|
|
||||||||
1 in activation of human mesangial BK channels by cGMP kinase
Department of Physiology and Biophysics, University of Nebraska Medical Center, Omaha, Nebraska 68198-4575
Submitted 4 February 2003 ; accepted in final form 30 March 2003
| ABSTRACT |
|---|
|
|
|---|
-subunits, encoded by
the slopoke gene (Slo), and one of four cell-specific
accessory
-subunits (h
14). We used patch-clamp
analysis to determine the influence of h
1,
h
2, and h
4 on activation of human mesangial
BK by cGMP kinase. We found that HEK 293 cells, coexpressing human (h)
Slo
with either h
1 or h
2,
contained single BK currents activated by db-cGMP in cell-attached patches.
However, recombinant BK were not activated by db-cGMP when
hSlo
was expressed alone or with h
4. DNA-RNA
hybridization revealed that mesangial cells contained mRNA for
h
1 but not h
2 or h
4. The BK
response to db-cGMP was decreased when h
1 antisense but not
scrambled oligonucleotides were incorporated into mesangial cells. Western
blot analysis showed that h
1 antisense oligonucleotide
inhibited the amount of h
1-V5 fusion protein expressed in HEK
293 cells by
50%. These results show that mesangial cells contain
h
1, a BK accessory protein, which confers activation of BK by
cGMP kinase.
large-conductance calcium-activated potassium channels; maxi-potassium; human
-subunit; antisense; patch clamp; guanosine 3',5'-cyclic monophosphate
The structure of BK includes four identical pore-forming
- and
accessory
-subunits. The slopoke gene (Slo)
-subunits are present without
-subunits in endothelial cells
(20) where they retain
qualitatively typical Ca2+/voltage-dependent gating
properties. At least four
-subunits associated with Slo
have been described. It is thought that the variety of
-subunits can
explain much of the well-described functional diversity of BK.
Type 1 of the human
-subunit of the BK channel encoded by
Slo (h
1) is found predominantly in smooth muscle
where it enhances Ca2+ and voltage sensitivity
(5). The physiological
significance of the h
1-subunit at the integrative level was
demonstrated by Brenner et al.
(6), who developed a
1 knockout mouse that possessed a hypertensive phenotype.
This hypertensive model supported the notion that BK is a negative feedback
regulator of smooth muscle contraction and is consistent with the role of
1 to enhance the Ca2+ sensitivity of
BK.
Although the h
2-subunit contains an additional
inactivating protein extension, the h
1- and
h
2-subunits confer similar functional properties to
hSlo
(5).
Moreover, h
1 and h
2 are the most similar of
the four
-subunits, having 66% protein conservation and similar
membrane-spanning topology (5).
The h
3- and h
4-subunits have similar
membrane-spanning topology to h
1 and h
2 but
are structurally and functionally different. h
3, With four
known isoforms, has a widespread tissue distribution, with
h
3c and h
3d highly expressed in the pancreas
and testes, respectively (33).
h
4 Is primarily contained in nerve terminals where it
decreases Ca2+ sensitivity of BK and enhances
neurotransmitter secretion (4).
Interestingly, cGMP kinase activates BK in vascular smooth muscle and
mesangial cells. However, cAMP kinase predominantly activates BK in rat brain
(25). Thus the specific BK
-subunits may confer different regulatory properties on
hSlo
as demanded by the specialized function of the cell.
In the present study, we tested the hypothesis that the mesangial BK
contains the h
1-subunit, which permits activation of BK by
cGMP kinase. The association of a specific h
-subunit with
hSlo
may partially explain the tissue-specific activation of
BK by cGMP kinase.
| METHODS |
|---|
|
|
|---|
(accession
nos. U09384
[GenBank]
and U02632
[GenBank]
), a generous gift from Richard Aldrich, was originally
present in the pBluescript KS(+/) expression vector. The expression
vector chosen for most of these experiments was pEGFP-C1 (Clontech
Laboratories, Palo Alto, CA), which encodes a green fluorescent protein (GFP)
that had been optimized for expression in mammalian cells. GFP and
hslo
contain 239 and 1,142 amino acid residues, respectively.
The hSlo
/pBluescript plasmid and the pEGFP-C1 expression
vector were digested with HindIII and BamHI restriction
enzymes. The desired HindIII/BamHI restriction
enzyme-digested nucleotide fragments of hSlo
and pEGFP-C1 were
isolated and purified using a Prep-A-Gene DNA purification kit (Bio-Rad
Laboratories), and the hSlo
cDNA was ligated in-frame into
pEGFP-C1 in the presence of T4 DNA ligase. The resulting plasmids were
transformed into DH5
Escherichia coli and plated on rich broth
agar with 30 mg/ml kanamycin. Isolated colonies were analyzed by restriction
enzyme analysis to confirm their sequence. The plasmids were proliferated in
E. coli, the cells were lysed, and the plasmids were purified with an
anion-exchange resin and alcohol precipitation (Qiagen, Valencia, CA).
The cDNAs of h
-subunits were placed in similar expression vectors for
cotransfection into HEK 293 cells. h
2 And h
4
were expressed in the absence of a fluorescent protein, whereas
h
1 was in the pTracer-CMV2 expression vector (Invitrogen,
Carlsbad, CA) with the expressed GFP separated from the h
1
protein. In some experiments, h
1 cDNA was present in the
pcDNA3.1/GeneStorm expression vector (Invitrogen) fused with a V5 epitope.
Transfection of plasmids into HEK 293 cells. HEK 293 cells were plated on 35-mm petri dishes in 10% FBS plus DMEM (pH = 7.2) supplemented with penicillin (100 U/ml), L-glutamine (2.0 mM), sodium bicarbonate (0.375%), HEPES (10 mM), and pyruvic acid (1.0 mM) and incubated overnight at 37°C in the presence of 5% CO2. After a rinse with DMEM, a solution of 1.0 ml DMEM containing 1.0 µg of the plasmid and 1.7 µl of Lipofectamine Plus reagent with 2.5 µl Lipofectamine was applied to each petri dish of cells. The cells were incubated for 3 h at 37°C in the presence of 5% CO2. DMEM (1.0 ml) containing antibiotics and FBS (20%) were added to each dish, and the cells were incubated for an additional 2472 h.
Patch-clamp procedure. Single-channel analysis was performed at 23°C using standard patch-clamp techniques (11, 29). Experiments were performed with the pipette attached to the membrane (cell attached). The pipette solution contained (in mM) 140 KCl, 1.0 CaCl2, 2.0 MgCl2, 1.4 EGTA, and 10 mM HEPES (pH = 7.4) and the bath solution contained (in mM) 135 KCl, 5.0 KCl2, 2.0 MgCl2, 1.0 CaCl2, and 10 HEPES (pH = 7.4).
The patch pipette, partially filled with solution, was in contact with a
Ag-AgCl wire on a polycarbonate holder connected to the head stage of a
patch-clamp apparatus (501A; Warner Instrument, Hamden, CT). The pipette was
lowered on the cell membrane, and suction was applied to obtain a
high-resistance (>5G
) seal. The unitary current, defined as zero for
the closed state, was determined as the mean of the best-fit Gaussian
distribution of the amplitude histograms. Channels were considered in an open
state when the total current (I) was >(n
)I and <(n +
)I, with n
as the maximum number of observed current levels. The open probability
(Po) was defined as the percent time spent in an open
state divided by the total time of the analyzed record. The number of channels
in a patch was determined by maximally stimulating BK with depolarizing
potentials in excised patches. The Axoscope acquisition program and pClamp
program set 6.02 (Axon Instruments, Foster City, CA) were used to record and
analyze currents.
Mesangial cell cultures. As previously described (12, 29), cultured human mesangial cells were subpassaged from generations 510 in DMEM supplemented with 10 mM HEPES, 2.0 mM glutamine, 0.66 U/ml insulin, 1.0 mM sodium pyruvate, 0.1 mM nonessential amino acids, 100 U/ml penicillin, 100 µg/ml streptomycin, and 20% FBS. On reaching confluency, cells were passed on 22 x 22 1-mm cover glasses (Fisher, Pittsburgh, PA), cultured at 37°C in 5.0% CO2, and inserted in a perfusion chamber (23°C; Warner RC-2OH) for patch-clamp experiments.
DNA-RNA hybridization. Mesangial cell RNA was extracted by the guanidinium thiocyanate method previously described (9). In brief, cultured mesangial cells were exposed to 1.0 ml TriReagent as detailed by the manufacturer (Molecular Research Center, Cincinnati, OH). The total RNA was isolated, washed, and suspended in sterile H2O.
PCR products were generated from h
cDNAs by previously described
methods (16) using the
following sequence-specific primers: h
1,
CTTTGCCTGGGTGTAACCAT, CCAGGATGGACAGGTACTGG; h
2,
GTTTATATGGACCAGTGGCCGG, CTATTGATCCGTTGGATCCTCTCAC; and h
4,
GCTCCGGGTGGCTTACGAGTACACGGAAG, GTCCTCTGGTCTCTGATGCTG. PCR fragments of
h
1, h
2, and h
4 were blotted
on a Zeta-Probe membrane using a Bio-Dot SF Microfiltration Apparatus (Bio-Rad
Laboratories, Hercules, CA). All PCR products were approximately the same
concentration determined by ethidium bromide staining of an agarose gel. After
DNA blotting, an AlkPhos Direct kit (Amersham Pharmacia Biotech, Piscataway,
NJ) was used to prehybridize the blotted membrane, label a human mesangial
cell RNA probe, hybridize the labeled probe, and wash the membrane. Along with
the experimental samples, the same solution in the absence of DNA was used as
a control. CDP-Star was used to generate and detect a chemiluminescent signal
(Amersham Pharmacia Biotech). The manufacturer protocols were followed with
the exception of performing all hybridization washes at 50°C. A signal was
detected after exposure to film for 2 h.
Antisense procedures. In some experiments, cultured mesangial
cells were incubated in 2.5 nM phosphorothioate-modified h
1
antisense mRNA primers (5'-CATCACCAGCTTCTTCACCAT) and a control
scrambled sequence (5'-ATGTTCATCAAGGCCTACAGG) for 2472 h before
experimentation. Because of the nucleotide sequence similarities between
h
1 and h
2, we tested the efficiency of the
antisense oligonucleotide with the h
1 cDNA fused to the
nucleotide sequences encoding for a V5 epitope. This vector was transfected
into HEK 293 cells and incubated in the presence or absence of the
h
1 antisense primer (2.5 nM) for 72 h. The expression of the
h
1-V5 epitope fusion protein (in the pcDNA3.1 GeneStorm
expression vector; Invitrogen) was detected by immunoblotting. The transfected
cells were collected and homogenized for 30 s with a Multi-Gen7 generator
(ProScientific, Oxford, CT). Protein concentration was assayed using Protein
Assay Dye (Bio-Rad) according to the instructions of the manufacturer. Equal
amounts of protein (20 µg) were boiled for 3 min in Laemmli sample buffer,
applied to a 12.5% polyacrylamide gel (precast; Bio-Rad), electrophoresed, and
then transferred to a polyvinylidene difluoride nitrocellulose membrane. The
membrane was blocked overnight at 4°C in 5% milk and then exposed
overnight at 4°C to a V5-specific antibody conjugated to alkaline
phosphatase (1:2,000; Invitrogen). Bands were visualized using an Amplified
Alkaline Phosphatase Immuno-Blot Assay Kit (Bio-Rad).
Data analysis. The effects of cGMP on recombinant
hslo
plus h
and on mesangial cell BK were analyzed by
comparing the Po value before and after adding db-cGMP
using the paired t-test. Significance between values was established
by a P value <0.05. Comparisons between groups were done using
ANOVA plus Student-Newman-Keul's test with P < 0.05 considered
significant.
| RESULTS |
|---|
|
|
|---|
-subunits on activation of BK by cGMP
kinase. The following experiments determined if one or more of three
-subunits could confer activation of BK by db-cGMP. HEK 293 cells were
transfected with plasmids containing the coding sequence for
GFP-hSlo
- and h
-subunits and then cultured for
2472 h before patch-clamp analysis of the expressed BK in the
cell-attached configuration. Transfection efficiency appeared to be >90%,
as detected by epifluorescence. The representative current tracings, when
hSlo
was expressed alone or with h
1,
h
2, and h
4 in HEK 293 cells, are shown in
Fig. 1A. The
top set of tracings represents BK currents obtained from expression
of only hSlo
[pipette potential (Vp) =
20 mV]. The Po (1 channel) was initially 0.007 and
remained low, at 0.001, after the addition of db-cGMP. The second set of
tracings is representative of BK currents obtained by expression of
hSlo
with h
1. The Po (4
channels) was much greater (0.16), likely reflecting the enhancement of BK
current when h
1 associates with hSlo
. On
addition of db-cGMP, the Po increased to 0.34. As shown by
the third set of representative recordings, when h
2 was
expressed with hSlo
, the addition of db-cGMP increased the
Po to 0.39. The bottom set of recordings is
representative of the currents obtained when hSlo
was
coexpressed with h
4. In these experiments, the addition of
db-cGMP did not affect the Po (from 0.01 to 0.005; 1
channel) of BK.
|
The bar graphs in Fig.
1B summarize the effects of db-cGMP on single BK currents
(cell attached) in HEK 293 cells expressing hSlo
alone or
hSlo
with h
1, h
2, and
h
4. When hSlo
alone was expressed, the
Po decreased slightly, but not significantly [change in
(
) Po = 0.06 ± 0.03; n = 5],
on addition of db-cGMP. When hSlo
was coexpressed with
h
1 or h
2, the addition of db-cGMP increased
Po significantly by 0.23 ± 0.11 (n = 7)
and 0.21 ± 0.03 (n = 5), respectively. When
hSlo
was coexpressed with h
4, the
Po of BK was not affected significantly (0.01
± 0.01, n = 7) by the addition of db-cGMP. These results show
that either h
1 or h
2, but not
h
4, can confer activation of BK-hSlo
by
db-cGMP.
Identification of the h
-isoform in human mesangial
cells. The previous experiments showed that db-cGMP activated BK current
in HEK 293 cells only when hSlo
was coexpressed with
h
1 or h
2. We employed DNA-RNA hybridization
methods to determine which
-subunit is present in human mesangial cells.
Specific DNA for h
1, h
2, and
h
4 was generated using nucleotide primers
(Fig. 2A). As shown in
Fig. 2B, hybridization
of mesangial cell RNA to PCR-generated DNA (designed for different regions of
the h
-subunits) under optimized conditions confirmed the presence of RNA
for h
1 but not h
2 or h
4.
These results suggest that h
1 is present and could be
associated with the hSlo
component of the mesangial BK.
|
Effect of h
1 antisense
oligonucleotides on activation of mesangial BK by cGMP. It was previously
shown that db-cGMP activated BK in cell-attached patches of cultured human
mesangial cells (30,
31). Phosphorothioated
modified antisense oligonucleotides, complimentary to the h
1
initiation coding sequence, were used to determine if h
1 was
necessary for activation of BK by db-cGMP. As shown in
Fig. 3A, incubation of
mesangial cells with h
1 antisense oligonucleotides nearly
eliminated the activation of BK by db-cGMP (Vp =
20 mV). This effect is shown in the recordings of BK currents (cell
attached) in a control cell (no antisense) in
Fig. 3A. The addition
of db-cGMP to the bathing solution increased Po from 0.53
to 0.83 (
Po = 0.30). As shown in
Fig. 3A,
middle, in the presence of the specific anti-h
1
oligonucleotide, db-cGMP increased the Po from 0.14 to
only 0.25 (
Po = 0.11). In the presence of scrambled
oligonucleotides, db-cGMP activated BK from 0.21 to 0.42
(Fig. 3A,
bottom;
Po = 0.21). As revealed in the
tracings, there was considerable variability in the baseline
Po values for BK. Therefore, the mean basal
Po values (before cGMP) were not significantly different
between any of the treatment groups (P > 0.3), and no conclusions
could be made regarding differences in baseline activity. However, differences
were apparent when changes in BK activity were determined (before and after
db-cGMP addition). As shown in Fig.
3B, db-cGMP activated (control) mesangial BK
significantly (
Po = 0.31 ± 0.02, n
= 5). In the presence of the h
1 antisense oligonucleotides,
db-cGMP did not significantly affect BK activity
(
Po = 0.06 ± 0.04, n = 4). However,
db-cGMP activated BK in the presence of the scrambled oligonucleotides
(
Po = 0.21 ± 0.06, n = 5).
|
Western blot analysis was used to determine the effectiveness of the
h
1 antisense oligonucleotides on the expression of
recombinant h
1. Figure
4 shows a representative Western blot demonstrating the effects of
h
1 antisense oligonucleotides (2.5 nM for 72 h) on the
expression of recombinant h
1 in HEK 293 cells. In this
experiment, h
1 antisense oligonucleotides reduced the
expression of h
1 protein by 48%, as determined by
densitometry analysis. This experiment was repeated five times with a mean
reduction in expression of 49.4 ± 7.6% (n = 5) when the cells
were treated with h
1 antisense oligonucleotides.
|
| DISCUSSION |
|---|
|
|
|---|
-subunits influences the properties of the pore-forming
-subunit. The goal of the present study was to determine if an
accessory
-subunit was necessary for activation of BK by cGMP kinase in
human mesangial cells. Both h
1 and h
2
effectively conferred activation of recombinant BK by db-cGMP in HEK 293
cells. However, mesangial RNA hybridized only to h
1-specific
DNA and demonstrated no binding to h
2- and
h
4-specific DNA. Moreover, h
1 antisense
oligonucleotides reduced the db-cGMP activation of BK. We conclude that
h
1 is the predominant BK
-subunit in human mesangial
cells and has an essential role in the activation of BK by cGMP kinase.
Role of
-subunits in cGMP kinase activation of BK.
The revelation that the cGMP kinase pathway activated BK in either the
presence of h
1 or h
2 but not
h
4 is consistent with findings by Brenner et al.
(5), who demonstrated that
h
1 and h
2 confer very similar functional
properties to hSlo
. The major difference between
h
1 and h
2 is the presence of an additional
inactivation ball at the NH2 terminus of the h
2
protein. However, these subunits have similar membrane-spanning topology and,
with 65% amino acid homology, are the most closely related in primary protein
structure among the h
-subunits. On the other hand, h
4
has only 21 and 26% amino acid homology with h
1 and
h
2, respectively
(5). The
h
3-subunit was not tested for the ability to confer
activation of BK by cGMP kinase in this study. However, h
3
also contains a very different primary protein structure compared with
h
1 and h
2. Although the expression studies
showed that either h
1 or h
2 can confer
cGMP-mediated activation of BK, the mechanism is not understood. The
h
-subunits may be phosphorylated in this reaction or could alter the
phosphorylation/dephosphorylation of the
-subunit or another protein
associated with BK.
Alioua et al. (1) used
32P-radiolabeled ATP to show that PKG directly phosphorylated the
hSlo
subunit. With the use of site-directed mutagenesis,
studies have identified specific amino acid sites of PKG phosphorylation
(10,
18). One of these studies
demonstrated PKG activation of BK expressed with hSlo
in the
presence of h
1
(18). However, another study
demonstrated activation of Slo
in Xenopus oocytes in
the absence of an expressed h
-subunit
(17). This result is seemingly
inconsistent with the present study, which could not demonstrate cGMP kinase
activation when only hSlo
was expressed in HEK 293 cells.
However, although HEK 293 cells contain the necessary machinery for cGMP
kinase activation of a substrate
(3,
13,
23), Xenopus oocytes
require the coexpression with cGMP kinase. Overexpression of PKG in
Xenopus oocytes in the absence of a
-subunit may have resulted
in (nonphysiological) phosphorylation of the Slo
-subunit. This
result would be consistent with the notion that the
-subunit alters the
conformation of the Slo
-subunit to facilitate specific protein
kinase phosphorylation.
The absence of the phosphatase limb in the phosphorylation cycle may also
explain why both the
- and
1-subunits were required
for activating BK in oocytes. Most kinase phosphorylation reactions are
balanced by dephosphorylation reactions that involve protein phosphatases (PP)
and protein phosphatase inhibitors (PPI; see Ref.
28). BK are not only modulated
by PKG but also by PP, which dephosphorylates and inactivates mesangial BK
(7,
27). When cGMP activates BK, a
PPI may also be activated, thereby suppressing the dephosphorylation limb of
the cycle and ensuring maximal substrate phosphorylation. It is possible that
the
-subunit is necessary for the activation of PPI. In this scenario,
if Xenopus oocytes do not contain PP and PPI, then merely
phosphorylating hSlo
would enhance the Po
of BK. However, HEK 293 cells, which contain the machinery for cGMP kinase
(including a PPI and PP), may require the
-subunit for cGMP kinase
activation of PPI and inhibition of the PP.
Identification of h
-subunit in mesangial BK.
DNA-RNA hybridization revealed mRNA for the h
1-subunit but
not the h
2- and h
4-subunits in human
mesangial cells. In a previous study, multiple tissue array expression using
radiolabeled cDNA revealed high expression of h
1 in tissues
containing smooth muscle cells
(4). The same study showed that
h
2 message was present mostly in endocrine tissue, and
h
4 was predominantly in neural tissue
(4). It was interesting that
h
1 was not highly expressed in the kidney. However, this
result may reflect the fact that mesangial cells are a very minute component
of the kidney mass. The presence of mRNA for h
1 in mesangial
cells reflects the phenotypic similarities between these cells and smooth
muscle.
In this investigation, we have determined that the mRNA for
h
1 is present in human mesangial cells. The results of this
study suggest that h
1 associates with hSlo
and confers cGMP activation of mesangial BK. In human mesangial cells, the
role of the
1-subunit may be to stabilize an intramolecular
site within the
-subunit to facilitate the cGMP kinase-dependent
phosphorylation of BK.
| DISCLOSURES |
|---|
| ACKNOWLEDGMENTS |
|---|
,
h
1-, h
2-, and
h
4-subunits. | FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
subunit family.
FEBS Lett 474:
99106, 2000.[ISI][Medline]
subunit. FASEB J
14: 885894,
2000.
-subunits of the large conductance calcium-activated K+
channel. J Biol Chem 275:
2321123218, 2000.This article has been cited by other articles:
![]() |
R. M. Foutz, P. R. Grimm, and S. C. Sansom Insulin increases the activity of mesangial BK channels through MAPK signaling Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1465 - F1472. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Grimm, R. M. Foutz, R. Brenner, and S. C. Sansom Identification and localization of BK-beta subunits in the distal nephron of the mouse kidney Am J Physiol Renal Physiol, July 1, 2007; 293(1): F350 - F359. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Pluznick and S. C. Sansom BK channels in the kidney: role in K+ secretion and localization of molecular components Am J Physiol Renal Physiol, September 1, 2006; 291(3): F517 - F529. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oelze, A. Warnholtz, J. Faulhaber, P. Wenzel, A. L. Kleschyov, M. Coldewey, U. Hink, O. Pongs, I. Fleming, S. Wassmann, et al. NADPH Oxidase Accounts for Enhanced Superoxide Production and Impaired Endothelium-Dependent Smooth Muscle Relaxation in BK{beta}1-/- Mice Arterioscler. Thromb. Vasc. Biol., August 1, 2006; 26(8): 1753 - 1759. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ma, J. L. Pluznick, and S. C. Sansom Ion Channels in Mesangial Cells: Function, Malfunction, or Fiction Physiology, April 1, 2005; 20(2): 102 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Pluznick, P. Wei, P. R. Grimm, and S. C. Sansom BK-{beta}1 subunit: immunolocalization in the mammalian connecting tubule and its role in the kaliuretic response to volume expansion Am J Physiol Renal Physiol, April 1, 2005; 288(4): F846 - F854. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, J. L. Pluznick, P. Wei, B. J. Padanilam, and S. C. Sansom TRPC4 forms store-operated Ca2+ channels in mouse mesangial cells Am J Physiol Cell Physiol, August 1, 2004; 287(2): C357 - C364. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |