. Wall Reduced ENaC protein abundance contributes to the lower blood pressure observed in pendrin-null mice Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1314 - F1324. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Y. Na, G.-H. Kim, K. W. Joo, J. W. Lee, H. R. Jang, Y. K. Oh, U. S. Jeon, S.-W. Chae, M. A. Knepper, and J. S. Han Chronic furosemide or hydrochlorothiazide administration increases H+-ATPase B1 subunit abundance in rat kidney Am J Physiol Renal Physiol, June 1, 2007; 292(6): F1701 - F1709. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zheng, J. W. Verlander, I. J. Lynch, M. Cash, J. Shao, L. R. Stow, B. D. Cain, I. D. Weiner, S. M. Wall, and C. S. Wingo Cellular distribution of the potassium channel KCNQ1 in normal mouse kidney Am J Physiol Renal Physiol, January 1, 2007; 292(1): F456 - F466. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Kim, J.-H. Jung, E.-Y. Park, C.-W. Yang, H. Kim, S. Nielsen, K. M. Madsen, and J. Kim Expression of protein kinase C isoenzymes {alpha}, betaI, and {delta} in subtypes of intercalated cells of mouse kidney Am J Physiol Renal Physiol, November 1, 2006; 291(5): F1052 - F1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Verlander, Y. H. Kim, W. Shin, T. D. Pham, K. A. Hassell, W. H. Beierwaltes, E. D. Green, L. Everett, S. W. Matthews, and S. M. Wall Dietary Cl- restriction upregulates pendrin expression within the apical plasma membrane of type B intercalated cells Am J Physiol Renal Physiol, October 1, 2006; 291(4): F833 - F839. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Han, B. P. Croker, W. L. Clapp, D. Werner, M. Sahni, J. Kim, H.-Y. Kim, M. E. Handlogten, and I. D. Weiner Expression of the Ammonia Transporter, Rh C Glycoprotein, in Normal and Neoplastic Human Kidney J. Am. Soc. Nephrol., October 1, 2006; 17(10): 2670 - 2679. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vallet, N. Picard, D. Loffing-Cueni, M. Fysekidis, M. Bloch-Faure, G. Deschenes, S. Breton, P. Meneton, J. Loffing, P. S. Aronson, et al. Pendrin Regulation in Mouse Kidney Primarily Is Chloride-Dependent J. Am. Soc. Nephrol., August 1, 2006; 17(8): 2153 - 2163. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nissant, M. Paulais, S. Lachheb, S. Lourdel, and J. Teulon Similar chloride channels in the connecting tubule and cortical collecting duct of the mouse kidney Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1421 - F1429. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Petrovic, H. Amlal, X. Sun, F. Karet, S. Barone, and M. Soleimani Vasopressin induces expression of the Cl-/HCO3- exchanger SLC26A7 in kidney medullary collecting ducts of Brattleboro rats Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1194 - F1201. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, R. T. Worrell, H. C. Li, S. L. Barone, S. Petrovic, H. Amlal, and M. Soleimani Chloride/Bicarbonate Exchanger SLC26A7 Is Localized in Endosomes in Medullary Collecting Duct Cells and Is Targeted to the Basolateral Membrane in Hypertonicity and Potassium Depletion J. Am. Soc. Nephrol., April 1, 2006; 17(4): 956 - 967. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Wall, M. A. Knepper, K. A. Hassell, M. P. Fischer, A. Shodeinde, W. Shin, T. D. Pham, J. W. Meyer, J. N. Lorenz, W. H. Beierwaltes, et al. Hypotension in NKCC1 null mice: role of the kidneys Am J Physiol Renal Physiol, February 1, 2006; 290(2): F409 - F416. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Kim, J. W. Verlander, S. W. Matthews, I. Kurtz, W. Shin, I. D. Weiner, L. A. Everett, E. D. Green, S. Nielsen, and S. M. Wall Intercalated cell H+/OH- transporter expression is reduced in Slc26a4 null mice Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1262 - F1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Quentin, R. Chambrey, M. M. Trinh-Trang-Tan, M. Fysekidis, M. Cambillau, M. Paillard, P. S. Aronson, and D. Eladari The Cl-/HCO3- exchanger pendrin in the rat kidney is regulated in response to chronic alterations in chloride balance Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1179 - F1188. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Petrovic, S. Barone, J. Xu, L. Conforti, L. Ma, M. Kujala, J. Kere, and M. Soleimani SLC26A7: a basolateral Cl-/HCO3- exchanger specific to intercalated cells of the outer medullary collecting duct Am J Physiol Renal Physiol, January 1, 2004; 286(1): F161 - F169. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Kim, T.-H. Kwon, B. M. Christensen, J. Nielsen, S. M. Wall, K. M. Madsen, J. Frokiaer, and S. Nielsen Altered expression of renal acid-base transporters in rats with lithium-induced NDI Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1244 - F1257. [Abstract] [Full Text] |
||||
![]() |
S. Petrovic, L. Ma, Z. Wang, and M. Soleimani Identification of an apical Cl-/HCO-3 exchanger in rat kidney proximal tubule Am J Physiol Cell Physiol, September 1, 2003; 285(3): C608 - C617. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Verlander, R. T. Miller, A. E. Frank, I. E. Royaux, Y.-H. Kim, and I. D. Weiner Localization of the ammonium transporter proteins RhBG and RhCG in mouse kidney Am J Physiol Renal Physiol, February 1, 2003; 284(2): F323 - F337. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |