|
|
||||||||
1 Universitätsklinikum Eppendorf, 20246 Hamburg, Germany; 2 Division of Nephrology, Department of Medicine, Veterans Affairs Medical Center, and 3 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, Tennessee 37212-2372
| |
ABSTRACT |
|---|
|
|
|---|
The
Cre/loxP transgenic system may be used to achieve temporally
and/or spatially regulated gene deletion. The Mx1Cre
mouse expresses Cre recombinase under control of the IFN-inducible
Mx1 promoter. Mx1Cre mice were crossed with a
reporter strain (ROSA26tm1Sor) in which
-galactosidase activity is
expressed only after Cre-mediated recombination to determine
the cellular pattern of Cre-mediated genetic recombination
in the kidney and other tissues. Widespread recombination was observed
in vascular endothelium as well as in the liver and spleen.
Recombination was restricted to subsets of stromal cells in uterus,
duodenum, colon, aorta, and kidney. In the cortex,
-galactosidase
activity was detected in a subset of tubules and all glomerular cells,
including endothelium, mesangium, and podocytes. No
-galactosidase
activity was detected in proximal tubules. Costaining of kidneys with
segment-specific markers demonstrated induction of
-galactosidase
activity in collecting duct, with sporadic labeling of the thick
ascending limb but no significant labeling of distal convoluted
tubules. We conclude that Mx1-driven gene recombination is
spatially as well as temporally restricted. The Mx1Cre
transgene should prove a useful reagent to achieve temporally regulated
recombination in endothelial, glomerular, and distal renal epithelia in mice.
Cre recombinase; liver; spleen; interstitium; collecting duct; glomerulus
| |
INTRODUCTION |
|---|
|
|
|---|
GENE-TARGETING STRATEGIES have helped to elucidate the roles of several genes in developmental biology. However, the use of traditional knockout animals does not allow examination of the physiological role of a gene when its deletion leads to intrauterine or perinatal death. Furthermore, identification of specific roles for a gene in particular tissues or cell types may be obscured, because widespread deletion of the gene in multiple cell types or tissues could equally account for a particular phenotype. Conditional gene-targeting systems have been developed to address these deficiencies. The Cre/loxP system allows spatially or temporally regulated gene targeting mediated by two separate transgenes: loxP sites and Cre recombinase (10, 18, 19, 21). LoxP sites comprise a specific 34-bp DNA sequence that is engineered to flank the gene to be deleted (i.e., a "floxed" allele). LoxP sequences provide recognition sites for the second component, Cre recombinase, a 343-amino acid protein from the bacteriophage P1 that binds to the loxP sites and mediates excision of the intervening nucleotide sequence (15, 19). By placing Cre recombinase expression under the control of an inducible or tissue-specific promoter, temporal or spatial control of genetic deletion can be achieved (10, 18, 19, 21).
The Mx1Cre transgenic mouse expresses a modified Cre recombinase under control of the inducible Mx1 promoter (10), part of the viral defense system that is normally silent in healthy mice (1, 7). Mx1 gene expression is potently induced by IFN or intraperitoneal injection of the IFN inducer polyinosinic-polycytidylic acid (pI-pC), a synthetic double-stranded RNA. Previous studies of Mx1Cre mice reported tissue-dependent efficiency of Mx1Cre-mediated recombination of a floxed DNA polymerase allele as determined by Southern blot (10). After induction with pI-pC, nearly 100% recombination was found in liver, spleen DNA, and hematopoetic cells, but only 50% recombination was detected in kidney, heart, and lung DNA by using Southern blot hybridization (3, 10, 14). The basis for this difference is poorly understood, and the cell-specific pattern of recombination in kidney and other tissues was not determined.
The purpose of the present study was to determine whether incomplete Cre-mediated recombination observed in whole kidney DNA results from global but inefficient recombination throughout the kidney or from a highly efficient recombination restricted to certain cell types of the kidney. The latter finding would allow the Mx1Cre transgenic mouse to be used as a system for inducible gene targeting in specific regions or cell types within the kidney.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Chemical reagents and transgenic animals.
pI-pC and other reagents were purchased from Sigma (St. Louis, MO)
unless stated otherwise. C57Bl/6 mice were purchased from Harlan
Sprague-Dawley (Indianapolis, IN). Transgenic mice carrying Cre under control of the IFN-inducible Mx1 promoter
(Mx1Cre mice) were generously provided by Dr. Joachim Herz
(University of Texas, Health Science Center). B6,
129-GtRosa26tm1Sor mice (no. 3309, Jackson Laboratory, Bar
Harbor, ME) were used as a reporter strain. The LacZ gene
has been inserted into the ROSA26 locus. The Rosa26 promoter is a
universally expressed gene (17), but in this strain its
transcription is suppressed by placement of an upstream
polyA+ containing a "stop" sequence flanked by
loxP sequences (i.e., loxP/polyA+/loxP-LacZ). When crossed
with a Cre transgenic strain, genetic recombination occurs at the two
LoxP sites, excising the intervening stop sequence, thereby
allowing LacZ to be expressed. LacZ expression can therefore be utilized to localize sites of Cre recombinase activity
(17, 22). Staining for
-galactosidase tissues of Mx1Cre × B6, 129-Gtrosa26tm1Sor transgenic
mice thereby reveals the cellular distribution of the
Cre-mediated recombination. Animals were housed under
standard conditions and were fed a regular rodent chow containing 6%
fat (wt/wt; TEKLAD Premier Laboratory Diets, Madison, WI).
Induction of Mx1Cre expression. Mice were injected intraperitoneally with 250 µl of 1 mg/ml pI-pC RNA or 250 µl saline every other day for a total of three injections.
Preparation of tissue and immunohistochemistry.
Multiple organs, including liver, spleen, stomach, duodenum,
lung, and kidneys, of the double transgenic mice were harvested at
death 3 days after the final pI-pC injection. After fixation with 4%
paraformaldehyde+0.25% glutaraldehyde in PBS for 2 h at 4°C,
tissue sections were cut with a vibratome into 200-µm slices. To
detect
-galactosidase activity, these slices were bathed twice in
permeabilization solution (2 mM MgCl2, 0.01% sodium
deoxycholate, and 0.02% Nonidet P-40 in PBS) for 30 min and then
stained with 1 mg/ml
5-bromo-4-chloro-3-indolyl-D-galactopyranoside
(
-galactosidase; Sigma) in staining solution (2 mM
MgCl2, 5 mM potassium ferricyanide, potassium ferrocyanide,
and 20 mM Tris, 7.4 pH, in PBS) at room temperature in the dark for
48 h (2, 13). Tissues were washed, dehydrated through
a graded ethanol series, and embedded in paraffin by using standard
procedures. Serial 5-µm sections were cut and examined by light
microscopy. To define the
-galactosidase-positive nephron
segments, costaining was performed with a goat anti-human Tamm-Horsfall antibody (1:2,500; Organon-Technika) that specifically recognizes medullary and cortical thick ascending limb (TAL), as well
as the early portion of the distal tubule (8, 23), or the
lectin Dolicus biflorus (Vector Laboratories) that
specifically recognizes mouse collecting duct
(11). A commerically available anti-aquaporin-2
(AQP2) antibody was used to specifically identify collecting duct
principal cells (AQP21-A, anti-rat AQP2 IgG no. 2, Alpha Diagnostic
International, San Antonio, TX) (6). To define distal
convoluted tubule (DCT) segments, an anti-thiazide-sensitive NaCl
cotransporter (TSC) antibody was used (generously provided by Dr. Mark
Knepper, National Institutes of Health, Bethesda, MD) (9).
Staining was localized by using biotinylated D. biflorus (1:250), or a biotinylated anti-IgG secondary antibody was applied to
-galactosidase-stained sections. Biotin was identified by using
streptavidin coupled to horseradish peroxidase and was visualized with
diaminiobenzidine (Vectastain ABC kit, Vector Laboratories). Sections
were viewed and imaged with a Zeiss Axioskop and spot-cam digital
camera (Diagnostic Instruments).
Genotyping for Cre and LacZ-ROSA by PCR. Transmission of Mx1Cre and lacZ genes to the intercrossed offspring of the two transgenic strains was determined by PCR of genomic DNA isolated from mouse tail segments by using a DNA isolation kit (Qiagen). A 370-bp Cre-specific fragment was amplified with primers ACCTGAAGATGTTCGCGATTATCT and ACCGTCAGTACGTGAGATATCTT. An 822-bp LacZ-specific fragment was amplified with primers GCATCGAGCTGGGTAATAAGGGTTGGCAAT and GACACCAGACCAACTGGTAATGGTAGCGAC. Internal control primers to amplify a 150-bp fragment in all genomic DNA samples were CAAATGTTGCTTGTCTGGTG and GTCAGTCGAGTGCACAGTTT. Amplification was performed for all fragments by using 40 cycles with 1 min at 94°C, 30 s at 60°C, and 30 s at 72°C. Genotyping results were determined from PCR reactions run on 1% agarose gels.
| |
RESULTS |
|---|
|
|
|---|
Transgenic mice carrying both the Mx1Cre transgene and the LoxP-stop-LoxP-regulated ROSA26tm1Sor transgene were obtained by intercrossing C57/B6 Mx1Cre mice with B6, 129-Gt ROSA 26tm1Sor mice. Transmission of both transgenes was confirmed by PCR analysis using Cre- and lacZ-specific primers. Mx1Cre expression was induced by interperitoneally injecting pI-pC three times into at least five individual, 8-wk-old double transgenic Mx1Cre×Rosa26/lacZ animals for each tissue studied. Saline injections were also performed in three double-transgenic animals to determine the level of background staining and to serve as a control for spontaneous noninduced Cre-mediated recombination. Three days after the third injection of pI-pC, animals were killed and organs were harvested.
Saline injection did not induce
-galactosidase activity (Figs.
1 and 2, blue
staining)
in any tissue studied including liver spleen and kidneys. In
contrast, pI-pC injection induced intense
-galactosidase activity,
particularly in liver and spleen (Fig. 1), in accordance with
previously reported results using Southern blot (3, 10,
14).
-Galactosidase activity was also widely present in
pulmonary endothelium, cerebral endothelium (Fig. 1), and the
epithelium of the choroid plexus in the brain (not shown). Cre-mediated recombination was also observed in
subpopulations of stroma and smooth muscle in aorta and uterus but was
completely absent in cardiac muscle (not shown).
|
|
In the kidney, intense
-galactosidase staining was present
throughout the outer medulla, reflecting highly efficient
Cre-mediated recombination in this region of the kidney
(Fig. 2). Little staining was detected in the papilla. In the cortex,
only sporadic
-galactosidase activity was detected in the proximal
tubule (Fig. 2). Cortical
-galactosidase activity was apparent in
glomeruli, microvascular endothelium, and collecting ducts (Fig. 2). In
the glomerulus,
-galactosidase activity was expressed in all
cellular compartments, including the mesangium, and visceral epithelial
cells (i.e., podocytes; Fig. 2) but was most intense in the endothelium.
Proximal tubules, identified by the presence of a brush-border
membrane, showed no evidence of
-galactosidase activity. Similarly, costaining with TSC antibody, a marker for DCT, showed no evidence of
-galactosidase activity in the DCT. Colabeling with Tamm-Horsfall antibody, to identify TAL, revealed only sporadic
-galactosidase labeling of the cortical TAL (Fig. 2, C and D)
and more extensive, but still limited, labeling of the medullary thick
limb. In contrast, colabeling with collecting duct markers, including
the lectin, D. biflorus, and AQP2, confirmed robust
Cre-mediated recombination that was more efficient in the
outer medulla (outer medullary collecting duct) than in the cortex
(cortical collecting duct) (Fig. 2) and included both AQP2-positive and
AQP2-negative cells.
Finally, recombination in the gastrointestinal tract was
characterized (Fig. 3). These studies
also revealed segmental heterogeneity of epithelial recombination,
demonstrating widespread induction of
-galactosidase activity in
gastric epithelium but only sporadic
-galactosidase activity in
duodenum and colonic epithelium. In contrast, abundant
-galactosidase activity was evident in the submucosal interstitium
and vascular endothelium in these regions of the aerodigestive tract.
|
| |
DISCUSSION |
|---|
|
|
|---|
The generation of mosaic knockout mice with temporally regulated
or cell-specific promoters driving Cre recombinase expression provides
a novel and direct approach to study gene function, allowing for the
selective control of gene expression in kidney and other tissues. The
present studies defined the spatial pattern of genetic recombination
mediated by the temporally regulated Mx1Cre transgene. Induction of this transgene in adult mice (by injection with pI-pC) resulted in Cre-mediated recombination in a variety of
organs, including liver, spleen, kidney, lung, gastric epithelium, and endothelial cells in brain, uterus, and intestine. Mx1
induction of Cre-mediated recombination in the liver, as
reflected by
-galactosidase activity, was particularly efficient,
approximating 100%. Because no
-galactosidase activity was detected
in liver (or any other tissue) obtained from saline-injected controls,
we conclude that baseline and endogenous activation of the
Mx1 transgene is tightly regulated and normally insufficient
to cause recombination in these tissues at any point in their development.
The Mx1 gene was originally discovered as a mouse influenza virus resistance locus. Mx1 proteins are ubiquitous and abundant stable cytoplasmic proteins that can be detected for several days after IFN induction in mice and in humans (where Mx1 gene homologs have been found) (1). Although a high level of Mx1 gene activity in cells of the immune system might be expected, our studies additionally show that the Cre transgene, driven by a 2.3-kb fragment containing the Mx1 promoter, results in IFN-inducible gene expression in a diverse set of cells outside of the classic immune system.
Mx1Cre-driven recombination was spatially restricted in several other organs, including spleen (where recombination was inefficient in the follicles) and aorta (where recombination appears to be restricted to stromal and smooth muscle cells). Interestingly, epithelial recombination appeared heterogenous in the gastrointestinal tract, where it was robust in stomach but essentially absent in duodenum and colon. Similarly, epithelial recombination in kidney was heterogenous and predominated in the collecting duct. Staining with AQP2 antibodies suggests variable efficiency of recombination in both intercalated cells (AQP2 negative) and principal cells (AQP2 positive). No recombination was detected in DCT cells (TSC1 positive). Efficient Mx1-driven, Cre-mediated recombination was also evident in glomeruli and renal endothelium.
Because the
-galactosidase knocked into the endogenous ROSA26 allele
(i.e., without the preceding floxed stop sequence) is widely and
efficiently expressed in all tissues (22), we interpret the restricted recombination as reflecting differential induction of
the Mx1-driven Cre expression in the constituent
cells. Although it is possible that these cells are exposed to
different levels of local IFN production stimulated by pI-pC, this
seems unlikely because previous studies found similar recombination
efficiency whether pI-pC was used to induce endogenous IFN or exogenous
IFN was administered (10). Rather, different levels of
Cre expression, in these various cell types and tissues,
appear more consistent with the available data. For instance, the
predominant recombination in the renal collecting duct corresponds with
a recent report that endogenous Mx1 protein expression in humans
predominates in distal tubule and collecting ducts in human kidney
(5).
Although studies of mice with inducible Cre transgene have
been published (10, 20), reports of the heterogeneity of
cells exhibiting inducible gene targeting within the discrete tissues has not previously been reported. Other groups have shown noninducible segment-specific gene targeting by using renal-specific promoters including
-glutamyl transferase (16) or a kidney
androgen-regulated protein (KAP) promoter, exclusively targeting
proximal tubule cells (4). Use of the KAP promoter fused
to the human angiotensinogen gene confers constitutive expression in
proximal tubule cells of male mice. Because the KAP promoter is
androgen regulated, Cre expression is only detected in
kidneys of female mice after exogenous testosterone. Extrarenal
expression of the KAP-driven transgene appears to be limited to
epidydimus in male mice (4). Conversely, the AQP2 promoter
specifically targets principal cells in the collecting duct
(12). No gender dependence of renal AQP2 transgene
expression was reported; however, extrarenal expression was found in
the vas deferens and the testis in male mice (12). Gender
differences in the production and action of the Mx1 gene have not been reported and would not be predicted because of similar response to viral infection in male and female mice. Furthermore, in
contrast to these other transgenes, the Mx1Cre mouse allows for temporal control of gene disruption not only in collecting duct but
also in endothelium and glomeruli as well.
In summary, the present studies demonstrate that efficient temporally regulated and spatially restricted gene targeting in the kidney can be achieved by using the Mx1Cre/loxP transgenes. This transgene should be particularly useful for deleting floxed alleles of genes highly expressed in vascular endothelium, glomerulus, and collecting duct. In contrast, the Mx1Cre transgene does not appear to be suitable for genetic targeting of cells in the proximal tubule. These transgenic mice should also be useful in achieving temporal control of gene-mediated deletion in the spleen, liver, and gastric epithelium.
| |
ACKNOWLEDGEMENTS |
|---|
Support for this project was provided by the Deutsche Forschungsgemeinschaft (DFG Schn 581/2-1; A. Schneider), an American Heart Association TN affiliate award (Y. Guan), National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-38226 (M. D. Breyer), and a Veterans Administration Merit Award (M. D. Breyer). Infrastructural support was provided by National Cancer Institute award P30 CA68485.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: M. D. Breyer, Div. of Nephrology, S-3223 MCN, Vanderbilt Univ. Medical Ctr., Nashville, TN 37232-2372 (E-mail: matthew.breyer{at}vanderbilt.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published October 22, 2002;10.1152/ajprenal.00235.2002
Received 24 January 2002; accepted in final form 30 September 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arnheiter, H,
Skuntz S,
Noteborn M,
Chang S,
and
Meier E.
Transgenic mice with intracellular immunity to influenza virus.
Cell
62:
51-61,
1990[ISI][Medline].
2.
Ave, P,
Colucci-Guyon E,
Babinet C,
and
Huerre MR.
An improved method to detect beta-galactosidase activity in transgenic mice: a post-staining procedure on paraffin embedded tissue sections.
Transgenic Res
6:
37-40,
1997[ISI][Medline].
3.
Betz, U,
Block W,
van den Broek M,
Yoshida K,
Taga T,
Kishimoto T,
Addicks K,
Rajewsky K,
and
Müller W.
Postnatally induced inactivation of gp130 in mice results in neurological, cardiac, hematopoietic, immunological, hepatic and pulmonary defects.
J Exp Med
188:
1955-1965,
1998
4.
Ding, Y,
Davisson RL,
Hardy DO,
Zhu LJ,
Merrill DC,
Catterall JF,
and
Sigmund CD.
The kidney androgen-regulated protein promoter confers renal proximal tubule cell-specific and highly androgen-responsive expression on the human angiotensinogen gene in transgenic mice.
J Biol Chem
272:
28142-28148,
1997
5.
Floege, J,
Burg M,
Al Masri AN,
Grone HJ,
and
von Wussow P.
Expression of interferon-inducible Mx-proteins in patients with IgA nephropathy or Henoch-Schonlein purpura.
Am J Kidney Dis
33:
434-440,
1999[ISI].
6.
Hayashi, M,
Sasaki S,
Tsuganezawa H,
Monkawa T,
Kitajima W,
Konishi K,
Fushimi K,
Marumo F,
and
Saruta T.
Role of vasopressin V2 receptor in acute regulation of aquaporin-2.
Kidney Blood Press Res
19:
32-37,
1996[ISI][Medline].
7.
Horisberger, MA,
and
De Staritzky K.
Expression and stability of the Mx protein in different tissues of mice, in response to interferon inducers or to influenza virus infection.
J Interferon Res
9:
583-590,
1989[ISI][Medline].
8.
Hoyer, JR,
Sisson SP,
and
Vernier RL.
Tamm-Horsfall glycoprotein: ultrastructural immunoperoxidase localization in rat kidney.
Lab Invest
41:
168-173,
1979[ISI].
9.
Kim, GH,
Masilamani S,
Turner R,
Mitchell C,
Wade JB,
and
Knepper MA.
The thiazide-sensitive Na-Cl cotransporter is an aldosterone-induced protein.
Proc Natl Acad Sci USA
95:
14552-14557,
1998
10.
Kuhn, R,
Schwenk F,
Aguet M,
and
Rajewsky K.
Inducible gene targeting in mice.
Science
269:
1427-1429,
1995
11.
Laitinen, L,
Virtanen I,
and
Saxen L.
Changes in the glycosylation pattern during embryonic development of mouse kidney as revealed with lectin conjugates.
J Histochem Cytochem
35:
55-65,
1987[Abstract].
12.
Nelson, RD,
Stricklett P,
Gustafson C,
Stevens A,
Ausiello D,
Brown D,
and
Kohan DE.
Expression of an AQP2 Cre recombinase transgene in kidney and male reproductive system of transgenic mice.
Am J Physiol Cell Physiol
275:
C216-C226,
1998
13.
Robert, B,
St John PL,
and
Abrahamson DR.
Direct visualization of renal vascular morphogenesis in Flk1 heterozygous mutant mice.
Am J Physiol Renal Physiol
275:
F164-F172,
1998
14.
Rohlmann, A,
Gotthardt M,
Hammer RE,
and
Herz J.
Inducible inactivation of hepatic LRP gene by cre-mediated recombination confirms role of LRP in clearance of chylomicron remnants.
J Clin Invest
101:
689-695,
1998[ISI][Medline].
15.
Sauer, B,
and
Henderson N.
Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1.
Proc Natl Acad Sci USA
85:
5166-5170,
1988
16.
Sepulveda, AR,
Huang SL,
Lebovitz RM,
and
Lieberman MW.
A 346-base pair region of the mouse gamma-glutamyl transpeptidase type II promoter contains sufficient cis-acting elements for kidney-restricted expression in transgenic mice.
J Biol Chem
272:
11959-11967,
1997
17.
Soriano, P.
Generalized lacZ expression with the ROSA26 Cre reporter strain.
Nat Genet
21:
70-71,
1999[ISI][Medline].
18.
Stec, DE,
and
Sigmund CD.
Modifiable gene expression in mice: kidney-specific deletion of a target gene via the cre-loxP system.
Exp Nephrol
6:
568-575,
1998[ISI][Medline].
19.
Sternberg, N,
and
Hamilton D.
Bacteriophage P1 site-specific recombination. I. Recombination between loxP sites.
J Mol Biol
150:
467-486,
1981[ISI][Medline].
20.
St-Onge, L,
Furth PA,
and
Gruss P.
Temporal control of the Cre recombinase in transgenic mice by a tetracycline responsive promoter.
Nucleic Acids Res
24:
3875-3877,
1996
21.
Stricklett, PK,
Nelson RD,
and
Kohan DE.
The Cre/loxP system and gene targeting in the kidney.
Am J Physiol Renal Physiol
276:
F651-F657,
1999
22.
Zambrowicz, BP,
Imamoto A,
Fiering S,
Herzenberg LA,
Kerr WG,
and
Soriano P.
Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells.
Proc Natl Acad Sci USA
94:
3789-3794,
1997
23.
Zhu, X,
Cheng J,
Gao J,
Lepor H,
Zhang ZT,
Pak J,
and
Wu XR.
Isolation of mouse THP gene promoter and demonstration of its kidney-specific activity in transgenic mice.
Am J Physiol Renal Physiol
282:
F608-F617,
2002
This article has been cited by other articles:
![]() |
J. M. Salmon, N. J. Slater, M. A. Hall, M. P. McCormack, S. L. Nutt, S. M. Jane, and D. J. Curtis Aberrant mast-cell differentiation in mice lacking the stem-cell leukemia gene Blood, November 15, 2007; 110(10): 3573 - 3581. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Bleuming, X. C. He, L. L. Kodach, J. C. Hardwick, F. A. Koopman, F. J. ten Kate, S. J.H. van Deventer, D. W. Hommes, M. P. Peppelenbosch, G. J. Offerhaus, et al. Bone Morphogenetic Protein Signaling Suppresses Tumorigenesis at Gastric Epithelial Transition Zones in Mice Cancer Res., September 1, 2007; 67(17): 8149 - 8155. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gawlik and S. E. Quaggin Deciphering the Renal Code: Advances in Conditional Gene Targeting Physiology, October 1, 2004; 19(5): 245 - 252. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |