AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 285: F289-F294, 2003. First published April 1, 2003; doi:10.1152/ajprenal.00046.2003
0363-6127/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/F289    most recent
00046.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kudlacek, P. E.
Right arrow Articles by Sansom, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kudlacek, P. E.
Right arrow Articles by Sansom, S. C.

Role of h{beta}1 in activation of human mesangial BK channels by cGMP kinase

Patrick E. Kudlacek, Jennifer L. Pluznick, Rong Ma, Babu Padanilam, and Steven C. Sansom

Department of Physiology and Biophysics, University of Nebraska Medical Center, Omaha, Nebraska 68198-4575

Submitted 4 February 2003 ; accepted in final form 30 March 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In vascular smooth muscle and glomerular mesangial cells, relaxing agents such as nitric oxide and atrial natriuretic peptide activate large-conductance Ca2+-activated K+ channels (BK) via the cGMP kinase pathway. BK are composed of pore-forming {alpha}-subunits, encoded by the slopoke gene (Slo), and one of four cell-specific accessory {beta}-subunits (h{beta}1–4). We used patch-clamp analysis to determine the influence of h{beta}1, h{beta}2, and h{beta}4 on activation of human mesangial BK by cGMP kinase. We found that HEK 293 cells, coexpressing human (h) Slo{alpha} with either h{beta}1 or h{beta}2, contained single BK currents activated by db-cGMP in cell-attached patches. However, recombinant BK were not activated by db-cGMP when hSlo{alpha} was expressed alone or with h{beta}4. DNA-RNA hybridization revealed that mesangial cells contained mRNA for h{beta}1 but not h{beta}2 or h{beta}4. The BK response to db-cGMP was decreased when h{beta}1 antisense but not scrambled oligonucleotides were incorporated into mesangial cells. Western blot analysis showed that h{beta}1 antisense oligonucleotide inhibited the amount of h{beta}1-V5 fusion protein expressed in HEK 293 cells by ~50%. These results show that mesangial cells contain h{beta}1, a BK accessory protein, which confers activation of BK by cGMP kinase.

large-conductance calcium-activated potassium channels; maxi-potassium; human {beta}-subunit; antisense; patch clamp; guanosine 3',5'-cyclic monophosphate


LARGE, CA2+-ACTIVATED K+ CHANNELS (BK) are present in a variety of cell types and have been studied in the uterus (35), brain (22, 24, 25), and smooth muscle cells of various vascular beds (8, 19, 21, 26, 32, 34). Our laboratory has previously described BK in human mesangial cells (29), smooth muscle-like cells of the renal glomeruli that participate in regulating the rate of filtration (3, 14, 15). In mesangial cells (30, 31) and vascular smooth muscle (2, 26, 34), BK are activated by nitric oxide and atrial natriuretic peptide via the cGMP kinase second messenger system. On activation of BK, the membrane potential hyperpolarizes, thereby reducing the entry of Ca2+ through voltage-gated Ca2+ channels. By preventing an influx of Ca2+ and lowering the concentration of intracellular Ca2+, smooth muscle cells are less responsive to a contractile agonist. Thus activation of BK by cGMP kinase contributes to an increased glomerular filtration rate, vascular dilation, or the relaxation of tracheal and uterine smooth muscle.

The structure of BK includes four identical pore-forming {alpha}- and accessory {beta}-subunits. The slopoke gene (Slo) {alpha}-subunits are present without {beta}-subunits in endothelial cells (20) where they retain qualitatively typical Ca2+/voltage-dependent gating properties. At least four {beta}-subunits associated with Slo{alpha} have been described. It is thought that the variety of {beta}-subunits can explain much of the well-described functional diversity of BK.

Type 1 of the human {beta}-subunit of the BK channel encoded by Slo (h{beta}1) is found predominantly in smooth muscle where it enhances Ca2+ and voltage sensitivity (5). The physiological significance of the h{beta}1-subunit at the integrative level was demonstrated by Brenner et al. (6), who developed a {beta}1 knockout mouse that possessed a hypertensive phenotype. This hypertensive model supported the notion that BK is a negative feedback regulator of smooth muscle contraction and is consistent with the role of {beta}1 to enhance the Ca2+ sensitivity of BK.

Although the h{beta}2-subunit contains an additional inactivating protein extension, the h{beta}1- and h{beta}2-subunits confer similar functional properties to hSlo{alpha} (5). Moreover, h{beta}1 and h{beta}2 are the most similar of the four {beta}-subunits, having 66% protein conservation and similar membrane-spanning topology (5). The h{beta}3- and h{beta}4-subunits have similar membrane-spanning topology to h{beta}1 and h{beta}2 but are structurally and functionally different. h{beta}3, With four known isoforms, has a widespread tissue distribution, with h{beta}3c and h{beta}3d highly expressed in the pancreas and testes, respectively (33). h{beta}4 Is primarily contained in nerve terminals where it decreases Ca2+ sensitivity of BK and enhances neurotransmitter secretion (4). Interestingly, cGMP kinase activates BK in vascular smooth muscle and mesangial cells. However, cAMP kinase predominantly activates BK in rat brain (25). Thus the specific BK {beta}-subunits may confer different regulatory properties on hSlo{alpha} as demanded by the specialized function of the cell.

In the present study, we tested the hypothesis that the mesangial BK contains the h{beta}1-subunit, which permits activation of BK by cGMP kinase. The association of a specific h{beta}-subunit with hSlo{alpha} may partially explain the tissue-specific activation of BK by cGMP kinase.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid construction. The cDNA for hslo{alpha} (accession nos. U09384 [GenBank] and U02632 [GenBank] ), a generous gift from Richard Aldrich, was originally present in the pBluescript KS(+/–) expression vector. The expression vector chosen for most of these experiments was pEGFP-C1 (Clontech Laboratories, Palo Alto, CA), which encodes a green fluorescent protein (GFP) that had been optimized for expression in mammalian cells. GFP and hslo{alpha} contain 239 and 1,142 amino acid residues, respectively. The hSlo{alpha}/pBluescript plasmid and the pEGFP-C1 expression vector were digested with HindIII and BamHI restriction enzymes. The desired HindIII/BamHI restriction enzyme-digested nucleotide fragments of hSlo{alpha} and pEGFP-C1 were isolated and purified using a Prep-A-Gene DNA purification kit (Bio-Rad Laboratories), and the hSlo{alpha} cDNA was ligated in-frame into pEGFP-C1 in the presence of T4 DNA ligase. The resulting plasmids were transformed into DH5{alpha} Escherichia coli and plated on rich broth agar with 30 mg/ml kanamycin. Isolated colonies were analyzed by restriction enzyme analysis to confirm their sequence. The plasmids were proliferated in E. coli, the cells were lysed, and the plasmids were purified with an anion-exchange resin and alcohol precipitation (Qiagen, Valencia, CA).

The cDNAs of h{beta}-subunits were placed in similar expression vectors for cotransfection into HEK 293 cells. h{beta}2 And h{beta}4 were expressed in the absence of a fluorescent protein, whereas h{beta}1 was in the pTracer-CMV2 expression vector (Invitrogen, Carlsbad, CA) with the expressed GFP separated from the h{beta}1 protein. In some experiments, h{beta}1 cDNA was present in the pcDNA3.1/GeneStorm expression vector (Invitrogen) fused with a V5 epitope.

Transfection of plasmids into HEK 293 cells. HEK 293 cells were plated on 35-mm petri dishes in 10% FBS plus DMEM (pH = 7.2) supplemented with penicillin (100 U/ml), L-glutamine (2.0 mM), sodium bicarbonate (0.375%), HEPES (10 mM), and pyruvic acid (1.0 mM) and incubated overnight at 37°C in the presence of 5% CO2. After a rinse with DMEM, a solution of 1.0 ml DMEM containing 1.0 µg of the plasmid and 1.7 µl of Lipofectamine Plus reagent with 2.5 µl Lipofectamine was applied to each petri dish of cells. The cells were incubated for 3 h at 37°C in the presence of 5% CO2. DMEM (1.0 ml) containing antibiotics and FBS (20%) were added to each dish, and the cells were incubated for an additional 24–72 h.

Patch-clamp procedure. Single-channel analysis was performed at 23°C using standard patch-clamp techniques (11, 29). Experiments were performed with the pipette attached to the membrane (cell attached). The pipette solution contained (in mM) 140 KCl, 1.0 CaCl2, 2.0 MgCl2, 1.4 EGTA, and 10 mM HEPES (pH = 7.4) and the bath solution contained (in mM) 135 KCl, 5.0 KCl2, 2.0 MgCl2, 1.0 CaCl2, and 10 HEPES (pH = 7.4).

The patch pipette, partially filled with solution, was in contact with a Ag-AgCl wire on a polycarbonate holder connected to the head stage of a patch-clamp apparatus (501A; Warner Instrument, Hamden, CT). The pipette was lowered on the cell membrane, and suction was applied to obtain a high-resistance (>5G{Omega}) seal. The unitary current, defined as zero for the closed state, was determined as the mean of the best-fit Gaussian distribution of the amplitude histograms. Channels were considered in an open state when the total current (I) was >(n1/2)I and <(n + 1/2)I, with n as the maximum number of observed current levels. The open probability (Po) was defined as the percent time spent in an open state divided by the total time of the analyzed record. The number of channels in a patch was determined by maximally stimulating BK with depolarizing potentials in excised patches. The Axoscope acquisition program and pClamp program set 6.02 (Axon Instruments, Foster City, CA) were used to record and analyze currents.

Mesangial cell cultures. As previously described (12, 29), cultured human mesangial cells were subpassaged from generations 5–10 in DMEM supplemented with 10 mM HEPES, 2.0 mM glutamine, 0.66 U/ml insulin, 1.0 mM sodium pyruvate, 0.1 mM nonessential amino acids, 100 U/ml penicillin, 100 µg/ml streptomycin, and 20% FBS. On reaching confluency, cells were passed on 22 x 22 1-mm cover glasses (Fisher, Pittsburgh, PA), cultured at 37°C in 5.0% CO2, and inserted in a perfusion chamber (23°C; Warner RC-2OH) for patch-clamp experiments.

DNA-RNA hybridization. Mesangial cell RNA was extracted by the guanidinium thiocyanate method previously described (9). In brief, cultured mesangial cells were exposed to 1.0 ml TriReagent as detailed by the manufacturer (Molecular Research Center, Cincinnati, OH). The total RNA was isolated, washed, and suspended in sterile H2O.

PCR products were generated from h{beta} cDNAs by previously described methods (16) using the following sequence-specific primers: h{beta}1, CTTTGCCTGGGTGTAACCAT, CCAGGATGGACAGGTACTGG; h{beta}2, GTTTATATGGACCAGTGGCCGG, CTATTGATCCGTTGGATCCTCTCAC; and h{beta}4, GCTCCGGGTGGCTTACGAGTACACGGAAG, GTCCTCTGGTCTCTGATGCTG. PCR fragments of h{beta}1, h{beta}2, and h{beta}4 were blotted on a Zeta-Probe membrane using a Bio-Dot SF Microfiltration Apparatus (Bio-Rad Laboratories, Hercules, CA). All PCR products were approximately the same concentration determined by ethidium bromide staining of an agarose gel. After DNA blotting, an AlkPhos Direct kit (Amersham Pharmacia Biotech, Piscataway, NJ) was used to prehybridize the blotted membrane, label a human mesangial cell RNA probe, hybridize the labeled probe, and wash the membrane. Along with the experimental samples, the same solution in the absence of DNA was used as a control. CDP-Star was used to generate and detect a chemiluminescent signal (Amersham Pharmacia Biotech). The manufacturer protocols were followed with the exception of performing all hybridization washes at 50°C. A signal was detected after exposure to film for 2 h.

Antisense procedures. In some experiments, cultured mesangial cells were incubated in 2.5 nM phosphorothioate-modified h{beta}1 antisense mRNA primers (5'-CATCACCAGCTTCTTCACCAT) and a control scrambled sequence (5'-ATGTTCATCAAGGCCTACAGG) for 24–72 h before experimentation. Because of the nucleotide sequence similarities between h{beta}1 and h{beta}2, we tested the efficiency of the antisense oligonucleotide with the h{beta}1 cDNA fused to the nucleotide sequences encoding for a V5 epitope. This vector was transfected into HEK 293 cells and incubated in the presence or absence of the h{beta}1 antisense primer (2.5 nM) for 72 h. The expression of the h{beta}1-V5 epitope fusion protein (in the pcDNA3.1 GeneStorm expression vector; Invitrogen) was detected by immunoblotting. The transfected cells were collected and homogenized for 30 s with a Multi-Gen7 generator (ProScientific, Oxford, CT). Protein concentration was assayed using Protein Assay Dye (Bio-Rad) according to the instructions of the manufacturer. Equal amounts of protein (20 µg) were boiled for 3 min in Laemmli sample buffer, applied to a 12.5% polyacrylamide gel (precast; Bio-Rad), electrophoresed, and then transferred to a polyvinylidene difluoride nitrocellulose membrane. The membrane was blocked overnight at 4°C in 5% milk and then exposed overnight at 4°C to a V5-specific antibody conjugated to alkaline phosphatase (1:2,000; Invitrogen). Bands were visualized using an Amplified Alkaline Phosphatase Immuno-Blot Assay Kit (Bio-Rad).

Data analysis. The effects of cGMP on recombinant hslo{alpha} plus h{beta} and on mesangial cell BK were analyzed by comparing the Po value before and after adding db-cGMP using the paired t-test. Significance between values was established by a P value <0.05. Comparisons between groups were done using ANOVA plus Student-Newman-Keul's test with P < 0.05 considered significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Influence of {beta}-subunits on activation of BK by cGMP kinase. The following experiments determined if one or more of three {beta}-subunits could confer activation of BK by db-cGMP. HEK 293 cells were transfected with plasmids containing the coding sequence for GFP-hSlo{alpha}- and h{beta}-subunits and then cultured for 24–72 h before patch-clamp analysis of the expressed BK in the cell-attached configuration. Transfection efficiency appeared to be >90%, as detected by epifluorescence. The representative current tracings, when hSlo{alpha} was expressed alone or with h{beta}1, h{beta}2, and h{beta}4 in HEK 293 cells, are shown in Fig. 1A. The top set of tracings represents BK currents obtained from expression of only hSlo{alpha} [pipette potential (Vp) = –20 mV]. The Po (1 channel) was initially 0.007 and remained low, at 0.001, after the addition of db-cGMP. The second set of tracings is representative of BK currents obtained by expression of hSlo{alpha} with h{beta}1. The Po (4 channels) was much greater (0.16), likely reflecting the enhancement of BK current when h{beta}1 associates with hSlo{alpha}. On addition of db-cGMP, the Po increased to 0.34. As shown by the third set of representative recordings, when h{beta}2 was expressed with hSlo{alpha}, the addition of db-cGMP increased the Po to 0.39. The bottom set of recordings is representative of the currents obtained when hSlo{alpha} was coexpressed with h{beta}4. In these experiments, the addition of db-cGMP did not affect the Po (from 0.01 to 0.005; 1 channel) of BK.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Representative current tracings (A) and summary bar graphs (B) showing the effects of adding db-cGMP on the open probability (Po) of large-conductance Ca2+-activated K+ (BK) channels in cell-attached patches of HEK 293 cells expressing the human (h) slopoke gene (hSlo{alpha}) alone and hSlo{alpha} with h{beta}1, h{beta}2, and h{beta}4. A: Po of BK increased in the presence of db-cGMP when hSlo{alpha} was expressed with h{beta}1 and h{beta}2 (middle) but not when expressed alone (top) or with h{beta}4 (bottom). Arrows indicate the closed state. B: summary of the db-cGMP-evoked mean change in Po ({Delta}Po) when hSlo{alpha} (n = 5 experiments), hSlo{alpha}/h{beta}1 (n = 7), hSlo{alpha}/h{beta}2 (n = 5), and hSlo{alpha}/h{beta}4 (n = 7) were expressed. *P < 0.05 compared with hSlo{alpha} using ANOVA plus the Student-Newman-Keul's test.

 

The bar graphs in Fig. 1B summarize the effects of db-cGMP on single BK currents (cell attached) in HEK 293 cells expressing hSlo{alpha} alone or hSlo{alpha} with h{beta}1, h{beta}2, and h{beta}4. When hSlo{alpha} alone was expressed, the Po decreased slightly, but not significantly [change in ({Delta}) Po = –0.06 ± 0.03; n = 5], on addition of db-cGMP. When hSlo{alpha} was coexpressed with h{beta}1 or h{beta}2, the addition of db-cGMP increased Po significantly by 0.23 ± 0.11 (n = 7) and 0.21 ± 0.03 (n = 5), respectively. When hSlo{alpha} was coexpressed with h{beta}4, the Po of BK was not affected significantly (–0.01 ± 0.01, n = 7) by the addition of db-cGMP. These results show that either h{beta}1 or h{beta}2, but not h{beta}4, can confer activation of BK-hSlo{alpha} by db-cGMP.

Identification of the h{beta}-isoform in human mesangial cells. The previous experiments showed that db-cGMP activated BK current in HEK 293 cells only when hSlo{alpha} was coexpressed with h{beta}1 or h{beta}2. We employed DNA-RNA hybridization methods to determine which {beta}-subunit is present in human mesangial cells. Specific DNA for h{beta}1, h{beta}2, and h{beta}4 was generated using nucleotide primers (Fig. 2A). As shown in Fig. 2B, hybridization of mesangial cell RNA to PCR-generated DNA (designed for different regions of the h{beta}-subunits) under optimized conditions confirmed the presence of RNA for h{beta}1 but not h{beta}2 or h{beta}4. These results suggest that h{beta}1 is present and could be associated with the hSlo{alpha} component of the mesangial BK.



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 2. A: ethidium bromide-stained agarose gel of equal amounts of PCR-generated products used for DNA-RNA hybridization experiments. Lane 1, DNA standard; lane 2, h{beta}1 PCR product; lane 3, h{beta}2 PCR product; lane 4, h{beta}4 PCR product. B: hybridization of human mesangial cell RNA to h{beta}1 (but not h{beta}2 and h{beta}4) PCR-generated DNA on a Zeta-Probe membrane.

 

Effect of h{beta}1 antisense oligonucleotides on activation of mesangial BK by cGMP. It was previously shown that db-cGMP activated BK in cell-attached patches of cultured human mesangial cells (30, 31). Phosphorothioated modified antisense oligonucleotides, complimentary to the h{beta}1 initiation coding sequence, were used to determine if h{beta}1 was necessary for activation of BK by db-cGMP. As shown in Fig. 3A, incubation of mesangial cells with h{beta}1 antisense oligonucleotides nearly eliminated the activation of BK by db-cGMP (–Vp = –20 mV). This effect is shown in the recordings of BK currents (cell attached) in a control cell (no antisense) in Fig. 3A. The addition of db-cGMP to the bathing solution increased Po from 0.53 to 0.83 ({Delta}Po = 0.30). As shown in Fig. 3A, middle, in the presence of the specific anti-h{beta}1 oligonucleotide, db-cGMP increased the Po from 0.14 to only 0.25 ({Delta}Po = 0.11). In the presence of scrambled oligonucleotides, db-cGMP activated BK from 0.21 to 0.42 (Fig. 3A, bottom; {Delta}Po = 0.21). As revealed in the tracings, there was considerable variability in the baseline Po values for BK. Therefore, the mean basal Po values (before cGMP) were not significantly different between any of the treatment groups (P > 0.3), and no conclusions could be made regarding differences in baseline activity. However, differences were apparent when changes in BK activity were determined (before and after db-cGMP addition). As shown in Fig. 3B, db-cGMP activated (control) mesangial BK significantly ({Delta}Po = 0.31 ± 0.02, n = 5). In the presence of the h{beta}1 antisense oligonucleotides, db-cGMP did not significantly affect BK activity ({Delta}Po = 0.06 ± 0.04, n = 4). However, db-cGMP activated BK in the presence of the scrambled oligonucleotides ({Delta}Po = 0.21 ± 0.06, n = 5).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3. A: representative current tracings (cell attached) demonstrating the effects of db-cGMP on BK from mesangial cells cultured in normal growth media, media with h{beta}1 antisense, or media containing scrambled oligonucleotide phosphothioate-modified primer. db-cGMP activated mesangial BK in normal media (top) and when mesangial cells were treated with scrambled oligonucleotides (bottom). h{beta}1 Antisense oligonucleotides effectively silenced the activation of BK by db-cGMP. Arrows denote the closed state. B: summary of db-cGMP-evoked mean {Delta}Po when mesangial cells are incubated in normal media (n = 5), h{beta}1 antisense (n = 4), and scrambled (n = 5) oligonucleotide-treated media. *P < 0.05 compared with control mesangial cells using ANOVA plus the Student-Newman-Keul's test.

 

Western blot analysis was used to determine the effectiveness of the h{beta}1 antisense oligonucleotides on the expression of recombinant h{beta}1. Figure 4 shows a representative Western blot demonstrating the effects of h{beta}1 antisense oligonucleotides (2.5 nM for 72 h) on the expression of recombinant h{beta}1 in HEK 293 cells. In this experiment, h{beta}1 antisense oligonucleotides reduced the expression of h{beta}1 protein by 48%, as determined by densitometry analysis. This experiment was repeated five times with a mean reduction in expression of 49.4 ± 7.6% (n = 5) when the cells were treated with h{beta}1 antisense oligonucleotides.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Effectiveness of h{beta}1 antisense oligonucleotides as determined by immunoblot analysis of recombinant h{beta}1-V5 fusion protein, isolated from the cytosolic fraction after 72 h of incubation with HEK 293 cells. Lane 1, low-molecular-weight prestained standard; lane 2, recombinant h{beta}1-V5 fusion protein at 30 kDa; lane 3, recombinant h{beta}1-V5 fusion protein incubated in the presence of 2.5 nM h{beta}1 antisense oligonucleotide.

 


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The BK channel is phenotypically varied partly because one of the four accessory {beta}-subunits influences the properties of the pore-forming {alpha}-subunit. The goal of the present study was to determine if an accessory {beta}-subunit was necessary for activation of BK by cGMP kinase in human mesangial cells. Both h{beta}1 and h{beta}2 effectively conferred activation of recombinant BK by db-cGMP in HEK 293 cells. However, mesangial RNA hybridized only to h{beta}1-specific DNA and demonstrated no binding to h{beta}2- and h{beta}4-specific DNA. Moreover, h{beta}1 antisense oligonucleotides reduced the db-cGMP activation of BK. We conclude that h{beta}1 is the predominant BK {beta}-subunit in human mesangial cells and has an essential role in the activation of BK by cGMP kinase.

Role of {beta}-subunits in cGMP kinase activation of BK. The revelation that the cGMP kinase pathway activated BK in either the presence of h{beta}1 or h{beta}2 but not h{beta}4 is consistent with findings by Brenner et al. (5), who demonstrated that h{beta}1 and h{beta}2 confer very similar functional properties to hSlo{alpha}. The major difference between h{beta}1 and h{beta}2 is the presence of an additional inactivation ball at the NH2 terminus of the h{beta}2 protein. However, these subunits have similar membrane-spanning topology and, with 65% amino acid homology, are the most closely related in primary protein structure among the h{beta}-subunits. On the other hand, h{beta}4 has only 21 and 26% amino acid homology with h{beta}1 and h{beta}2, respectively (5). The h{beta}3-subunit was not tested for the ability to confer activation of BK by cGMP kinase in this study. However, h{beta}3 also contains a very different primary protein structure compared with h{beta}1 and h{beta}2. Although the expression studies showed that either h{beta}1 or h{beta}2 can confer cGMP-mediated activation of BK, the mechanism is not understood. The h{beta}-subunits may be phosphorylated in this reaction or could alter the phosphorylation/dephosphorylation of the {alpha}-subunit or another protein associated with BK.

Alioua et al. (1) used 32P-radiolabeled ATP to show that PKG directly phosphorylated the hSlo{alpha} subunit. With the use of site-directed mutagenesis, studies have identified specific amino acid sites of PKG phosphorylation (10, 18). One of these studies demonstrated PKG activation of BK expressed with hSlo{alpha} in the presence of h{beta}1 (18). However, another study demonstrated activation of Slo{alpha} in Xenopus oocytes in the absence of an expressed h{beta}-subunit (17). This result is seemingly inconsistent with the present study, which could not demonstrate cGMP kinase activation when only hSlo{alpha} was expressed in HEK 293 cells. However, although HEK 293 cells contain the necessary machinery for cGMP kinase activation of a substrate (3, 13, 23), Xenopus oocytes require the coexpression with cGMP kinase. Overexpression of PKG in Xenopus oocytes in the absence of a {beta}-subunit may have resulted in (nonphysiological) phosphorylation of the Slo{alpha}-subunit. This result would be consistent with the notion that the {beta}-subunit alters the conformation of the Slo{alpha}-subunit to facilitate specific protein kinase phosphorylation.

The absence of the phosphatase limb in the phosphorylation cycle may also explain why both the {alpha}- and {beta}1-subunits were required for activating BK in oocytes. Most kinase phosphorylation reactions are balanced by dephosphorylation reactions that involve protein phosphatases (PP) and protein phosphatase inhibitors (PPI; see Ref. 28). BK are not only modulated by PKG but also by PP, which dephosphorylates and inactivates mesangial BK (7, 27). When cGMP activates BK, a PPI may also be activated, thereby suppressing the dephosphorylation limb of the cycle and ensuring maximal substrate phosphorylation. It is possible that the {beta}-subunit is necessary for the activation of PPI. In this scenario, if Xenopus oocytes do not contain PP and PPI, then merely phosphorylating hSlo{alpha} would enhance the Po of BK. However, HEK 293 cells, which contain the machinery for cGMP kinase (including a PPI and PP), may require the {beta}-subunit for cGMP kinase activation of PPI and inhibition of the PP.

Identification of h{beta}-subunit in mesangial BK. DNA-RNA hybridization revealed mRNA for the h{beta}1-subunit but not the h{beta}2- and h{beta}4-subunits in human mesangial cells. In a previous study, multiple tissue array expression using radiolabeled cDNA revealed high expression of h{beta}1 in tissues containing smooth muscle cells (4). The same study showed that h{beta}2 message was present mostly in endocrine tissue, and h{beta}4 was predominantly in neural tissue (4). It was interesting that h{beta}1 was not highly expressed in the kidney. However, this result may reflect the fact that mesangial cells are a very minute component of the kidney mass. The presence of mRNA for h{beta}1 in mesangial cells reflects the phenotypic similarities between these cells and smooth muscle.

In this investigation, we have determined that the mRNA for h{beta}1 is present in human mesangial cells. The results of this study suggest that h{beta}1 associates with hSlo{alpha} and confers cGMP activation of mesangial BK. In human mesangial cells, the role of the {beta}1-subunit may be to stabilize an intramolecular site within the {alpha}-subunit to facilitate the cGMP kinase-dependent phosphorylation of BK.


    DISCLOSURES
 
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants NIHRO1DK-49561 (to S. C. Sansom) and 1T32HL-0788 (to P. E. Kudlacek and J. L. Pluznick).


    ACKNOWLEDGMENTS
 
We are grateful to Drs. Richard Aldrich and Robert Brenner (Stanford University) for providing cDNAs for hslo{alpha}, h{beta}1-, h{beta}2-, and h{beta}4-subunits.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. C. Sansom, Dept. of Physiology and Biophysics, 984575 Nebraska Medical Center, Omaha, NE 68198-4575 (E-mail: ssansom{at}unmc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alioua A, Tanaka Y, Wallner M, Hofmann F, Ruth P, Meera P, and Toro L. The large conductance, voltage-dependent, and calcium-sensitive K+ channel, Hslo, is a target of cGMP-dependent protein kinase phosphorylation in vivo. J Biol Chem 273: 32950–32956, 1998.[Abstract/Free Full Text]
  2. Archer SL, Huang JMC, Hampl V, Nelson DP, and Shultz PJ. Nitric oxide and cGMP cause vasorelaxation by activation of a charybdotoxin-sensitive K channel by cGMP-dependent protein kinase. Proc Natl Acad Sci USA 91: 7583–7587, 1994.[Abstract/Free Full Text]
  3. Arriba G, Barrio V, Olivera A, Rodriguez-Puyol D, and Lopez-Novoa JM. Atrial natriuretic peptide inhibits angiotensin II-induced contraction of isolated glomeruli and cultured glomerular mesangial cells of rat: the role of calcium. J Lab Clin Med 111: 466–474, 1988.[ISI][Medline]
  4. Behrens R, Nolting A, Reimann F, Schwarz M, Waldschütz R, and Pongs O. HKCNMB3 and hKCNMB4, cloning and characterization of two members of the large-conductance calcium-activated potassium channel {beta} subunit family. FEBS Lett 474: 99–106, 2000.[ISI][Medline]
  5. Brenner R, Jegla TJ, Wickenden A, Liu Y, and Aldrich RW. Cloning and functional characterization of novel large conductance calcium-activated potassium channel beta subunits, hKCNMB3 and hKCNMB4. J Biol Chem 275: 6453–6461, 2000.[Abstract/Free Full Text]
  6. Brenner R, Perez GJ, Bonev AD, Eckman DM, Kosek JC, Wiler SW, Patterson AJ, Nelson MT, and Aldrich RW. Vasoregulation by the beta1 subunit of the calcium-activated potassium channel. Nature 407: 870–876, 2000.[Medline]
  7. Carl A, Kenyon JL, Uemura D, Fusetani N, and Sanders KM. Regulation of Ca2+-activated K+ channels by protein kinase A and phosphatase inhibitors. Am J Physiol Cell Physiol 261: C387–C392, 1991.[Abstract/Free Full Text]
  8. Carrier GO, Fuchs LC, Winecoff AP, Giulumian AD, and White RE. Nitrovasodilators relax mesenteric microvessels by cGMP-induced stimulation of Ca-activated K channels. Am J Physiol Heart Circ Physiol 273: H76–H84, 1997.[Abstract/Free Full Text]
  9. Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.[ISI][Medline]
  10. Fukao M, Mason HS, Britton FC, Kenyon JL, Horowitz B, and Keef KD. Cyclic GMP-dependent protein kinase activates cloned BKCa channels expressed in mammalian cells by direct phosphorylation at serine 1072. J Biol Chem 274: 10927–10935, 1999.[Abstract/Free Full Text]
  11. Hamill OP, Marty A, Neher E, Sackmann B, and Sigworth FJ. Improved patch-clamp techniques for high resolution current recording from cells and cell-free membrane patches. Pflügers Arch 391: 85–100, 1981.[ISI][Medline]
  12. Jaffer F, Saunders C, Shultz P, Throckmorton D, Weinshell E, and Abboud HE. Regulation of mesangial cell growth by polypeptide mitogens. Am J Pathol 135: 261–269, 1989.[Abstract]
  13. Jockers R, Petit L, Lacroix I, deCoppet P, Barrett P, Morgan PJ, Guardiol B, Delagrange P, Marullo S, and Strosberg AD. Novel isoforms of Mellc melatonin receptors modulating intracellular cyclic guanosine 3',5'-monophosphate levels. Mol Endocrinol 11: 1070–1081, 1997.[Abstract/Free Full Text]
  14. Kriz W, Elger M, Lemley K, and Sakai T. Structure of the glomerular mesangium: a biomechanical interpretation. Kidney Int 38: S2–S9, 1990.
  15. Kriz W, Elger M, Mundel P, and Lemley KV. Structure-stabilizing forces in the glomerular tuft. J Am Soc Nephrol 5: 1731–1739, 1995.[Abstract]
  16. Mullis KB and Faloona FA. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 155: 335–350, 1987.[ISI][Medline]
  17. Nara M, Dhulipala PD, Wang YX, and Kotlikoff MI. Reconstitution of beta-adrenergic modulation of large conductance, calcium-activated potassium (maxi-K) channels in Xenopus oocytes: identification of the cAMP-dependent protein kinase phosphorylation site. J Biol Chem 273: 14920–14924, 1998.[Abstract/Free Full Text]
  18. Nara M, Dhulipala PDK, Ji GJ, Kamasani UR, Wang YX, Matalon S, and Kotlikoff MI. Guanylyl cyclase stimulatory coupling to KCa channels. Am J Physiol Cell Physiol 279: C1938–C1945, 2000.[Abstract/Free Full Text]
  19. Onoue H and Katusic ZS. Role of potassium channels in relaxations of canine middle cerebral arteries induced by nitric oxide donors. Stroke 28: 1264–1270, 1997.[Abstract/Free Full Text]
  20. Papassotiriou J, Köhler R, Prenen J, Krause H, Akbar M, Eggermont J, Paul M, Distler A, Nilius B, and Hoyer J. Endothelial K+ channel lacks the Ca2+ sensitivity-regulating {beta} subunit. FASEB J 14: 885–894, 2000.[Abstract/Free Full Text]
  21. Peng W, Hoidal JR, and Farrukh IS. Regulation of Ca2+-activated K+ channels in pulmonary vascular smooth muscle cells: role of nitric oxide. J Appl Physiol 81: 1264–1272, 1996.[Abstract/Free Full Text]
  22. Pozzo-Miller LD, Connor JA, and Andrews SB. Microheterogeneity of calcium signalling in dendrites. J Physiol 525: 53–61, 2000.[Abstract/Free Full Text]
  23. Ramamoorthy S, Giovanetti E, Qian Y, and Blakely RD. Phosphorylation and regulation of antidepressant-sensitive serotonin transporters. J Biol Chem 273: 2458–2466, 1998.[Abstract/Free Full Text]
  24. Reinhart PH, Chung S, and Levitan IB. A family of calcium-dependent potassium channels from rat brain. Neuron 2: 1031–1041, 1989.[ISI][Medline]
  25. Reinhart PH, Chung S, Martin BL, Brautigan DL, and Levitan IB. Modulation of calcium-activated potassium channels from rat brain by protein kinase A and phosphatase 2A. J Neurosci 11: 1627–1635, 1991.[Abstract]
  26. Robertson BE, Schubert R, Hescheler J, and Nelson MT. cGMP-dependent protein kinase activates Ca-activated K channels in cerebral artery smooth muscle cells. Am J Physiol Cell Physiol 265: C299–C303, 1993.[Abstract/Free Full Text]
  27. Sansom SC, Stockand JD, Hall D, and Williams B. Regulation of large calcium-activated potassium channels by protein phosphatase 2A. J Biol Chem 272: 9902–9906, 1997.[Abstract/Free Full Text]
  28. Shenolikar S and Ingebritsen TS. Protein (serine and threonine phosphate phosphatases). In: Methods in Enzymology, edited by Colowick SP and Kaplan NO. New York: Academic, 1989, p. 102–129.
  29. Stockand JD and Sansom SC. Large Ca2+-activated K+ channels responsive to angiotensin II in cultured human mesangial cells. Am J Physiol Cell Physiol 267: C1080–C1086, 1994.[Abstract/Free Full Text]
  30. Stockand JD and Sansom SC. Mechanism of activation by cGMP-dependent protein kinase of large Ca2+-activated K+ channels in mesangial cells. Am J Physiol Cell Physiol 271: C1669–C1677, 1996.[Abstract/Free Full Text]
  31. Stockand JD and Sansom SC. Role of large, Ca-activated K channels in regulation by nitroprusside and ANP of mesangial contraction. Am J Physiol Cell Physiol 270: C1773–C1779, 1996.[Abstract/Free Full Text]
  32. Tanaka Y, Igarashi T, Kaneko H, Yamaki F, Mochizuki Y, Aida M, Taniguchi H, Tanaka H, and Shigenobu K. NO-mediated MaxiK(Ca) channel activation produces relaxation of guinea pig aorta independently of voltage-dependent L-type Ca2+ channels. Gen Pharmacol 34: 159–165, 2000.[ISI][Medline]
  33. Uebele VN, Lagrutta A, Wade T, Figueroa DJ, Liu Y, McKenna E, Austin CP, Bennett PB, and Swanson R. Cloning and functional expression of two families of {beta}-subunits of the large conductance calcium-activated K+ channel. J Biol Chem 275: 23211–23218, 2000.[Abstract/Free Full Text]
  34. Williams DL Jr, Katz GM, Roy-Contancin L, and Reuben JP. Guanosine 5'-monophosphate modulates gating of high-conductance Ca-activated K channels in vascular smooth muscle cells. Proc Natl Acad Sci USA 85: 9360–9364, 1988.[Abstract/Free Full Text]
  35. Zhou X, Schlossmann J, Hofmann F, Ruth P, and Korth M. Regulation of stably expressed and native BK channels from human myometrium by cGMP- and cAMP-dependent protein kinase. Pflügers Arch 436: 725–734, 2000.



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
R. M. Foutz, P. R. Grimm, and S. C. Sansom
Insulin increases the activity of mesangial BK channels through MAPK signaling
Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1465 - F1472.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. R. Grimm, R. M. Foutz, R. Brenner, and S. C. Sansom
Identification and localization of BK-beta subunits in the distal nephron of the mouse kidney
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F350 - F359.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. L. Pluznick and S. C. Sansom
BK channels in the kidney: role in K+ secretion and localization of molecular components
Am J Physiol Renal Physiol, September 1, 2006; 291(3): F517 - F529.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Oelze, A. Warnholtz, J. Faulhaber, P. Wenzel, A. L. Kleschyov, M. Coldewey, U. Hink, O. Pongs, I. Fleming, S. Wassmann, et al.
NADPH Oxidase Accounts for Enhanced Superoxide Production and Impaired Endothelium-Dependent Smooth Muscle Relaxation in BK{beta}1-/- Mice
Arterioscler. Thromb. Vasc. Biol., August 1, 2006; 26(8): 1753 - 1759.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
R. Ma, J. L. Pluznick, and S. C. Sansom
Ion Channels in Mesangial Cells: Function, Malfunction, or Fiction
Physiology, April 1, 2005; 20(2): 102 - 111.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. L. Pluznick, P. Wei, P. R. Grimm, and S. C. Sansom
BK-{beta}1 subunit: immunolocalization in the mammalian connecting tubule and its role in the kaliuretic response to volume expansion
Am J Physiol Renal Physiol, April 1, 2005; 288(4): F846 - F854.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
X. Wang, J. L. Pluznick, P. Wei, B. J. Padanilam, and S. C. Sansom
TRPC4 forms store-operated Ca2+ channels in mouse mesangial cells
Am J Physiol Cell Physiol, August 1, 2004; 287(2): C357 - C364.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/F289    most recent
00046.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kudlacek, P. E.
Right arrow Articles by Sansom, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kudlacek, P. E.
Right arrow Articles by Sansom, S. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.