|
|
||||||||

1 Division of Nephrology, Department of Medicine, University of Cincinnati, and 2 Veterans Affairs Medical Center, Cincinnati, Ohio 45267-0585
| |
ABSTRACT |
|---|
|
|
|---|
The purpose of the present studies was to
examine the renal distribution and functional properties of
Na+-HCO



sodium-bicarbonate cotransporter; NBC4; NBC1; acid-base transporters; thick limb of the loop of Henle
| |
INTRODUCTION |
|---|
|
|
|---|
FIRST DESCRIBED IN THE
KIDNEY, the Na+-HCO



On the basis of functional data, the presence of more than one NBC
isoform was suggested (3, 6, 8, 9, 12, 32-34, 39).
Recent molecular cloning experiments have confirmed this prediction by
identifying four NBC isoforms (NBC1-4) and two related proteins
(NCBE and AE4) (1, 2, 4, 10, 11, 13, 20, 25, 26, 28, 29, 33, 34,
36, 39). For each NBC isoform, a number of splice variants have
been identified. NBC1 has four distinct splice variants, with kidney
(kNBC1) and pancreatic (pNBC1) variants being the two most abundant
ones (1, 2, 10, 11, 28, 29, 33). With respect to NBC2,
three splice variants have been identified. These are retinal NBC2,
skeletal muscle NBC3 (mNBC3), and vascular NBCn1, which is a rat
ortholog of NBC2 (13, 20, 25). NBC3 has three identified
splice variants, with kNBC3 (also referred to as NDCBE) being the most
common (4, 19, 40). NBC4 has three variants that have been
reported so far (26, 31). These are referred to as NBC4a-c
(26, 31). NBC1-3 mediate
Na+-HCO
/HCO
/HCO
The purpose of the present studies was to study the renal distribution and functional properties of NBC4. Specifically, we were interested in comparing the electrogenicity of this transporter vs. NBC1, as both show the highest degree of homology to each other.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
RNA Isolation
RNA was extracted from various rat tissues by using TriReagent (Molecular Research, Cincinnati, OH) according to the manufacturer's instructions. The extracted RNA was quantitated spectrophotometrically and stored at
80°C.
Northern Blot Hybridization
RNA samples (30 µg/lane) were fractionated on 1.2% agarose-formaldehyde gels and transferred to nylon membranes. RNA was covalently bound to the nylon membranes by ultraviolet cross-linking. Hybridization was performed according to established methods and as used previously (4), with [32P]dCTP (NEN, Boston, MA)-labeled cDNA probes. Radiolabeled blots were exposed to PhosphorImager storage screens for 24-72 h and imaged by using ImageQuant software (Molecular Dynamics). For NBC4, a PCR fragment encoded by the rat NBC4-specific primers (ATGGTTGACCGATCCTTG and GCTGGCTCTTAATAATGATGGC for the sense and antisense directions, respectively) was purified from the rat kidney cortex RNA and used as a specific probe for Northern blot hybridization. For NBC1, an ~700-bp PCR fragment corresponding to nucleotides 1910-2650 of the rat kidney NBC1 cDNA was used as a specific probe.Nephron Segment Distribution of NBC4 in Rat
To examine the tissue and nephron segment distribution of NBC4 in rat, a rat NBC4 cDNA fragment was cloned by RT-PCR. The following primers were designed on the basis of the human NBC4 cDNA sequence: GCC AGC TAT GCA TGA AAT TG (sense) and ATG GGT CCT GTG CTG CTG AG (antisense). Using a gradient-based RT-PCR cycler, a cDNA fragment of 1.1 kb, which is the expected size for the fragment, was amplified from rat kidney. The cDNA sequence of this fragment is 76% homologous to human NBC4. Rat-specific primers (ATGGTTGACCGATCCTTG and GCTGGCTCTTAATAATGATGGC for the sense and antisense directions, respectively) were designed on the basis of the sequence of the amplified fragment and used for NBC4 RT-PCR. The rat PCR fragment corresponds to nucleotides 1434-1751 of NBC4a (AF-243499), 1781-2098 of NBC4b (NM-033323), 1781-2098 of NBC4c (AF-293337), and 1615-1932 of NBC4e (AF-452248). This fragment is therefore common to all NBC4 variants that have been cloned to date.Single nephron segments from the medullary thick ascending limb (mTAL), cortical thick ascending limb (cTAL), proximal straight tubule, or cortical collecting duct (CCD) were dissected from freshly killed rat kidney at 4-6°C. The dissection media comprised the following (in mM): 140 NaCl, 2.5 K2HPO4, 2 CaCl2, 1.2 MgSO4, 5.5 D-glucose, 1 Na-citrate, 4 Na-lactate, and 6 L-alanine, pH 7.4, bubbled with 100% O2. Tubule lengths were ~0.5-0.7 mm. The mTAL, cTAL, proximal straight tubule, or CCD segments were pooled in a small volume (5-10 µl) of ice-cold PBS, three or four segments per pool. The tubules were centrifuged at 12,000 g for 1 min at room temperature, and then PBS was removed and replaced with 10 µl of a tubule lysis solution consisting of 0.9% Triton X-100, 5 mmol/l DTT, and 1 U/µl rRNasin (Promega, Madison, WI). After 5 min on ice, the tubules were gently agitated by tapping the tube, and (in µl) 1 (0.5 µg) oligo(dT) primer, 1 H2O, 4 5× reverse transcription buffer, 2 DTT (0.1 mol/l), and 1 dNTPs (10 mmol/l each) were added. The reaction was equilibrated to 42°C for 2 min, and 1 µl SuperScript II RT (Life Technologies, Grand Island, NY) was added, mixed, and incubated for 1 h at 42°C. After reverse transcription, 30 µl of TE (10 mmol/l Tris · Cl and 1 mmol/l EDTA, pH 8.0) were added, and the combined mixture was heated to 95°C for 5 min and then placed on ice. Amplification of the NBC4 cDNA by PCR was performed with rat NBC4-specific primers (ATGGTTGACCGATCCTTG and GCTGGCTCTTAATAATGATGGC for the sense and antisense directions, respectively). Cycling parameters were 95°C for 32 s, 50°C for 37 s, and 68°C for 4 min.
Cloning of Human NBC4
Total RNA (2 µg) from human liver was reverse transcribed with an oligo(dT) RT and then subjected to PCR by using human NBC4-specific primers. The primers were designed on the basis of the published sequence (AF-207661) (26). One NH2-terminal and two distinct COOH-terminal fragments from human liver were identified by RT-PCR. To obtain the COOH-terminal fragment, the following primers were used: 5'-TCA GTC TCC ACC ACA AAT CGC AGT C (sense) and 5'-TTGTCA ATC CAG GCC AGG TCG TGC (antisense). This fragment encodes nucleotides 2869-5397 of the published cDNA. To obtain the NH2-terminal end, the following primers were used: 5'-GGA CAT GGT TCA GAA ACA GCT AAA GCA GAC (sense) and 5'-CGG TGA AGC GGG TGA TAT ATT TGA TG (antisense). This fragment corresponds to nucleotides 1989-4078 of the published cDNA. To obtain the full-length cDNAs, the following primers were used: GGA CAT GGT TCA GAA ACA GCT AAA GCA GAC (1989, sense) and TTG TCA ATC CAGGCCAGG TCG TGC (5397, antisense) for RT-PCR on RNA isolated from rat liver. Two full-length NBC4 variants were isolated that are referred to as NBC4e and NBC4f and contain 3345 and 3067 nucleotides, respectively. The NBC4f cDNA is shorter than NBC4e by only 278 bp; however, it shows a truncation of 377 amino acids on its COOH-terminal end due to a stop codon at position 2464. The hydropathy plot analysis of this truncated variant shows only six transmembrane-spanning domains (data not shown), which most likely makes it nonfunctional. NBC4e, on the other hand, has 10 transmembrane-spanning domains (as judged by the hydropathy plot analysis) and encodes a 1,051-amino acid protein (RESULTS). For the purpose of these studies, we focused on NBC4e characterization. Cycling parameters were as 30 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 3 min. All fragments were subcloned into pGEM-T vector and sequenced.Expression Studies in Xenopus laevis Oocytes
Synthesis of NBC1 and NBC4 cRNAs.
The capped NBC1 (kidney variant) and NBC4e cRNAs were generated by
using the mCAP RNA Capping Kit (Stratagene, La Jolla, CA) according to
the manufacturer's instruction. Briefly, the plasmids containing
full-length human NBC1 or NBC4 were linearized by restriction enzyme
digestion. The products were then in vitro transcribed to cRNAs. The
purified linear template, at 1 µg, was mixed with transcription
buffer, rNTP mix, mCAP analog, and T7 polymerase and incubated at
37°C for 30 min. The template was removed by adding RNAse-free DNAse
I to the reaction, and the product was purified by phenol-chloroform
extraction and ethanol precipitation. The size of the in vitro
transcription product, its quantity, and its quality were evaluated by
denaturing agarose gel electrophoresis. The cRNAs were stored in
RNase-free water at
80°C.
Expression of NBC transporters in X. laevis oocytes. X. laevis oocytes were injected with NBC1 or NBC4e cRNA. Stage IV and V oocytes were isolated as previously described (14) and used for expression studies according to established methods (35). Fifty nanoliters cRNA (0.2-1.3 µg/µl) were injected with a Drummond 510 microdispenser via a sterile glass pipette with a tip of 20-30 µm. After injection, the oocytes were maintained in a solution of the following composition (in mM): 96 NaCl, 2.0 KCl, 1.0 MgCl2, 1.8 CaCl2, 5 HEPES, 2.5 Na pyruvate, and 0.5 theophylline, as well as 100 U/ml penicillin and 100 µg/ml streptomycin, pH 7.5. Injected oocytes were stored in an incubator at 19°C and were used for electrophysiological experiments after 2-4 days.
Electrophysiology.
Oocytes were placed on nylon mesh in a perfusion chamber and
continuously perfused (3 ml/min perfusion rate). The perfusion solution
had the following composition (in mM): 96 NaCl, 2 KCl, 1 MgCl2, 1.8 CaCl2, and 15 HEPES, pH 7.5. After a
stabilization period, when the membrane potential
(Vm) was constant, the perfusion solution was
switched to a CO2/HCO
) filled with 3 M KCl and connected to an Axoclamp 2A amplifier
(Axon Instruments, Foster City, CA) (14, 40). The
digitized signals were stored and analyzed on a personal computer with
Axotape (Axon Instruments).
Intracellular pH studies. Intracellular pH (pHi) in oocytes was measured with the pH-sensitive fluorescent probe BCECF (Molecular Probes, Eugene, OR) as described (30, 40). Briefly, oocytes were incubated with 10 µM BCECF-AM for 8-10 min at room temperature and then transferred onto nylon mesh attached to the bottom of a 1-ml perfusion chamber. Fluid was delivered to the chamber by a peristaltic pump in the CO2-impermeable tubing (Cole Palmer) and exchanged at the rate of 4 ml/min. The chamber was closed by a custom-made tightly fitting lid and constantly superfused with the gas mixture of 1.5% CO2-98.5% O2 to prevent CO2 loss and keep the pH constant. pH of the fluid in the chamber was frequently checked with a Horiba pH meter (model B213). Ratiometric fluorescence measurements were performed on a Zeiss Axiovert S-100 inverted microscope equipped with the Attofluor RatioVision digital imaging system (Attofluor, Rockville, MD). Achroplan ×40/0.8 water objective with 3.6-mm working distance was used. Ratiometric fluorescence measurements were performed by using the Attofluor digital imaging system. Excitation wavelengths were 450 and 488 nm, and fluorescence emission intensity was recorded at 520 nm. Digitized images were analyzed by using the Attograph and Attoview software packages provided by Attofluor. Intracellular calibration studies were performed by the high-K+-nigericin method. Accordingly, at the end of the experiment, each oocyte was perfused with at least three different pH calibration solutions (6.4, 7, and 7.5). Nigericin (40 µM) was added to each calibration solution, and pH was constantly monitored until it reached a stable value, usually in ~10 min or less. Calibration points were fitted to a linear regression curve, which was then used for conversion of calculated F488/F450 ratios to cell pH (see Fig. 6B, right, a representative calibration tracing) and was performed at the end of the experiment depicted in Fig. 6B, left. The dynamic range of our measurements, the range of acquired ratios vs. the range of pH values used for calibration, was comparable to those published previously for oocytes (30). Rather than performing calibration studies in oocytes separate from the experimental oocytes (30), we obtained a calibration curve at the end of each experiment in the same oocyte that was used for the actual experiment. This modification may account for the differences in the absolute pHi values in our present study compared with the published results (30).
To measure NBC activity, oocytes were first incubated in a HCO


Materials
A Marathon cDNA Amplification Kit was purchased from Clontech Laboratories (Palo Alto, CA). DMEM/F-12 medium was purchased from Life Technologies. All other chemicals were purchased from Sigma (St. Louis, MO).Statistics
Results are given as means ± SE. Statistical comparisons between the groups were performed by ANOVA. The data were considered significant if P < 0.05.| |
RESULTS |
|---|
|
|
|---|
Tissue Distribution of NBC4 in Rat
Figure 1A is a representative Northern blot hybridization and demonstrates that NBC4 mRNA levels are abundant in proximal colon, distal colon, and kidney, moderate in duodenum and stomach, and very low in heart and liver. To determine whether NBC4 is indeed present in liver and heart, an RT-PCR experiment was performed by using rat-specific primers (see EXPERIMENTAL PROCEDURES). As shown in Fig. 1B, an NBC4 transcript of expected size is detected in RNA isolated from liver and heart. The expression of NBC4 in the kidney is shown for comparison. The cDNA sequence of the purified PCR band verified its identity as NBC4.
|
Renal Distribution of NBC4
The studies in Fig. 1 indicated that NBC4 mRNA is expressed in the kidney. To examine the zonal distribution of NBC4 in the kidney, RNA from rat kidney cortex, outer medulla, and inner medulla was utilized for RT-PCR by using rat-specific primers. As shown in Fig. 2, a PCR fragment, which has abundant expression in the cortex and outer medulla but very low expression in the inner medulla, was identified. The cDNA sequence of the purified PCR fragment verified its identity as NBC4.
|
To determine whether detectable NBC4 mRNA levels are expressed in
various kidney zones, Northern blot hybridizations were performed on
RNA isolated from cortex, outer medulla, and inner medulla. A
representative blot is shown in Fig.
3A and indicates high NBC4
mRNA expression levels in the outer medulla followed by the cortex. The
abundance of NBC4 in the inner medulla was very low (Fig.
3A). This pattern of expression is distinct from NBC1, which
is predominantly expressed in the cortex and is very faint or absent in
the outer medulla or inner medulla, respectively (Fig. 3B).
|
Nephron Segment Distribution of NBC4
The presence of NBC4 in the outer medulla (and cortex) is interesting. To determine whether NBC4 expression in the outer medulla (and cortex) is originating in part from mTAL (and cTAL), single-nephron RT-PCR was performed on isolated tubules. Three single mTAL tubules and three single cTAL tubules were pooled separately and subjected to RT-PCR. As indicated in Fig. 4A, mTAL and cTAL tubules abundantly express NBC4. In separate experiments, the expression of NBC4 mRNA in proximal tubule and CCD was examined. Figure 4B shows very faint bands of expected size in proximal tubule and CCD. The tubule lengths were comparable and cycling parameters were identical in all nephron segment RT-PCR experiments.
|
Cloning of a Novel NBC4 Variant (Nucleotide and Amino Acid Sequence)
RT-PCR of human liver RNA with primers encoding the full-length coding region of NBC4 (see EXPERIMENTAL PROCEDURES) identified two distinct transcripts that when sequenced were confirmed to be novel variants of NBC4 (see EXPERIMENTAL PROCEDURES). Figure 5 depicts and compares the conceptual translation of the open reading frame of NBC4e with NBC4a and kidney NBC1. As indicated, the sequence of NBC4e is shorter by 86 amino acids compared with the published sequence of NBC4a. The open reading frame of NBC4e encodes a 1,051-amino acid protein. The sequence of NBC4f, which is shorter than NBC4a by 377 amino acids, is not shown here but can be accessed from GenBank (AF-453528).
|
NBC4 Expression in Oocytes: pHi Studies
In this series of experiments, the functional properties of NBC4e were examined. Toward this end, pHi was monitored in oocytes that were injected with NBC4e cRNA. For comparison, oocytes that were injected with water were utilized. As shown in Fig. 6, switching to a CO2/HCO


|
The results of Na+-dependent,
HCO


|
Baseline pHi was 7.37 ± 0.029 in control oocytes
(n = 5) and 7.41 ± 0.025 in oocytes injected with
NBC4 cRNA (n = 6; P > 0.05 for both).
The rate of Na+-dependent pHi recovery in
NBC4-injected oocytes was similar in normal (Cl-containing solutions)
and Cl-depleted oocytes (perfused with Cl-free, gluconate-containing
solutions for 45 min before pHi recording), indicating that
NBC4 does not function in Na+-dependent
Cl
/HCO
NBC4 Expression in Oocytes: Electrogenecity
In this series of experiments, we monitored Vm in oocytes injected with NBC4e cRNA. For comparison, oocytes injected with NBC1 cRNA were utilized. Exposure to CO2/HCO


|
Interestingly, exposure to CO2/HCO

The summary of the effects of CO2/HCO

59 ± 2 mV in control oocytes
(n = 7),
61 ± 1 mV in NBC1 (n = 11), and
62 ± 1 mV in NBC4 (n = 12). The
average Vm measured after 3-min exposure to
CO2/HCO
|
The above Vm recordings and pHi
tracings were obtained from separate oocytes. In the next series of
experiments, we performed Vm recordings followed
by pHi measurement in the same oocyte. Accordingly, oocytes
were subjected to electrophysiological measurement and, on the
completion of Vm recording, were removed from
the chamber, loaded with BCECF, and subjected to pHi
measurement. Figure 10A is a
representative recording and indicates that no changes in
Vm were observed in response to exposure to
CO



|
| |
DISCUSSION |
|---|
|
|
|---|
NBC4 mRNA expression in the kidney is abundant in the outer
medulla and cortex and low in the inner medulla (Figs. 2 and 3). NBC4
is predominantly expressed in the mTAL and cTAL of the loop of Henle
(Fig. 4). Functional studies indicated that NBC4 mediates a
DIDS-inhibitable, Na+-dependent HCO
In the present studies, a novel human NBC4 transcript was cloned and characterized. The NBC4 variant has a 3153-nucleotide open reading frame and encodes a 1,051-amino acid protein (Fig. 5). Similar to other NBC isoforms, NBC4e has 10 transmembrane-spanning domains. Amino acid sequence analysis demonstrated that similar to NBC1 (9), NBC4 has one cAMP-dependent protein kinase phosphorylation site and one tryosine kinase phosphorylation site (Fig. 5). NBC4e has five potential NH2-linked glycosylation sites (436, 688, 703, and 711 amino acids) and multiple casein kinase and protein kinase C phosphorylation sites.
An interesting aspect of these studies is the distinct pattern of NBC4 distribution in the kidney (Figs. 2-4). NBC4 expression is abundant in the outer medulla, with lower levels in the cortex. The inner medulla has the least amount of NBC4 among kidney zones. This is distinct from NBC1, which is highly expressed in the cortex and is very faint or absent in the outer medulla and inner medulla, respectively (Fig. 3B and Refs. 2, 29, and 33). NBC4 is predominantly expressed in mTAL and cTAL of the loop of Henle, sites that do not express NBC1 (2, 29, 33), suggesting that NBC4 and NBC1 perform distinct functions. The accuracy of nephron segment isolation was verified by examining the isolated tubules for the expression of apical Na-K-2Cl cotransporter, which is exclusively expressed in mTAL and cTAL. RT-PCR studies verified the expression of Na-K-2Cl cotransporter in isolated mTAL and cTAL tubules.
NBC1 is highly electrogenic (Figs. 8 and 9) and mediates the transport
of HCO







The inward NBC4 flux direction should result in the transport of
HCO






Two recent reports suggested that NBC4c (a variant of NBC4) is
electrogenic and carries a net negative charge (31, 37). This conclusion, although at variance with the present results (Figs.
8-10), may be due to the possibility that those studies (31, 37) used a splice variant of NBC4 distinct from our clone.
Whether the truncation of NBC4 by 86 amino acids could be responsible for the lack of electrogenecity of NBC4e in the present results (Figs.
8-10) remains to be studied. It should be mentioned that the recordings of Vm and pHi recovery
from acidosis in response to CO2/HCO
Rat NBC4 has a molecular mass of 3.5 kb (Figs. 1-3), which is much smaller than the human NBC4 molecular mass of 6 kb (26). The difference likely results from the presence of a long noncoding region in human NBC4, because the coding region of human NBC4 is only ~3.2 kb. The mRNA of rat NBC4 in the outer medulla and cortex appears as two transcripts, raising the possibility that similar to human NBC4, rat NBC4 has more than one splice variant. Interestingly, the larger transcript is absent in the inner medulla and stomach. Additional studies are needed to clone and examine the regulation of rat NBC4 transcripts.
Although the subcellular localization of NBC4 was not determined in
these studies, it is likely that this transporter is expressed on the
basolateral membrane of epithelial cells. This conclusion is strongly
supported by nephron segment studies indicating the expression of NBC4
in the mTAL and cTAL (Fig. 4) as well as functional studies indicating
the lack of any luminal Na+-dependent
HCO
In conclusion, NBC4e is a novel variant of NBC4 and mediates a
DIDS-sensitive electroneutral cotransport of Na+ and
HCO

| |
ACKNOWLEDGEMENTS |
|---|
These studies were supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-54430, a Merit Review grant, a grant from the Cystic Fibrosis Foundation, and grants from Dialysis Clinic, Inc. (M. Soleimani). L. Conforti was supported by American Heart Association Grant 0030091N.
| |
FOOTNOTES |
|---|
The nucleotide sequences reported in this paper have been submitted to GenBank/EBI Data Bank as AF-452248 (NBC4e) and AF-453528 (NBC4f).
Address for reprint requests and other correspondence: M. Soleimani, Division of Nephrology and Hypertension, Univ. of Cincinnati Medical Ctr., 231 Albert Sabin Way, MSB G259, Cincinnati, Ohio 45267-0585 (E-mail: Manoocher.Soleimani{at}uc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
August 13, 2002;10.1152/ajprenal.00055.2002
Received 7 February 2002; accepted in final form 7 August 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abduladze, N,
Lee I,
Newman D,
Hwang J,
Boorer K,
Pushkin A,
and
Kurtz I.
Molecular cloning, chromosomal localization, tissue distribution, and functional expression of the human pancreatic sodium bicarbonate cotransporter.
J Biol Chem
273:
17689-17695,
1998
2.
Abduladze, N,
Lee I,
Newman D,
Hwang J,
Pushkin A,
and
Kurtz I.
Axial heterogeneity of sodium-bicarbonate cotransporter expression in the rabbit proximal tubule.
Am J Physiol Renal Physiol
274:
F628-F633,
1998
3.
Alpern, RJ.
Mechanism of basolateral membrane H+/OH
/HCO
4.
Amlal, H,
Burnham CE,
and
Soleimani M.
Characterization of the Na+:HCO
5.
Amlal, H,
Habo K,
and
Soleimani M.
Potassium deprivation upregulates expression of renal basolateral Na+-HCO
6.
Aronson, PS,
Soleimani M,
and
Grassl SM.
Properties of the renal Na(+)-HCO
7.
Astion, ML,
Obaid AL,
and
Orkand RK.
Effects of barium and bicarbonate on glial cells of Necturus optic nerve.
J Gen Physiol
93:
731-744,
1989
8.
Bonanno, JA,
and
Giasson C.
Intracellular pH regulation in fresh and cultured bovine corneal endothelium. II. Na+:HCO
/HCO
9.
Boron, WF,
and
Boulpaep EL.
Intracellular pH regulation in the renal proximal tubule of the salamander: basolateral HCO
10.
Burnham, CE,
Amlal H,
Wang Z,
Shull GE,
and
Soleimani M.
Cloning and functional expression of a human kidney Na+:HCO
11.
Burnham, CE,
Flagella M,
Wang Z,
Amlal H,
Shull GH,
and
Soleimani M.
Cloning, renal distribution, and regulation of the rat Na+-HCO
12.
Camilion Hurtado, MC,
Alvarez BV,
Perez NG,
and
Cingolini NE.
Role of an electrogenic Na+/HCO
13.
Choi, I,
Aalkjær C,
Boulpaep EL,
and
Boron WF.
An electroneutral sodium/bicarbonate cotransporter NBCn1 and associated sodium channel.
Nature
405:
571-575,
2000[Medline].
14.
Conforti, L,
and
Sperelakis N.
The patch clamp technique for measurement of K+ channels in Xenopus oocytes and mammalian expression systems.
In: Potassium Channels in Cardiovascular Biology, edited by Archer A,
and Rusch M.. New York: Kluwer Academic/Plenum, 2001, p. 143-161.
15.
Dart, C,
and
Vaughan-Jones RD.
Na(+)-HCO
16.
Fitz, JC,
Persico M,
and
Scharschmidt BF.
Electrophysiological evidence for Na-coupled bicarbonate transport in cultured rat hepatocyte.
Am J Physiol Gastrointest Liver Physiol
256:
G491-G500,
1989
17.
Gleeson, D,
Smith ND,
and
Boyer JL.
Bicarbonate dependent and independent intracellular pH regulatory mechanisms in rat hepatocyte.
J Clin Invest
84:
312-321,
1989[ISI][Medline].
18.
Good, DW.
The thick ascending limb as a site of renal bicarbonate reabsorption.
Semin Nephrol
13:
225-235,
1993[ISI][Medline].
19.
Grichtchenko, II,
Choi I,
Zhong X,
Bray-Ward P,
Russell JM,
and
Boron WF.
Cloning, characterization and chromosomal mapping of a human electroneutral Na+- driven Cl-HCO3 exchanger.
J Biol Chem
276:
8358-8363,
2001
20.
Ishibashi, K,
Sasaki S,
and
Marumo F.
Molecular cloning of a new sodium bicarbonate cotransporter cDNA from human retina.
Biochem Biophys Res Commun
246:
535-538,
1998[ISI][Medline].
21.
Jentsch, TJ,
Stahlknecht TR,
Hollwede H,
Fischer DG,
Keller SK,
and
Wiederholt M.
A bicarbonate-dependent process inhibitable by disulfonic stilbenes and a Na+/H+ exchanger mediate 22Na+ uptake into cultured bovine corneal endothelium.
J Biol Chem
260:
795-801,
1985
22.
Kwon, TH,
Fulton C,
Wang W,
Kurtz I,
Frøkiær J,
Aalkjær C,
and
Nielsen S.
Chronic metabolic acidosis upregulates rat kidney Na-HCO
23.
Lagadic-Gossmann, D,
Buckler KJ,
and
Vaughn-Jones RD.
Role of HCO
24.
Lubman, RL,
Chao DC,
and
Crandall ED.
Basolateral localization of Na-HCO
25.
Pushkin, A,
Abuladze N,
Lee I,
Newman D,
Hwang J,
and
Kurtz I.
Cloning, tissue distribution, genomic organization, and functional characterization of NBC3, a new member of the sodium bicarbonate cotransporter family.
J Biol Chem
274:
16569-16575,
1999
26.
Pushkin, A,
Abuladze N,
Newman D,
Lee I,
Xu G,
and
Kurtz I.
Two C-terminal variants of NBC4, a new member of the sodium bicarbonate cotransporter family: cloning, characterization, and localization.
IUBMB Life
50:
13-19,
2000[ISI][Medline].
27.
Rajendran, VM,
Oesterlin M,
and
Binder HJ.
Sodium uptake across basolateral membrane of rat distal colon. Evidence for Na-H exchange and Na-anion cotransport.
J Clin Invest
88:
1379-1385,
1991[ISI][Medline].
28.
Romero, MF,
Fong P,
Berger UV,
Hediger MA,
and
Boron WF.
Cloning and functional expression of rNBC, an electrogenic Na+-HCO
29.
Romero, MF,
Hediger MA,
Boulpaep EL,
and
Boron WF.
Expression cloning and characterization of a renal electgrogenic Na+:HCO
30.
Sasaki, S,
Ishibashi K,
Nagai T,
and
Marumo F.
Regulation mechanisms of intracellular pH of Xenopus laevis oocyte.
Biochim Biophys Acta
1137:
45-51,
1992[Medline].
31.
Sasani, P,
Pushkin A,
Gross E,
Abuladze N,
Dukkipati R,
Carpenito G,
Newman D,
and
Kurtz I.
Functional characterization of NBC4: a new electrogenic sodium-bicarbonate cotransporter.
Am J Physiol Cell Physiol
282:
C408-C416,
2002
32.
Soleimani, M,
and
Burnham C.
Physiologic and molecular aspects of the Na+:HCO
33.
Soleimani, M,
and
Burnham CE.
Na+:HCO
34.
Soleimani, M,
Grassl SM,
and
Aronson PS.
Stoichiometry of the Na+-HCO
35.
Stuhmer, W,
and
Parekh AB.
Electrophysiological recordings form Xenopus oocytes.
In: Single-Channel Recording (2nd ed.), edited by Sackman B,
and Neher E.. New York: Plenum, 1995, p. 341-356.
36.
Tsuganezawa, H,
Kobayashi K,
Iyori M,
Araki T,
Koizumi A,
Watanabe SI,
Kaneko A,
Fukao T,
Monkawa T,
Kim DK,
Kanai Y,
Endou H,
Hayashi M,
and
Saruta T.
A new member of the HCO
37.
Virkki, LV,
Wilson DA,
Vaughan-Jones RD,
and
Boron WF.
Functional characterization of human NBC4 as an electrogenic Na+-HCO
38.
Vorum, H,
Kwon TH,
Fulton C,
Simonsen B,
Choi I,
Boron W,
Maunsbach AB,
Nielsen S,
and
Aalkjær C.
Immunolocalization of electroneutral Na-HCO
39.
Wang, CZ,
Yano H,
Nagashima K,
and
Seino S.
The Na+ driven Cl/HCO
40.
Wang, Z,
Conforti L,
Petrovic S,
Amlal H,
and
Burnham C.
Mouse Na+:HCO
41.
Yoshitomi, K,
Burckhardt BC,
and
Fromter E.
Rheogenic sodium-bicarbonate co-transport in the peritubular cell membrane of rat renal proximal tubule.
Pflügers Arch
405:
360-366,
1985[ISI][Medline].
This article has been cited by other articles:
![]() |
|