AJP - Renal Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 284: F229-F241, 2003. First published August 27, 2002; doi:10.1152/ajprenal.00147.2002
0363-6127/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/1/F229    most recent
00147.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (48)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wall, S. M.
Right arrow Articles by Verlander, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wall, S. M.
Right arrow Articles by Verlander, J. W.
Vol. 284, Issue 1, F229-F241, January 2003

Localization of pendrin in mouse kidney

Susan M. Wall1,2, Kathryn A. Hassell1, Ines E. Royaux3, Eric D. Green3, Judy Y. Chang1, Gregory L. Shipley2, and Jill W. Verlander4

1 Departments of Medicine and 2 Integrative Biology and Pharmacology, University of Texas Medical School at Houston, Houston, Texas 77030; 3 Genome Technology Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892; and 4 Department of Medicine, University of Florida College of Medicine, Gainesville, Florida 32610


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Pendrin is an anion exchanger expressed in type B intercalated cells of the cortical collecting duct (CCD). Whether pendrin localizes to other nephron segments with intercalated cells is unknown. Moreover, whether pendrin is expressed in proximal tubule is debated. Thus the distribution of pendrin mRNA and protein expression in mouse kidney was investigated by using light and electron microscopic immunohistochemistry and quantitative real-time PCR. We observed that pendrin mRNA is expressed mainly in cortex. Within cortex, pendrin mRNA is at least fivefold higher in CCD and the connecting tubule (CNT) than in the other segments. Pendrin protein was observed in a subset of cells within the distal convoluted tubule as well as in type B and in non-A-non-B intercalated cells of the CNT and CCD. In type B intercalated cells, pendrin immunoreactivity was highest in apical cytoplasmic vesicles with little immunolabel along the apical plasma membrane. In non-A-non-B intercalated cells, intense pendrin immunoreactivity was detected along the apical plasma membrane. These differences in the subcellular distribution of pendrin immunolabel were confirmed by morphometric analysis. In conclusion, pendrin is expressed in the mouse distal convoluted tubule, CCD, and CNT along the apical plasma membrane of non-A-non-B intercalated cells and in subapical cytoplasmic vesicles of type B intercalated cells.

intercalated cell; distal convoluted tubule; cortical collecting duct; connecting tubule; anion exchange


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

INTERCALATED CELLS MEDIATE transepithelial transport of net H+ equivalents along the collecting duct (24), a process mediated largely through vacuolar H+- ATPase. However, Brown et al. (3) observed that H+-ATPase has opposite polarity within subpopulations of intercalated cells. Thus these cells are thought to either secrete or absorb net H+ equivalents depending on whether H+-ATPase localizes to the apical or the basolateral plasma membrane. Intercalated cells are classified as type A, B, or non-A-non-B from immunological and ultrastructural characteristics (30). The immunohistochemical classification of these cells is based on the presence or absence of AE1 immunoreactivity and the distribution of H+-ATPase within the cell (16, 24, 30). The distribution and expression of each of these transporters in each intercalated cell subtype is displayed in Fig. 1. The ultrastructure of each cell type (A, B, and non-A-non-B) has been characterized (30). Type A intercalated cells have a centralized nucleus, prominent apical plasma membrane microprojections, and prominent apical cytoplasmic membrane tubulovesicles. In the type A intercalated cell, H+-ATPase is expressed on the apical cytoplasmic vesicles and the apical plasma membrane, where it functions in series with the Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchanger AE1 on the basolateral plasma membrane to mediate secretion of net H+ equivalents into the luminal fluid (1, 6, 23) in both the medullary and the cortical collecting duct (24). In the kidney, a truncated splice variant of erythrocyte AE1 or band 3 (17) is observed (kAE1). Both H+-ATPase and kAE1 are highly regulated by changes in acid-base status (21). For example, kAE1 and H+-ATPase are upregulated during metabolic acidosis (2, 21, 33), which increases secretion of H+ equivalents into the luminal fluid.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Immunohistochemical classification of intercalated cells of the cortical collecting duct (CCD). AE1, anion exchanger type 1.

The non-A-non-B intercalated cell has been described in mice and rats (1, 16, 30). Non-A-non-B cells have a very high mitochondrial density, prominent apical plasma membrane microprojections, and sparse apical cytoplasmic vesicles (30). Similar to type A intercalated cells, this cell type has H+-ATPase in both the apical plasma membrane and in apical cytoplasmic vesicles; however, it does not express kAE1 (1, 16, 30). The physiological role of non-A-non-B intercalated cells in the regulation of acid-base homeostasis is, however, unknown (30).

Type B intercalated cells are distinguished from other intercalated cell subtypes ultrastructurally by the presence of a relatively smooth apical plasma membrane, an eccentric nucleus, clustered mitochondria, and cytoplasmic vesicles distributed throughout the cell. In the type B intercalated cell, H+-ATPase is expressed on the basolateral plasma membrane and in cytoplasmic vesicles throughout the cell (1, 16, 30). Type B intercalated cells are thought to mediate HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> secretion into the luminal fluid (24). In rabbits and mice, the majority of non-A intercalated cells of the cortical collecting duct (CCD) display electroneutral Na+-independent Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchange across the apical membrane (8, 10, 35). The gene product(s) responsible for apical anion exchange-mediated HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> secretion, thought to occur across type B intercalated cells, has been a matter of controversy. It has been proposed that kAE1 represents the putative apical anion exchanger of the type B intercalated cell (32). However, there is now abundant evidence that kAE1 does not represent the gene product of the apical anion exchanger of the type B intercalated cell (1, 9, 12, 16, 25, 30). More recent studies have shown that pendrin and AE4 represent other candidate genes for the putative apical anion exchanger.

AE4 is an Na+-independent Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchanger first cloned in rabbit kidney by Tsuganezawa et al. (31). In rabbit CCD, AE4 localizes to the apical membrane of some type B intercalated cells (31). However, preliminary reports indicate that in rat CCD, AE4 resides along the basolateral membrane of both type A and type B cells (7). Like apical anion exchange in the type B intercalated cell, AE4 is insensitive to stilbene inhibitors when expressed in Xenopus laevis oocytes (31). However, because its distribution in intercalated cell subtypes is debated and because no AE4 mouse knockout model exists, the physiological significance of AE4 in kidney is unknown.

Pendrin represents another Na+-independent Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchanger (27, 28). The molecular structure of the pendrin gene was deduced by Everett et al. (11). RNA in situ hybridization, Northern blot analysis, and immunocytochemistry data have shown that pendrin mRNA and protein are highly expressed in the inner ear, thyroid, and kidney (11, 19, 20).

The distribution of pendrin in the mammalian kidney has been debated. Light and fluorescent microscopic immunolocalization studies of Royaux et al. (20) reported that pendrin protein is highly expressed in the apical region of a subpopulation of cells within the CCD of mice, rats, and humans in which H+-ATPase is either basolateral or apical (Fig. 1) but not in cells that express kAE1. Thus pendrin protein is expressed in the apical region of non-A intercalated cells. Localization of pendrin to the apical region of the type B intercalated cell raises the possibility that this transporter represents the putative apical anion exchanger of this cell type. However, other laboratories have reported a different distribution of pendrin expression within the cortex. Soleimani et al. (28) have investigated the distribution of pendrin mRNA and protein expression in rat kidney by using RT-PCR of individual nephron segments and immunoblots of brush-border membrane vesicles. They observed that pendrin message and protein are highly expressed not only in the CCD but also along the brush border of the proximal tubule. Pendrin mRNA expression was not measured in the other segments of the cortex. Localization of pendrin to the brush border suggests a different functional role for the transporter than is suggested with localization of the transporter to the apical membrane of the type B intercalated cell. The purpose of the present study was therefore to explore the cellular and subcellular distribution of pendrin message and protein in mouse kidney in greater detail.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals. Nonalbino Swiss mice weighing 20-30 g were studied (Harlan, Ardmore, TX). Mice consumed a balanced rodent diet (Zeigler Brothers, Gardners, PA) and tap water. Mice were anesthetized with 100% O2 at 1 l/min with 4% isofluorane before death.

Dissection of tubules. Mice were injected with 1.5 mg furosemide ip 30 min before death. The kidney was perfused initially with 10 ml of ice-cold dissection solution and then with 20 ml of the same solution containing 1 mg/ml collagenase B (0.2 U/mg; Roche, Indianapolis, IN) and 1 mg/ml BSA (Sigma). The dissection solution contained (in mM) 144 NaCl, 5 KCl, 1 Na2HPO4, 1.2 MgSO4, 2 CaCl2, 5.5 glucose, and 10 HEPES, pH 7.4. The kidneys were removed, and a coronal section was made that contained the entire corticopapillary axis. The cortex was separated from the rest of the section and incubated in collagenase solution for 5 min at 37°C. The tissue was transferred to the dissection solution with 1 mg/ml albumin but without collagenase. Tissue was dissected at 4°C for not more than 30 min. Nephron segments from the cortex were dissected as described previously (22). Cortical thick ascending limbs (cTALs), proximal straight tubules, and CCDs were dissected from the medullary rays. CCD segments were at least 0.5 mm in length, had no branched points, and displayed the typical "cobblestone" appearance. Proximal convoluted tubules, glomeruli, and connecting tubules (CNTs) were dissected from the cortical labyrinth. CNTs also displayed the typical cobblestone appearance and were cut to span two branched points. The distal convoluted tubule (DCT) was dissected between its juncture with the macula densa and the beginning of the CNT. Tubule length was measured with a calibrated optical micrometer. The tubules were then transferred to an Eppendorf tube containing 0.5 ml dissection solution plus 10 µl RNAlater (Qiagen, Valencia, CA) but without collagenase or albumin. Transfer of tubules was accomplished by using glass tubing coated with dissection solution containing 1% albumin and connected to a Hamilton syringe with Silastic tubing. Samples were centrifuged at 11,750 g for 1 min at 4°C. The supernatant was removed. The tissue was then snap frozen in liquid nitrogen and stored at -80°C.

Preparation of total RNA from kidney slices. After death, the left kidneys were excised from the mice and coronal slices were made. Each slice was cut into three regions: cortex, outer medulla, and inner medulla. Each piece was snap frozen in liquid nitrogen and then weighed. Isolation of total RNA was performed by using an RNeasy minikit (Qiagen). The kidney tissue was placed in RLT buffer (20 ml buffer/g kidney tissue) with 10 µl/ml beta -mercaptoethanol, homogenized (Omni tissue homogenizer, Omni/Tech Quest, Warrenton, VA) at 15,000 rpm for 40 s, and placed on ice. A 600-µl aliquot of the lysate was centrifuged at 16,000 g for 3 min. Six hundred microliters of 70% ethanol were added to the supernatant and mixed. The resulting solution was then added directly to an RNeasy spin column, and total RNA was isolated with a kit, following the manufacturer's instructions (Qiagen). Total RNA (3.125 µg) was added to 125 µl diethyl pyrocarbonate-treated water containing 0.016 U/µl RNAse-free DNase I, 4.2 mM MgCl2, 1 mM KCl, and 0.3 mM Tris, pH 8.4. The mixture was incubated at 37°C for 30 min and then at 75°C for 10 min and then placed on ice and stored at -80°C.

Preparation of total RNA from individual tubules. Total RNA was prepared from individual nephron segments by using the Epicentre Kit (Epicentre Technologies, Madison, WI) following the instructions of the manufacturer with minor modifications. Cell lysis solution (150 µl) with 25 µg proteinase K was added to each sample. Samples were incubated at 65°C for 30 min while being vortexed for 5 s every 10 min and then placed on ice for 3-5 min. MasterPure complete protein precipitation reagent (75 µl) was added to each lysed sample, vortexed for 10 s, and then centrifuged at 10,000 g for 10 min. Ice-cold isopropanol (250 µl) was added to the supernatant of each sample. Samples were then inverted 30-40 times and centrifuged at 10,000 g for 10 min at 4°C. The isopropanol was decanted, and the pellet was rinsed twice with ice-cold 75% ethanol and then resuspended in 65 µl diethyl pyrocarbonate-treated water with 4 mM MgCl2, 1 mM KCl, 0.3 mM Tris, pH 8.4, and 0.016 U/µl DNAse I. The samples were vortexed and incubated at 37°C for 30 min. The DNase I reaction was stopped by transferring the samples to 75°C for 10 min. Samples were then stored at -80°C.

Quantitative real-time RT-PCR. Quantitative real-time PCR was performed in the Quantitative Genomics Core Laboratory in the Department of Integrative Biology and Pharmacology utilizing a 7700 Sequence Detector (Applied Biosystems, Foster City, CA) (4, 15). Specific quantitative assays for mouse pendrin and beta -actin were developed by using Primer Express software (Applied Biosystems) following the recommended guidelines on the basis of sequences from GenBank: 1) mouse pendrin qRT-PCR assay (accession no. AF-1674110), 1483(+): GCTGGCCTCATCTCAGCTG, 1552(-): GCAAGGGTTCCAGAAGCCT, 1504(+): 6-carboxyfluorescein (FAM)/ 6-carboxy-tetramethylrhodamine (TAMRA): ATTGTGATGGTTGCCATCGTTGCC; and 2) mouse beta -actin qRT-PCR assay (accession no. X03672), 1035(+): GCTCTGGCTCCTAGCACCAT, 1108(-): CCACCGATCCACACAGAGTAC, 1059(+): FAM/TAMRA: ATCAAGATCATTGCTCCTCCTGAGCGC.

cDNA was synthesized in 10-µl total volume by the addition of 6 µl/well RT master mix consisting of 400 nM assay-specific reverse primer, 500 µM deoxynucleotides, Superscript II buffer, DTT, and 10 U Superscript II RT (Invitrogen, Carlsbad, CA), added to an ABI 7700 96-well plate followed by the unknown RNA solution (4 µl). Each sample was measured in triplicate plus a control without RT. Each plate also contained serial dilutions of an assay-specific sDNA (synthetic amplicon oligonucleotides) standard spanning a 5-log range and a no-template control. Each plate was covered with Biofilm A (MJR, Waltham, MA) and incubated in a thermocycler (MJR) for 30 min at 50°C followed by 72°C for 10 min. Subsequently, 40 µl of a PCR master mix [400 nM forward and reverse primers, 100 nM fluorogenic probe, 3 mM MgCl2, and 200 µM deoxynucleotides, PCR buffer, and 1.25 U Taq polymerase (Invitrogen)] were added directly to each well of the cDNA plate. RT master mixes and all RNA samples were pipetted by a Tecan Genesis RSP 100 robotic workstation (Tecan US, Research Triangle Park, NC). PCR master mixes were pipetted utilizing a Biomek 2000 robotic workstation (Beckman, Fullerton, CA). Each assembled plate was then capped and run in the ABI 7700 with the following cycling conditions: 95°C for 1 min and 40 cycles of 95°C for 12 s and 60°C for 1 min. The resulting data were analyzed by using SDS software (Applied Biosystems, Foster City, CA) with TAMRA as the reference dye.

Synthetic DNA oligonucleotides used as standards (sDNA) encompassed the entire amplicon for the assay (Biosource International, Camarillo, CA). We have shown in several assays that in vitro transcribed RNA amplicon standards (sRNA) and sDNA standards have the same PCR efficiency when performed as described above (data not shown).

As a negative control, beta -actin transcript levels were measured in each sample assayed for pendrin mRNA. beta -Actin and pendrin mRNA are expressed as pendrin transcript per millimeter tubule (or per 10 glomeruli).

Antibody. The primary anti-pendrin antibody was a polyclonal antibody raised in rabbit that recognizes amino acids 766-780 of the human pendrin protein sequence. This antibody has been characterized previously and used for immunolocalization of pendrin in normal mouse kidney (20). For immunohistochemical localization of the thiazide-sensitive Na-Cl cotransporter (TSC), we used a polyclonal antibody raised in rabbit against a 110-amino acid segment of the NH2 terminus of rTSC1, which corresponds to amino acids 2-112 of the rat rTSC1. This antibody has been characterized previously (18) and was a gift from Dr. Steven C. Hebert (Yale University School of Medicine, New Haven, CT).

Tissue preparation for light microscopy. For light microscopic studies, ~2-mm-thick transverse sections of kidney from each animal were embedded in polyester wax (polyethylene glycol 400 distearate, Polysciences, Warrington, PA), and 5-µm-thick sections were cut and mounted on gelatin-coated glass slides.

Colocalization of pendrin and TSC immunoreactivity. Colocalization of pendrin and thiazide-sensitive cotransporter immunoreactivity was accomplished by using sequential immunoperoxidase procedures. Five-micrometer sections were dewaxed in ethanol, rehydrated, and then rinsed in PBS. Endogenous peroxidase activity was blocked by incubation of the sections in 0.3% H2O2 for 30 min. The sections were rinsed in PBS, treated for 20 min with 5% goat serum in PBS, and then incubated at 4°C overnight with the anti-pendrin antibody diluted 1:1,000 in PBS. The sections were washed twice in PBS for 5 min and then incubated for 30 min with peroxidase-conjugated goat anti-rabbit F(ab)2 secondary antibody (Jackson Immunoresearch, West Grove, PA) diluted 1:200 in PBS and then washed with PBS. The sections were then exposed to diaminobenzidine (peroxidase substrate kit, Vector Laboratories, Burlingame, CA). The sections were washed in glass-distilled water and then in PBS and incubated in 0.3% H2O2 for 30 min. The sections were again washed in PBS and incubated for 20 min with 5% normal goat serum in PBS. The sections were treated for 60 min with the anti-TSC antibody diluted 1:8,000 in PBS, washed in PBS, incubated for 30 min with the peroxidase-conjugated anti-rabbit secondary antibody, and then again washed with PBS. For detection of TSC immunoreactivity, Vector SG (Vector Laboratories) was used as the chromogen to produce a blue label. This label was easily distinguishable from the brown label produced by the diaminobenzidine used for detection of pendrin immunoreactivity. The sections were washed with glass-distilled water, dehydrated with xylene, mounted with Permount (Fisher Scientific, Fair Lawn, NJ), and observed by light microscopy. In each colocalization experiment, three control slides were included in which PBS only was substituted for the anti-pendrin primary antibody, the anti-TSC primary antibody, or both primary antibodies.

Tissue processing for immunoelectron microscopy. Mice were anesthetized and the kidneys were preserved by in vivo cardiac perfusion with 3% paraformaldehyde, 0.12% picric acid in PBS, pH 7.4, followed by overnight immersion at 4°C. The tissue was rinsed in PBS, and samples from the outer and inner cortex were immersed in 0.1 M NH4Cl for 1 h at 4°C. The tissue samples were then dehydrated in a graded series of alcohols and processed and embedded in Lowicryl K4M (Electron Microscopy Sciences, Ft. Washington, PA). Lowicryl polymerization was carried out under ultraviolet light for 24 h at 20°C and then for 48 h at room temperature. Samples containing well-preserved connecting segment and collecting duct were selected after light microscopic examination of 1-µm-thick sections stained with toluidine blue. Ultrathin sections of these were mounted on Formvar/carbon-coated nickel grids for immunogold cytochemistry.

Immunogold labeling. Briefly, the immunogold labeling procedure was performed by exposure of the ultrathin tissue sections to the primary antibody and then to a goat anti-rabbit IgG secondary antibody conjugated to 0.8-nm colloidal gold particles (Aurion UltraSmall gold conjugate, Electron Microscopy Sciences), followed by silver enhancement (Aurion R-Gent SE-EM, Electron Microscopy Sciences). Unless noted otherwise, all steps were done by floating the grids on droplets of solution at room temperature. The following solutions were used: incubation solution, 0.2% acetylated BSA (Aurion BSA-c, Electron Microscopy Sciences) and 10 mM NaN3, in PBS, pH 7.4; and blocking solution, 5% BSA, 0.1% cold-water fish-skin gelatin, and 5% normal goat serum, in PBS. The sections were exposed to 0.05 mM glycine in PBS for 15 min, incubated with the blocking solution for 30 min, washed with incubation solution, and then incubated in a humidified chamber overnight at 4°C with the primary antibody diluted 1:1,000 in incubation solution. The sections were then washed with incubation solution and incubated for 1.5 h with the secondary antibody diluted 1:100 in incubation solution. The sections were washed with incubation buffer, washed with PBS, postfixed with 1.25% glutaraldehyde in PBS, washed with PBS, and finally washed with glass-distilled water. The sections were then exposed to the silver- enhancement reagent for 40 min, washed with glass-distilled water, and counterstained with saturated uranyl acetate and lead citrate. Each group of sections subjected to the immunogold procedure included a control section that was exposed to incubation buffer in place of the primary antibody.

Electron microscopy. Ultrathin sections were examined with a Zeiss-EM10 transmission electron microscope. The CCD was identified by its characteristic heterogeneous epithelial cell population, which included principal cells and intercalated cells, and its location parallel to a cTAL of Henle's loop in the medullary ray. Connecting segments and initial collecting tubules (ICTs) were located in the cortical labyrinth between medullary rays. ICTs were identified by their epithelial cell morphology, which is similar to that described for the CCD. Connecting segments were distinguished from ICTs by the increased height of the epithelial cells and presence of tall vertical mitochondria in the connecting segment cells.

The mouse CCD and CNT contain at least three morphologically distinct intercalated cell subtypes: type A, type B, and a third cell type that has been identified in both rat and mouse kidney and referred to as non-A-non-B (30). The morphological characteristics used to identify these intercalated cell subtypes were established in morphological and immunocytochemical studies of both rat and mouse collecting duct (16, 30). Type A intercalated cells typically contain a centralized nucleus, mitochondria that are distributed throughout the cell, moderate apical plasma membrane microprojections, and prominent apical cytoplasmic membrane tubulovesicles that have relatively electron-dense limiting membranes. Type B intercalated cells typically exhibit a rounded cell outline, eccentric nucleus, clustered mitochondria, relatively smooth apical plasma membrane, and cytoplasmic vesicles throughout the cell. The cytoplasmic vesicles of type B intercalated cells are typically smaller in profile, and the limiting membranes are less electron dense than those in type A intercalated cells. Type B interalated cells frequently exhibit a vesicle-free band of cytoplasm along the apical plasma membrane. The third intercalated cell subtype, non-A-non-B, has distinctive morphological features, including a very high mitochondrial density, prominent apical plasma membrane microprojections, and relatively few cytoplasmic vesicles, which are apical.

Morphometric analysis. The boundary length of the apical plasma membrane, cytoplasm area, number of gold particles along the apical plasma membrane, and number of gold particles over the cytoplasm, including cytoplasmic vesicles, were quantified in type B and non-A-non-B intercalated cells (34) in three individual mice. A minimum of five of each intercalated cell type in each animal were selected randomly and photographed at a primary magnification of ×6,200. Individual photomicrographs were examined at a final magnification of approximately ×23,400. The exact magnification was calculated by using a calibration grid with 1,134 lines/mm.

The boundary length of the apical plasma membrane was determined by intersection counting using the Merz curvilinear test grid with a distance of 20 mm between the points corresponding to 0.856 µm (D) (34).

The boundary length (B) was calculated from the equation
B=I×D
in which I represents the number of intersections between the test line and the plasma membrane, and B was expressed in millimeters.

The area of cytoplasm in the intercalated cell profiles was determined by counting points over the cytoplasm by using the Merz curvilinear test grid and the formula for area (A)
A=P×D<SUP>2</SUP>
in which P is the number of points over the cytoplasm, and A was expressed in square millimeters.

Gold particles that were touching the apical plasma membrane and those over the cytoplasm, including cytoplasmic vesicle membranes, were counted and were related to either the apical plasma membrane boundary length (gold particles/mm of apical plasma membrane boundary length) or the cytoplasm area (gold particles/mm2 cytoplasm), respectively. In addition, the ratio of gold particles associated with the apical plasma membrane to gold particles over the cytoplasm was determined for each cell type.

Statistical analysis. For the RT-PCR, data comparisons among three or more groups were made by using ANOVA with Tukey's posttest. For comparisons of gold label density, repeated-measures ANOVA with Tukey's posttest was used. Statistical significance was achieved with a P < 0.05. Data are displayed as means ± SE.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Distribution of pendrin message in mouse kidney. Pendrin message abundance was examined in the cortex, outer medulla, and inner medulla of mouse kidney. As shown in Fig. 2, expression of pendrin relative to beta -actin mRNA was low in both the outer and the inner medulla. However, pendrin transcript expression was 6- to 10-fold higher in the cortex than in the medulla, similar to previously published results in rats (28). However, beta -actin mRNA/100 ng total RNA was the same in all three regions of the kidney (Fig. 2). Because pendrin mRNA is highly expressed in mouse cortex, the distribution of pendrin message within this region of the kidney was studied in greater detail.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2.   Pendrin transcript in mouse kidney. Pendrin mRNA was measured in cortex (COR), outer medulla (OM), and inner medulla (IM) of mouse kidney. Pendrin mRNA was expressed as the percentage of beta -actin transcript measured in the same sample. The pendrin/beta -actin transcript ratio was greater in cortex than in either inner or outer medulla, P < 0.05. beta -actin mRNA/100 ng total RNA was (×106), inner medulla, 2.0 ± 0.4; outer medulla, 2.7 ± 0.2; and cortex, 2.5 ± 0.09 (n = 6, P = not significant).

Figure 3 shows pendrin mRNA expression in individual nephron segments of mouse cortex. As shown, pendrin message expression was detected in glomeruli, proximal convoluted tubule, proximal straight tubule, and cTAL. However, pendrin mRNA expression was at least fivefold higher in CNT and CCD (P < 0.05).1 To determine whether this distribution resulted from variation in RNA integrity in these segments, beta -actin mRNA abundance was measured in each sample studied. In contrast to the distribution of pendrin expression, beta -actin message was not lower in glomeruli, cTAL, and proximal tubule than in CCD and CNT (Fig. 3). Therefore the relatively low levels of pendrin mRNA detected in glomeruli and proximal tubule were not the result of RNA degradation. We conclude that nephron segments containing type B intercalated cells, such as CNT and CCD, express high levels of pendrin mRNA.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Pendrin transcript abundance in nephron segments of the mouse cortex. A: pendrin mRNA/mm tubule length was measured in individual nephron segments of mouse cortex. B: in each of these nephron segments, beta -actin mRNA was also measured. Pendrin transcript was higher in CCD and connecting tubule (CNT) than in cortical thick ascending limb (cTAL), proximal straight tubule (PST), or proximal convoluted tubule (PCT) (P < 0.05). GLM, glomeruli.

Light and electron microscopic immunolocalization of pendrin protein in mouse kidney cortex. Because pendrin protein and mRNA (20, 28) are most highly expressed in cortex, the distribution of pendrin immunoreactivity in mouse cortex was studied in greater detail by using light microscopic immunohistochemistry of mouse kidney cortex labeled for pendrin. We observed that within the mouse kidney, the distribution of pendrin protein was similar to the distribution of pendrin mRNA described above. As reported previously (20), pendrin immunoreactivity was not observed in the glomerulus, proximal tubule, or thick ascending limb of Henle's loop (Fig. 4). Figure 4 shows labeling of a subset of cells within the collecting duct, as described previously (20). Because the DCT contains intercalated cells (16), pendrin expression in this segment was explored. To determine whether pendrin is expressed in the DCT, sections were labeled with antibodies specific for pendrin and for the TSC, a marker of DCT. Although the majority of DCT profiles did not exhibit pendrin-positive cells, a minority of cells with pendrin immunoreactivity were present in occasional tubules that expressed TSC (Fig. 4). In rare profiles, continuous apical TSC immunoreactivity was interrupted by a few pendrin-positive cells (Fig. 4d). Thus pendrin is expressed in a subset of cells within the DCT. Furthermore, some tubule profiles were observed that contained the transition from the DCT to the CNT (Fig. 4b). In these tubules, the DCT portion contained nearly continuous apical TSC immunoreactivity with rare pendrin-positive cells, whereas the CNT portion contained primarily cells that were negative for TSC immunoreactivity and a minority of cells with apical pendrin immunoreactivity (Fig. 4b). In addition, occasional CNT profiles were observed that had negative cells, pendrin-positive cells, and TSC-positive cells interspersed (Fig. 4c).


View larger version (124K):
[in this window]
[in a new window]
 
Fig. 4.   Light micrographs illustrating immunohistochemical colocalization of pendrin and thiazide-sensitive Na-Cl cotransporter (TSC) protein in mouse cortex. Brown represents pendrin immunoreactivity, whereas blue represents TSC immunoreactivity. a: Low-power view of mouse cortex. Pendrin is expressed in a subset of cells within the collecting ducts (CD). Distal convoluted tubule (D) profiles typically exhibit only apical TSC immunoreactivity. A single CNT with interspersed cell types is also visible. This profile is enlarged in c and contains negative cells, pendrin-positive cells (arrows), and TSC-positive cells (arrowheads). b: Transition from the late distal convoluted tubule (D) to the CNT. The late distal convoluted tubule illustrated here exhibits continuous apical TSC immunoreactivity with the exception of a single pendrin-positive cell (arrowhead) before the transition to the CNT, which contains TSC-negative cells and pendrin-positive cells (arrows). d: Several distal convoluted tubule profiles are illustrated; some contain pendrin-positive cells (arrows) among the TSC-positive cells.

To further characterize the distribution of pendrin, immunoelectron microscopy was performed. Again, no labeling was observed in the glomerulus, proximal tubule, or thick ascending limb (Fig. 5). However, in all sections observed, significant immunogold label was present in a subset of cells within the CCD, ICT, and CNT identified morphologically as intercalated cells (see below). As reported previously with light microscopic techniques (20), principal cells and CNT cells were consistently negative (not shown), exhibiting no more than background levels, which was the level of gold particles also observed over tubule lumens or intercellular spaces.


View larger version (142K):
[in this window]
[in a new window]
 
Fig. 5.   Transmission electron micrograph of a mouse proximal tubule cell subjected to immunogold labeling for pendrin. Only rare gold particles are present. No significant label was observed in any proximal tubule segment. Magnification, ×8,600.

Three distinct types of intercalated cells, type A, type B, and non-A-non-B, were observed in mouse CCD, ICT, and CNT (30). Type A intercalated cells were observed frequently in the CCD and ICT and were consistently negative for pendrin immunoreactivity (Fig. 6). However, all other intercalated cells throughout the CCD, ICT, and CNT were positive for pendrin. Although both type B and non-A-non-B intercalated cells exhibited pendrin immunoreactivity (see below), the subcellular distribution of the immunolabel differed qualitatively between these cell types.


View larger version (139K):
[in this window]
[in a new window]
 
Fig. 6.   Transmission electron micrographs of type A intercalated cells from the mouse CCD subjected to immunogold labeling for pendrin. a: Lower magnification electron micrograph illustrating the typical morphological features of the type A intercalated cell. Gold particles are rare and are randomly distributed over the cell. Magnification, ×8,900. Higher magnification transmission electron micrographs of the apical (b) and basal (c) regions of a type A intercalated cell from mouse CCD subjected to immunolabeling for pendrin. Virtually no gold particles are present. Magnification, ×19,200 (b) and ×19,000 (c).

In type B intercalated cells, pendrin immunolabel was predominantly associated with apical cytoplasmic vesicles (Fig. 7). Although type B cells have cytoplasmic vesicles distributed throughout the cell, only vesicles in the apical region were labeled (Fig. 7, a and b); vesicles in the basal region were negative (Fig. 7c). The apical plasma membrane of type B intercalated cells was also labeled. However, in most type B cells, the amount of label on the apical plasma membrane was low. In these cells, the apical plasma membrane surface was small and smooth, with few apical microprojections. However, occasional type B intercalated cells displayed prominent apical plasma membrane microprojections, and these cells also exhibited increased pendrin immunolabel on the apical plasma membrane (Fig. 7d). Sections that were exposed to incubation buffer in place of the primary antibody exhibited only rare gold particles in any location (Fig. 8). Type B intercalated cells were frequently identified in the CCD and the ICT and were rarely found in the CNT, as reported previously (1, 30).



View larger version (203K):
[in this window]
[in a new window]
 
Fig. 7.   Transmission electron micrograph of a type B intercalated cell from the mouse CCD subjected to immunogold labeling for pendrin. a: Typical morphological features of the type B intercalated cell, including a relatively small and smooth apical surface, cytoplasmic vesicles throughout the cell, an eccentric cell nucleus, and prominent basolateral plasma membrane infoldings. Pendrin immunolabeling is primarily associated with apical cytoplasmic vesicles. Magnification, ×11,800. Higher magnification transmission electron micrographs of the apical (b and d) and basal (c) regions of a type B intercalated cell from mouse CCD subjected to immunogold labeling for pendrin are shown. b: In the majority of type B intercalated cells, numerous gold particles were associated with cytoplasmic vesicles in the apical region (arrowheads), whereas only occasional particles are present along the apical plasma membrane (arrows). c: No significant labeling was present in the basolateral region of type B intercalated cells, over either the basolateral plasma membrane (arrows) or the cytoplasmic vesicles (arrowheads). Magnification, b and c, ×21,000. d: Occasional type B intercalated cells contained more prominent apical plasma membrane microprojections and more pendrin immunolabeling along the apical plasma membrane (arrows) compared with the typical type B intercalated cell illustrated in a and b. Prominent labeling of apical cytoplasmic vesicles was also present (arrowheads). Magnification, ×26,400.



View larger version (98K):
[in this window]
[in a new window]
 
Fig. 8.   Transmission electron micrograph of the apical region of a type B intercalated cell from the mouse CCD subjected to the immunogold labeling procedure with buffer substituted for the anti-pendrin primary antibody. Virtually no gold particles are present. Magnification, ×15,500.

In non-A-non-B intercalated cells, which typically exhibited extensive apical plasma membrane microprojections, pendrin immunolabel was predominantly located on the apical plasma membrane (Fig. 9). Fewer gold particles were associated with apical cytoplasmic vesicles (Fig. 9). As we reported previously (30), non-A-non-B intercalated cells were prevalent in the CNT. They were detected less often in the ICT and were not found in the CCD.


View larger version (95K):
[in this window]
[in a new window]
 
Fig. 9.   Transmission electron micrographs of non-A-non-B intercalated cells in the mouse CNT subjected to immunogold labeling for pendrin. a: Typical morphological features of the non-A-non-B intercalated cell, including long and numerous apical plasma membrane microprojections, numerous mitochondria throughout the cell, apical cytoplasmic vesicles, and a surface that bulges into the tubule lumen. Immunolabeling for pendrin was restricted to the apical region of the cell and was predominantly located along the apical plasma membrane. Magnification, ×12,900. b: At higher magnification, prominent immunogold labeling for pendrin is visible along the apical plasma membrane (arrows). Although numerous apical cytoplasmic vesicles are present, very few of these are labeled with gold particles (arrowheads) and the majority of these are negative for pendrin. Magnification, ×26,100.

The distribution of gold label in type B and non-A-non-B intercalated cells was quantified. In these two cell types, we compared the total amount of gold label and the density of label in the apical membrane and in the cytoplasm and cytoplasmic vesicles (Table 1). Both the density of gold label and the total gold label in the apical plasma membrane were markedly greater in non-A-non-B cells compared with type B intercalated cells. In contrast, the density of gold label in the cytoplasm was greater in type B cells than in non-A-non-B cells; however, there was no difference in the total cytoplasmic label in the two cell types. Furthermore, the ratio of label in the apical plasma membrane to label in the cytoplasm was markedly greater in non-A-non-B cells than in type B cells.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Distribution of gold label in type B and non-A-non-B intercalated cells

We also observed profiles of intercalated cells that were positive for pendrin immunoreactivity that did not exhibit the full complement of morphological features that are characteristic for either type B or non-A-non-B intercalated cells and thus could not be definitively identified. However, the pattern of pendrin immunolabel was similar to that observed in cells identified as type B and non-A-non-B in that they exhibited variable degrees of pendrin immunolabel in the apical cytoplasmic vesicles and apical plasma membrane.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The kidney has a tremendous capacity to excrete alkaline loads. For example, after drinking hypertonic NaHCO3 for 5-8 days, rats develop only a mild metabolic alkalosis (14). During metabolic alkalosis apical Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchange is upregulated, which augments secretion of OH- equivalents along the CCD (29). Thus determination of the gene product responsible for apical anion exchange represents an important issue in renal physiology.

Apical anion exchange in the CCD has been well studied by using isolated CCD tubules perfused in vitro. During metabolic alkalosis, the CCD secretes HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> through an active process (29), which is dependent on Cl- present in the luminal fluid but is Na+ independent and electroneutral, consistent with Na+-independent Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchange (29). In rabbit and mouse CCD, more than one-half of intercalated cells in the CCD display apical, stilbene-insensitive, Na+-independent Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchange (8, 10, 35). Because the gene product mediating apical anion exchange has not been established, the immunohistochemical classification of non-A intercalated cells (Fig. 1) is incomplete. Identification of the gene product responsible for the apical anion exchanger would generate an immunohistochemical classification system of intercalated cell subtypes that better reflects H+/OH- transport function for each intercalated cell subtype.

Because pendrin mediates Cl-/OH-, Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>, and Cl-/formate- exchange in heterologous expression systems (26, 28) and because it localizes to the apical membrane of type B intercalated cells, pendrin represents a candidate gene for the putative apical anion exchanger of the type B intercalated cell (20). Pendrin could mediate HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> secretion in native mouse CCD, either through direct transport of HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> by pendrin or through pendrin-mediated transport of another base such as OH- or formate-. However, the physiological role of pendrin may be more for regulation of halide balance, such as Cl- or I-, rather than for regulation of acid-base balance.

Pendrin is expressed in type B cells, the predominant non-A intercalated cell of the mouse CCD (30). Thus both pendrin and apical Na+-independent Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchange are found in a large percentage of intercalated cells of the mouse CCD. However, virtually all of the pendrin immunolabel was restricted to apical cytoplasmic vesicles, even though type B cells have cytoplasmic vesicles distributed throughout the cell. Very little immunolabel was detected on the apical plasma membrane of the type B intercalated cell. However, under the conditions of previous studies, pendrin is sufficiently expressed along the apical plasma membrane of type B cells to modulate transepithelial transport of HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> in the mouse CCD (20). During metabolic alkalosis, CCD from wild-type, Pds (+/+), mice secrete HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> (20). However, CCDs from mice with a genetic disruption of the pendrin gene, Pds (-/-), absorbed HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> when studied under the same treatment conditions (20). Thus it is likely that pendrin represents a gene product that contributes to the apical anion exchange process of the type B intercalated cell. However, low levels of HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> secretion reported in wild-type mice (20) might reflect low levels of pendrin protein expressed along the apical plasma membrane of the type B intercalated cell. It is also possible that under the conditions of the perfusion studies, pendrin is trafficked to the apical membrane of the type B cell.

In mice, cells with the morphological characteristics of intercalated cells of the B type express H+-ATPase along the basolateral plasma membrane and diffusely within cytoplasmic vesicles (30). The presence of pendrin in the subapical space of cells known to express H+-ATPase within the cytoplasm raises the question of whether these cells have the capacity to up- or downregulate transepithelial transport of net H+ or OH- equivalents or Cl- through trafficking of these transporters between the cytosol and the plasma membrane following changes in acid-base balance. These questions, however, will remain the subject of future studies.

As described previously in ultrastructural studies of the mouse (30), we observed that non-A-non-B cells are most prevalent in the CNT, less frequently observed in the ICT, and not detected in the CCD. The subcellular distribution of pendrin differs markedly in type B vs. non-A-non-B cells. In non-A-non-B cells, pendrin protein is highly expressed along the apical plasma membrane. These observations predict that in mice under basal conditions, apical anion exchange, due to pendrin, occurs to a greater extent in non-A-non-B cells than in type B cells. Thus in untreated mice, pendrin-mediated anion exchange is likely greater in the CNT than in the CCD. However, this hypothesis cannot be tested directly because the CNT is not easily perfused in vitro.

Occasional intercalated cells are found in the late DCT of mouse kidney (16). In the DCT, the vast majority of non-A intercalated cells in mouse DCT are non-A-non-B intercalated cells (16). Because pendrin labeling was observed by light microscopic immunohistochemistry in a subset of cells within occasional DCT profiles, it is likely that pendrin is expressed in non-A-non-B intercalated cells. However, this could not be confirmed by ultrastructural observation because DCT profiles containing intercalated cells were not observed by electron microscopy. The failure to observe by electron microscopy DCT profiles containing intercalated cells is not surprising, because the great majority of DCT profiles did not contain pendrin-positive cells.

In mice, intercalated cells that display the morphological characteristics of non-A-non-B intercalated cells express H+-ATPase in the apical plasma membrane and diffusely within cytoplasmic vesicles (30). Expression of both pendrin and H+-ATPase along the apical plasma membrane of non-A-non-B cells is surprising because pendrin is thought to mediate HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> secretion (20), whereas H+-ATPase mediates H+ secretion (13). It is possible that through upregulation of one transporter, in parallel with downregulation of the other, the cell can be converted from an H+- to an HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>- secreting cell and vice versa, depending on the acid-base derangement of the animal. Alternatively, H+-ATPase and pendrin may act in tandem to modulate transepithelial Cl- transport.

We observed the distribution of pendrin protein and mRNA to be similar in mouse kidney. Previous studies have detected pendrin mRNA in proximal tubule and CCD of rats by using Northern blots and RT-PCR (28). Use of quantitative real-time PCR has the advantage over Northern blots and other RT-PCR techniques in that it allows pendrin mRNA expression to be quantified over a 5-log range (4, 15). Using this technique, we observed expression of pendrin in the proximal tubule and the CCD, as reported by Soleimani et al. (28). However, in mice, pendrin mRNA expression is more than fivefold higher in CNT and CCD than in both proximal tubule and cTAL.

In conclusion, pendrin is highly expressed in the CNT and the CCD of mouse kidney. Pendrin is expressed in intercalated cells in a minority of DCT profiles, likely in the late portion of the DCT. Pendrin protein and mRNA expression are lower in the other structures of the mouse cortex. Expression of pendrin in the apical plasma membrane is greater in non-A-non-B intercalated cells than in type B intercalated cells. The observed differences in the subcellular distribution of pendrin immunoreactivity in type B intercalated cells and non-A-non-B intercalated cells suggest that under the conditions of these experiments, non-A-non-B intercalated cells are more actively involved in pendrin-mediated anion exchange than are type B intercalated cells. However, the presence of pendrin immunoreactivity in the apical cytoplasmic vesicles in both type B and non-A-non-B intercalated cells suggests that vesicle trafficking may occur in both cell types to regulate pendrin-mediated anion exchange under different physiological conditions.


    ACKNOWLEDGEMENTS

We thank Mae De la Caldenza and Michael P. Fischer (Department of Medicine, University of Texas Medical School, Houston, TX) and Melissa A. Lewis, Lauren DeWitt, and Dr. Sharon W. Matthews (University of Florida College of Medicine, Electron Microscopy Core Facility, Gainesville, FL) for technical assistance. We thank Dr. Mark Knepper for helpful suggestions.


    FOOTNOTES

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-52935 (S. M. Wall).

1 In mouse DCT, we observed pendrin mRNA per millimeter tubule length to be 61,417 ± 47,769 (n = 3) vs. 145,433 ± 79,892 (n = 3) for beta -actin. However, it is not possible to identify dissected DCT unambiguously in mouse kidney (5).

Address for reprint requests and other correspondence: S. M. Wall, Renal Division, Emory University School of Medicine, WMRB, Rm. 338, 1639 Pierce Dr. NE, Atlanta, GA 30322.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

August 27, 2002;10.1152/ajprenal.00147.2002

Received 17 April 2002; accepted in final form 20 August 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Alper, SL, Natale J, Gluck S, Lodish HF, and Brown D. Subtypes of intercalated cells in rat kidney collecting duct defined by antibodies against erythroid band 3 and renal vacuolar H+-ATPase. Proc Natl Acad Sci USA 86: 5429-5433, 1989[Abstract/Free Full Text].

2.   Bastani, B, Purcell H, Hemken P, Trigg D, and Gluck S. Expression and distribution of renal vacuolar proton-translocating adenosine triphosphatase in response to chronic acid and alkali loads in the rat. J Clin Invest 88: 126-136, 1991[Web of Science][Medline].

3.   Brown, D, Hirsch S, and Gluck S. Localization of a proton-pumping ATPase in rat kidney. J Clin Invest 82: 2114-2126, 1988[Web of Science][Medline].

4.   Bustin, SA. Absolute quantification of mRNA using real-time reverse transcriptase polymerase reaction assay. J Mol Endocrinol 25: 169-193, 2000[Abstract].

5.   Ciampolillo, F, McCoy DE, Green RB, Karlson KH, Dagenais A, Molday RS, and Stanton BA. Cell-specific expression of amiloride-sensitive, Na+-conducting ion channels in the kidney. Am J Physiol Cell Physiol 271: C1303-C1315, 1996[Abstract/Free Full Text].

6.   Drenckhahn, D, Schluter K, Allen DP, and Bennett V. Colocalization of band 3 with ankyrin and spectrin at the basal membrane of intercalated cells in the rat kidney. Science 230: 1287-1289, 1985[Abstract/Free Full Text].

7.   Elkjaer, ML, Hager H, Ishibashi K, Muallem S, Frokier J, and Nielsen S. Laser confocal microscopical and immunoelectron microscopical localization of anion exchanger AE4 in rat kidney (Abstract). J Am Soc Nephrol 12: 3A, 2001.

8.   Emmons, C. Functional characterization of anion exchange in mouse cortical collecting duct (CCD) intercalated cells (ICs) (Abstract). J Am Soc Nephrol 8: 5A, 1997.

9.   Emmons, C. Transport characteristics of the apical anion exchanger of rabbit cortical collecting duct b-cells. Am J Physiol Renal Physiol 276: F635-F643, 1999[Abstract/Free Full Text].

10.   Emmons, C, and Kurtz I. Functional characterization of three intercalated cell subtypes in the rabbit outer cortical collecting duct. J Clin Invest 93: 417-423, 1994[Web of Science][Medline].

11.   Everett, LA, Glaser B, Beck JC, Idol JR, Buchs A, Heyman M, Adawi F, Hazani E, Nassir E, Baxevanis AD, Sheffield VC, and Green ED. Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat Genet 17: 411-422, 1997[Web of Science][Medline].

12.   Fejes-Toth, G, Chen WR, Rusvai E, Moser T, and Naray-Fejes-Toth A. Differential expression of AE1 in renal HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>-secreting and -reabsorbing intercalated cells. J Biol Chem 269: 16717-26721, 1994.

13.   Gluck, S, Kelly S, and Al-Awqati Q. The proton translocating ATPase responsible for urinary acidification. J Biol Chem 257: 9230-9233, 1982[Abstract/Free Full Text].

14.   Good, DW. Adaptation of HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> and NH<UP><SUB>4</SUB><SUP>+</SUP></UP> transport in rat MTAL: effects of chronic metabolic acidosis and Na+ intake. Am J Physiol Renal Fluid Electrolyte Physiol 258: F1345-F1353, 1990[Abstract/Free Full Text].

15.   Heid, CA, Stevens J, Livak KJ, and Williams PM. Real time quantitative PCR. Genome Res 6: 986-994, 1996[Abstract/Free Full Text].

16.   Kim, J, Kim YH, Cha JH, Tisher CC, and Madsen KM. Intercalated cell subtypes in connecting tubule and cortical collecting duct of rat and mouse. J Am Soc Nephrol 10: 1-12, 1999[Abstract/Free Full Text].

17.   Kudrycki, KE, and Shull GE. Primary structure of the rat kidney band 3 anion exchange protein deduced from a cDNA. J Biol Chem 264: 8185-8192, 1989[Abstract/Free Full Text].

18.   Plotkin, MD, Kaplan MR, Verlander JW, Lee WS, Brown D, Poch E, Gullans SR, and Hebert SC. Localization of the thiazide sensitive Na-Cl cotransporter, rTSC1 in the rat kidney. Kidney Int 50: 174-183, 1996[Web of Science][Medline].

19.   Royaux, IE, Suzuki K, Mori A, Katoh R, Everett LA, Kohn LD, and Green ED. Pendrin, the protein encoded by the pendred syndrome gene (PDS), is an apical porter of iodide in the thyroid and is regulated by thyroglobulin in FRTL-5 cells. Endocrinology 141: 839-845, 2000[Abstract/Free Full Text].

20.   Royaux, IE, Wall SM, Karniski LP, Everett LA, Suzuki K, Knepper MA, and Green ED. Pendrin, encoded by the pendred syndrome gene, resides in the apical region of renal intercalated cells and mediates bicarbonate secretion. Proc Natl Acad Sci USA 98: 4221-4226, 2001[Abstract/Free Full Text].

21.   Sabolic, I, Brown D, Gluck SL, and Alper SL. Regulation of AE1 anion exchanger and H+-ATPase in rat cortex by acute metabolic acidois and alkalosis. Kidney Int 51: 125-137, 1997[Web of Science][Medline].

22.   Sands, JM, Terada Y, Bernard LM, and Knepper MA. Aldose reductase activities in microdissected rat renal tubule segments. Am J Physiol Renal Fluid Electrolyte Physiol 256: F563-F569, 1989[Abstract/Free Full Text].

23.   Schuster, VL. Bicarbonate reabsorption and secretion in the cortical and outer medullary collecting tubule. Semin Nephrol 10: 139-147, 1990[Web of Science][Medline].

24.   Schuster, VL. Function and regulation of collecting duct intercalated cells. Annu Rev Physiol 55: 267-288, 1993[Web of Science][Medline].

25.   Schuster, VL, Fejes-Toth G, Naray-Fejes-Toth A, and Gluck S. Colocalization of H+-ATPase and band 3 anion exchanger in rabbit collecting duct intercalated cells. Am J Physiol Renal Fluid Electrolyte Physiol 260: F506-F517, 1991[Abstract/Free Full Text].

26.   Scott, DA, and Karniski LP. Human pendrin expressed in Xenopus laevis oocytes mediates chloride/formate exchange. Am J Physiol Cell Physiol 278: C207-C211, 2000[Abstract/Free Full Text].

27.   Scott, DA, Wang R, Kreman TM, Sheffield VC, and Karniski LP. The pendred syndrome gene encodes a chloride-iodide transport protein. Nat Genet 21: 440-443, 1999[Web of Science][Medline].

28.   Soleimani, M, Greeley T, Petrovic S, Wang Z, Amlal H, Kopp P, and Burnham CE. Pendrin: an apical Cl-/OH-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchanger in the kidney cortex. Am J Physiol Renal Physiol 280: F356-F364, 2001[Abstract/Free Full Text].

29.   Star, RA, Burg MB, and Knepper MA. Bicarbonate secretion and chloride absorption by rabbit cortical collecting ducts: role of chloride/bicarbonate exchange. J Clin Invest 76: 1123-1130, 1985[Web of Science][Medline].

30.   Teng-ummnuay, P, Verlander JW, Yuan W, Tisher CC, and Madsen KM. Identification of distinct subpopulations of intercalated cells in the mouse collecting duct. J Am Soc Nephrol 7: 260-274, 1996[Abstract].

31.   Tsuganezawa, H, Kobayashi K, Iyori M, Araki T, Koizumi A, Watanabe SI, Kaneko A, Fukao T, Monkawa T, Yoshida T, Kim DK, Kanai Y, Endou H, Hayashi M, and Saruta T. A new member of the HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporter superfamily is an apical anion exchanger of beta-intercalated cells in the kidney. J Biol Chem 276: 8180-8189, 2001[Abstract/Free Full Text].

32.   van Adelsberg, JS, Edwards JC, and Al-Awqati Q. The apical Cl/HCO3 exchanger of b intercalated cells. J Biol Chem 268: 11283-11289, 1993[Abstract/Free Full Text].

33.   Verlander, JW, Madsen KM, Cannon JK, and Tisher CC. Activation of acid-secreting intercalated cells in rabbit collecting duct with ammonium chloride loading. Am J Physiol Renal Fluid Electrolyte Physiol 266: F633-F645, 1994[Abstract/Free Full Text].

34.   Weibel, ER, and Bolender RP. Stereological techniques for electron microscopic morphometry. In: Principles and Techniques of Electron Microscopy, edited by Hayat MA.. New York: Van Nostrand Reinhold, 1973, p. 237-296.

35.   Weiner, ID, Weill AE, and New AR. Distribution of Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchange and intercalated cells in rabbit cortical collecting duct. Am J Physiol Renal Fluid Electrolyte Physiol 267: F952-F964, 1994[Abstract/Free Full Text].


Am J Physiol Renal Fluid Electrolyte Physiol 284(1):F229-F241



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. H. Kim, T. D. Pham, W. Zheng, S. Hong, C. Baylis, V. Pech, W. H. Beierwaltes, D. B. Farley, L. E. Braverman, J. W. Verlander, et al.
Role of pendrin in iodide balance: going with the flow
Am J Physiol Renal Physiol, October 1, 2009; 297(4): F1069 - F1079.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H.-Y. Kim, J. W. Verlander, J. M. Bishop, B. D. Cain, K.-H. Han, P. Igarashi, H.-W. Lee, M. E. Handlogten, and I. D. Weiner
Basolateral expression of the ammonia transporter family member Rh C glycoprotein in the mouse kidney
Am J Physiol Renal Physiol, March 1, 2009; 296(3): F543 - F555.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. Hafner, R. Grimaldi, P. Capuano, G. Capasso, and C. A. Wagner
Pendrin in the mouse kidney is primarily regulated by Cl- excretion but also by systemic metabolic acidosis
Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1658 - C1667.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
D. Fioravante, R.-Y. Liu, and J. H. Byrne
The Ubiquitin-Proteasome System Is Necessary for Long-Term Synaptic Depression in Aplysia
J. Neurosci., October 8, 2008; 28(41): 10245 - 10256.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. Schliebe, R. Strotmann, K. Busse, D. Mitschke, H. Biebermann, L. Schomburg, J. Kohrle, J. Bar, H. Rompler, J. Wess, et al.
V2 vasopressin receptor deficiency causes changes in expression and function of renal and hypothalamic components involved in electrolyte and water homeostasis
Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1177 - F1190.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Adler, E. Efrati, and I. Zelikovic
Molecular mechanisms of epithelial cell-specific expression and regulation of the human anion exchanger (pendrin) gene
Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1261 - C1276.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
I. J. Lynch, A. Rudin, S.-L. Xia, L. R. Stow, G. E. Shull, I. D. Weiner, B. D. Cain, and C. S. Wingo
Impaired acid secretion in cortical collecting duct intercalated cells from H-K-ATPase-deficient mice: role of HK{alpha} isoforms
Am J Physiol Renal Physiol, March 1, 2008; 294(3): F621 - F627.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
V. Pech, W. Zheng, T. D. Pham, J. W. Verlander, and S. M. Wall
Angiotensin II Activates H+-ATPase in Type A Intercalated Cells
J. Am. Soc. Nephrol., January 1, 2008; 19(1): 84 - 91.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
F. Lang, V. Vallon, M. Knipper, and P. Wangemann
Functional significance of channels and transporters expressed in the inner ear and kidney
Am J Physiol Cell Physiol, October 1, 2007; 293(4): C1187 - C1208.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. H. Kim, V. Pech, K. B. Spencer, W. H. Beierwaltes, L. A. Everett, E. D. Green, W. Shin, J. W. Verlander, R. L. Sutliff, and S. M. Wall
Reduced ENaC protein abundance contributes to the lower blood pressure observed in pendrin-null mice
Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1314 - F1324.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. Y. Na, G.-H. Kim, K. W. Joo, J. W. Lee, H. R. Jang, Y. K. Oh, U. S. Jeon, S.-W. Chae, M. A. Knepper, and J. S. Han
Chronic furosemide or hydrochlorothiazide administration increases H+-ATPase B1 subunit abundance in rat kidney
Am J Physiol Renal Physiol, June 1, 2007; 292(6): F1701 - F1709.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. Zheng, J. W. Verlander, I. J. Lynch, M. Cash, J. Shao, L. R. Stow, B. D. Cain, I. D. Weiner, S. M. Wall, and C. S. Wingo
Cellular distribution of the potassium channel KCNQ1 in normal mouse kidney
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F456 - F466.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W.-Y. Kim, J.-H. Jung, E.-Y. Park, C.-W. Yang, H. Kim, S. Nielsen, K. M. Madsen, and J. Kim
Expression of protein kinase C isoenzymes {alpha}, betaI, and {delta} in subtypes of intercalated cells of mouse kidney
Am J Physiol Renal Physiol, November 1, 2006; 291(5): F1052 - F1060.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. W. Verlander, Y. H. Kim, W. Shin, T. D. Pham, K. A. Hassell, W. H. Beierwaltes, E. D. Green, L. Everett, S. W. Matthews, and S. M. Wall
Dietary Cl- restriction upregulates pendrin expression within the apical plasma membrane of type B intercalated cells
Am J Physiol Renal Physiol, October 1, 2006; 291(4): F833 - F839.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K.-H. Han, B. P. Croker, W. L. Clapp, D. Werner, M. Sahni, J. Kim, H.-Y. Kim, M. E. Handlogten, and I. D. Weiner
Expression of the Ammonia Transporter, Rh C Glycoprotein, in Normal and Neoplastic Human Kidney
J. Am. Soc. Nephrol., October 1, 2006; 17(10): 2670 - 2679.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Vallet, N. Picard, D. Loffing-Cueni, M. Fysekidis, M. Bloch-Faure, G. Deschenes, S. Breton, P. Meneton, J. Loffing, P. S. Aronson, et al.
Pendrin Regulation in Mouse Kidney Primarily Is Chloride-Dependent
J. Am. Soc. Nephrol., August 1, 2006; 17(8): 2153 - 2163.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Nissant, M. Paulais, S. Lachheb, S. Lourdel, and J. Teulon
Similar chloride channels in the connecting tubule and cortical collecting duct of the mouse kidney
Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1421 - F1429.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Petrovic, H. Amlal, X. Sun, F. Karet, S. Barone, and M. Soleimani
Vasopressin induces expression of the Cl-/HCO3- exchanger SLC26A7 in kidney medullary collecting ducts of Brattleboro rats
Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1194 - F1201.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. Xu, R. T. Worrell, H. C. Li, S. L. Barone, S. Petrovic, H. Amlal, and M. Soleimani
Chloride/Bicarbonate Exchanger SLC26A7 Is Localized in Endosomes in Medullary Collecting Duct Cells and Is Targeted to the Basolateral Membrane in Hypertonicity and Potassium Depletion
J. Am. Soc. Nephrol., April 1, 2006; 17(4): 956 - 967.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. M. Wall, M. A. Knepper, K. A. Hassell, M. P. Fischer, A. Shodeinde, W. Shin, T. D. Pham, J. W. Meyer, J. N. Lorenz, W. H. Beierwaltes, et al.
Hypotension in NKCC1 null mice: role of the kidneys
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F409 - F416.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y.-H. Kim, J. W. Verlander, S. W. Matthews, I. Kurtz, W. Shin, I. D. Weiner, L. A. Everett, E. D. Green, S. Nielsen, and S. M. Wall
Intercalated cell H+/OH- transporter expression is reduced in Slc26a4 null mice
Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1262 - F1272.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
F. Quentin, R. Chambrey, M. M. Trinh-Trang-Tan, M. Fysekidis, M. Cambillau, M. Paillard, P. S. Aronson, and D. Eladari
The Cl-/HCO3- exchanger pendrin in the rat kidney is regulated in response to chronic alterations in chloride balance
Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1179 - F1188.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Petrovic, S. Barone, J. Xu, L. Conforti, L. Ma, M. Kujala, J. Kere, and M. Soleimani
SLC26A7: a basolateral Cl-/HCO3- exchanger specific to intercalated cells of the outer medullary collecting duct
Am J Physiol Renal Physiol, January 1, 2004; 286(1): F161 - F169.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y.-H. Kim, T.-H. Kwon, B. M. Christensen, J. Nielsen, S. M. Wall, K. M. Madsen, J. Frokiaer, and S. Nielsen
Altered expression of renal acid-base transporters in rats with lithium-induced NDI
Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1244 - F1257.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Petrovic, L. Ma, Z. Wang, and M. Soleimani
Identification of an apical Cl-/HCO-3 exchanger in rat kidney proximal tubule
Am J Physiol Cell Physiol, September 1, 2003; 285(3): C608 - C617.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. W. Verlander, R. T. Miller, A. E. Frank, I. E. Royaux, Y.-H. Kim, and I. D. Weiner
Localization of the ammonium transporter proteins RhBG and RhCG in mouse kidney
Am J Physiol Renal Physiol, February 1, 2003; 284(2): F323 - F337.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/1/F229    most recent
00147.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (48)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wall, S. M.
Right arrow Articles by Verlander, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wall, S. M.
Right arrow Articles by Verlander, J. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online