AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 285: F610-F618, 2003. First published July 15, 2003; doi:10.1152/ajprenal.00101.2003
0363-6127/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/F610    most recent
00101.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (38)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramesh, G.
Right arrow Articles by Reeves, W. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramesh, G.
Right arrow Articles by Reeves, W. B.

TNFR2-mediated apoptosis and necrosis in cisplatin-induced acute renal failure

Ganesan Ramesh and W. Brian Reeves

Division of Nephrology, The Pennsylvania State College of Medicine, Hershey 17033, and Lebanon Veterans Affairs Medical Center, Lebanon, Pennsylvania 17042

Submitted 12 March 2003 ; accepted in final form 9 June 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cisplatin produces acute renal failure in humans and mice. Previous studies have shown that cisplatin upregulates the expression of TNF-{alpha} in mouse kidney and that inhibition of either the release or action of TNF-{alpha} protects the kidney from cisplatin-induced nephrotoxicity. In this study, we examined the effect of cisplatin on the expression of TNF receptors TNFR1 and TNFR2 in the kidney and the role of each receptor in mediating cisplatin nephrotoxicity. Injection of cisplatin into C57BL/6 mice led to an upregulation of TNFR1 and TNFR2 mRNA levels in the kidney. The upregulation of TNFR2 but not TNFR1 was blunted in TNF-{alpha}-deficient mice, indicating ligand-dependent upregulation of TNFR2. To study the roles of each receptor, we administered cisplatin to TNFR1- or TNFR2-deficient mice. TNFR2-deficient mice developed less severe renal dysfunction and showed reduced necrosis and apoptosis and leukocyte infiltration into the kidney compared with either TNFR1-deficient or wild-type mice. Moreover, renal TNF-{alpha} expression, ICAM-1 expression, and serum TNF-{alpha} levels were lower in TNFR2-deficient mice compared with wild-type or TNFR1-deficient mice treated with cisplatin. These results indicate that TNFR2 participates in cisplatin-induced renal injury in mice and may play an important role in TNF-{alpha}-mediated inflammation in the kidney in response to cisplatin.

acute tubular necrosis; gene expression; tumor necrosis factor; tumor necrosis factor receptor; cytokines


CISPLATIN IS A HIGHLY EFFECTIVE antitumor agent used to treat a wide variety of malignancies (28). The key limitation of this chemotherapeutic agent is nephrotoxicity. Approximately 25–35% of patients experience a significant decline in renal function after a single dose of cisplatin (45). Recent evidence indicates that inflammatory mechanisms play an important role in the pathogenesis of cisplatin-induced renal injury. Specifically, several laboratories have demonstrated that TNF-{alpha} pathways are activated in cisplatin injury (15, 23, 44). Indeed, TNF-{alpha} is a central figure in a large network of chemokines and cytokines expressed in the kidney after cisplatin injection (44). Moreover, inhibition of either TNF-{alpha} production or its activity ameliorated cisplatin-induced renal dysfunction and reduced cisplatin-induced structural damage (44). However, the pathway through which TNF-{alpha} mediates its toxicity in cisplatin injury is not known.

TNF-{alpha} is a potent proinflammatory cytokine that plays important roles in chronic inflammation and autoimmune diseases, such as rheumatoid arthritis, autoimmune diabetes, and multiple sclerosis (2, 10). The biological activities of TNF-{alpha} are mediated by two functionally distinct receptors, TNFR1 (p55) and TNFR2 (p75). Many of the cytotoxic and proinflammatory actions of TNF-{alpha} are mediated by TNFR1 (7, 32). TNFR1-deficient mice are resistant to endotoxic shock and show abrogated induction of adhesion molecules by TNF-{alpha} (38, 46). In contrast, TNFR2-deficient mice exhibit only subtle defects (18), and the role of TNFR2 in disease is unclear (9, 11). TNFR2 is thought to cooperate with TNFR1 by passing ligands to TNFR1 (53) or forming heterocomplexes with TNFR1 (40). However, the engagement of TNFR2 by TNF-{alpha} also leads to TNFR1-independent cellular events, including apoptosis of activated T cells (39, 57), thymocyte proliferation (52), and inhibition of early hematopoiesis (55). In this study, we have used TNFR1-, TNFR2-, and TNF-{alpha}-deficient mice to examine the TNF-{alpha} receptor subtype that mediates cisplatin-induced renal injury and the regulation of their expression in response to cisplatin. Our results indicate that TNFR2 expression in the kidney is regulated in a ligand-dependent manner and participates in both necrosis and apoptosis of renal epithelial cells in cisplatin nephrotoxicity.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and drug administration. Experiments were performed on 10- to 12-wk-old male C57BL/6, TNFR1 (C57BL/6-Tnfrs1atm1mak)-, TNFR2 (C57BL/6-Tnfrs1btm1Mwm)-, or TNF-{alpha} (B6;129-Tnftm1 Gkl)-deficient mice weighing ~30 g. Mice were obtained from Jackson Laboratory (Bar Harbor, ME) and maintained on a standard diet, and water was freely available. PCR genotyping was performed on selected animals from each strain to confirm the correct genotype. Cisplatin (Sigma-Aldrich, St. Louis, MO) was dissolved in saline at a concentration of 1 mg/ml. Mice were given a single intraperitoneal injection of either vehicle (saline) or cisplatin (20 mg/kg body wt). This dose of cisplatin produces severe renal failure in mice (44). Animals were killed 72 h after cisplatin injection, and blood and kidney tissues were collected.

Renal function. Renal function was assessed by measurement of urea nitrogen in the serum using a commercially available kit.

Quantitation of mRNA by real-time RT-PCR. Total RNA was isolated from kidneys using the TRIzol reagent. Real-time RT-PCR was performed using the Applied Biosystems 7700 Sequence Detection System. Total RNA (5 µg) was reverse transcribed in a reaction volume of 20 µl using Superscript II reverse transcriptase and random primers. The product was diluted to a volume of 500 µl, and either 2 (actin)- or 10-µl (all others) aliquots were used as templates for amplification using the SYBR green PCR amplification reagent (PE Biosystems, Foster City, CA) and gene-specific primers. The primer sets used were actin (forward: CATGGATGACGATATCGCT; reverse: CATGAGGTAGTCTGTCAGGT); TNF-{alpha} (forward: GCATGATCCGCGACGTGGAA; reverse: AGATCCATGCCGTTG GCCAG); TNFR1 (forward: CCGGGCCACCTGGTCCG; reverse: CAAGTAGGTTCCTTTGTG); TNFR2 (forward: GTCGCGCTGGTCTTCGAACTG; reverse: GGTATACATGCTTGCCTCACAGTC); and ICAM-1 (forward: AGATCACATTCACGGTGCTG; reverse: CTTCAGAGGCAGGAAACAGG).

TNF-{alpha} and soluble TNFR2 quantitation by ELISA. Levels of TNF-{alpha} and soluble TNFR2 in serum were determined using an ELISA assay (Quantikine Mouse TNF-{alpha} and Quantikine Mouse sTNFRII kits, R&D Systems, Minneapolis, MN) according to the manufacturer's instructions.

Western blot analysis. Kidneys were homogenized in PBS, and the protein concentration was quantitated (BCA protein assay reagent, Pierce, Rockford, IL). Samples of protein (100 µg) were separated by 10% SDS-PAGE and then transferred onto a polyvinylidene difluoride membrane. Western blot analysis was performed with an anti-TNFR2 antibody (1: 1,000 dilution, Santa Cruz Biotechnology, Santa Cruz, CA). Proteins were detected using enhanced chemiluminescence detection reagents (Amersham Pharmacia Biotech, Piscataway, NJ).

Histology and immunohistochemistry. Kidney tissue was fixed in buffered formalin for 12 h and then embedded in paraffin wax. Sections (5 µm) were stained with periodic acid-Schiff (PAS) or naphthol AS-D chloroacetate esterase (Sigma kit 91A). The esterase stain identifies infiltrating neutrophils and monocytes. Thirty x40 fields of esterase-stained sections of kidney cortex were examined for quantitation of leukocytes. Tubular injury was assessed in PAS-stained sections using a semiquantitative scale (23, 26, 43) in which the percentage of cortical tubules showing epithelial necrosis was assigned a score: 0 = normal; 1 = <10%; 2 = 10–25%; 3 = 26–75%; and 4 = >75%. Apoptosis was scored by counting the number of apoptotic cells, as defined by chromatin condensation or nuclear fragmentation (apoptotic bodies), on PAS-stained sections of cortex. The individual scoring the slides was blinded to the treatment and strain of the animal.

Statistical methods. All assays were performed in duplicate. The data are reported as means ± SE. Statistical significance was assessed by an unpaired, two-tailed Student t-test for single comparison or ANOVA for multiple comparisons.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cisplatin upregulates TNFR2 in a ligand-dependent manner. TNFR1 is widely expressed relative to the more restricted distribution of TNFR2 (17). The expression of TNFR1 and, in particular, TNFR2, which has NF-{kappa}B and other transcription factor binding sites in its promoter (47), can be altered in disease states. Therefore, we studied the expression of TNFR1 and TNFR2 mRNA in response to cisplatin injection. As shown in Fig. 1, cisplatin increased the expression of TNFR1 about threefold and increased TNFR2 expression six- to ninefold over saline-treated controls in either C57BL/6 or B6;129J mice. To examine whether the upregulation of either TNFR1 or TNFR2 is TNF-{alpha} dependent, receptor mRNA was quantified in cisplatin-treated TNF-{alpha}-deficient mice. The expression of TNFR1 was unaltered between the wild-type mice treated with cisplatin and TNF-{alpha}-deficient mice (Fig. 1). However, the upregulation of TNFR2 mRNA was blunted in TNF-{alpha}-deficient mice. We also examined the effect of cisplatin on kidney TNFR2 protein levels (Fig. 2). As shown in Fig. 2 (top), kidney TNFR2 protein levels were increased by cisplatin, and this increase was blunted in TNF-{alpha}-deficient mice. These results indicate ligand-dependent regulation of TNFR2 in cisplatin nephrotoxicity. As shown in Fig. 2 (bottom), TNFR2 protein was measured in C57BL/6 and TNFR1-deficient and TNFR2-deficient mice. Little or no TNFR2 was detectable in kidneys of saline-treated mice. Consistent with the above results, cisplatin produced a marked increase in TNFR2 content in C57BL/6 mice. Moreover, a similar increase occurred in TNFR1-deficient mice. As expected, no TNFR2 protein was present in the TNFR2-deficient kidneys. These results confirm that TNFR2 expression is increased in cisplatin-treated kidneys and indicate that the upregulation is not mediated via TNFR1.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. Regulation of renal tumor necrosis factor (TNF) receptor (TNFR1 and TNFR2) expression by cisplatin. C57BL/6, B6;129J, or TNF-{alpha}-deficient (TNF-KO) mice were injected with cisplatin (20 mg/kg body wt). Kidneys were harvested 72 h after injection, and levels of TNFR1 (hatched bars) and TNFR2 (solid bars) mRNA were determined by RT-PCR as described in MATERIALS AND METHODS. Cisplatin increased the levels of both TNFR1 and TNFR2 mRNA. The increase in TNFR2 mRNA was blunted in TNF-{alpha}-deficient mice. *P < 0.05 vs. cisplatin-treated B6;129J (n = 3–4/group).

 


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2. Regulation of TNFR2 expression by cisplatin. Mice from each indicated strain were injected with saline or cisplatin and killed after 72 h. The content of TNFR2 in kidneys was determined by Western blot analysis. Top: cisplatin treatment increased the TNFR2 protein content in B6;129 mice. This increase was blunted in TNF-KO mice. Bottom: cisplatin increased TNFR2 protein content in both C57BL/6 and TNFR1-deficient (TNFR1-KO) mice.

 

Serum levels of soluble TNFR2 were measured in wild-type mice and in mice deficient in either TNF-{alpha}, TNFR1, or TNFR2 (Fig. 3). Treatment of mice with cisplatin increased soluble TNFR2 levels in wild-type mice (either B6;129J or C57BL/6 strains) and TNFR1-deficient mice. TNF-{alpha}-deficient mice had lower levels of soluble TNFR2 in the presence or absence of cisplatin. As expected, TNFR2-deficient mice had undetectable levels of soluble TNFR2. These results are also consistent with TNF-{alpha}-dependent regulation of TNFR2 expression.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. Effect of cisplatin injection on soluble TNFR2 in serum. Mice from each indicated strain were injected with either saline or cisplatin (20 mg/kg). Serum was obtained 72 h after injection for measurement of soluble TNFR2 protein. ND, not detectable. Cisplatin increased soluble TNFR2 levels in both B6;129J and C57BL/6 mice (+P < 0.001 vs. saline; n = 3–8). Soluble TNFR2 levels were lower in TNF-KO mice than in B6;129J wild-type mice (*P < 0.001; n = 4).

 

Cisplatin upregulates TNF-{alpha} expression in TNFR1-deficient but not in TNFR2-deficient mice. Cisplatin increases kidney TNF-{alpha} expression and serum TNF-{alpha} levels (15, 23, 44). To determine whether this upregulation is mediated through TNF-{alpha} receptors, we measured TNF-{alpha} mRNA in kidney and TNF-{alpha} protein in the serum of TNFR1- or TNFR2-deficient mice after cisplatin injection. As shown in Fig. 4A, TNFR1-deficient mice showed a similar increase in kidney TNF-{alpha} mRNA as seen in wild-type mice treated with cisplatin. However, the increase was blunted significantly in TNFR2-deficient mice. Similarly, serum TNF-{alpha} protein levels (Fig. 4B) were also significantly lower in TNFR2-deficient mice than in wild-type or TNFR1-deficient mice, suggesting TNFR2-dependent regulation of TNF-{alpha} production in the kidney in response to cisplatin.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. Effect of cisplatin on renal TNF-{alpha} mRNA and serum TNF-{alpha} protein levels. Mice from the indicated strains were injected with either saline (open bars) or cisplatin (filled bars). Kidney and blood were obtained 72 h after injection for measurement of TNF-{alpha} mRNA (A) and TNF-{alpha} protein (B). Cisplatin caused marked elevations in renal TNF-{alpha} mRNA and serum TNF-{alpha} levels in C57BL/6 and TNFR1-KO mice. The levels were significantly lower in TNFR2-deficient (TNFR2-KO) mice. TNF-{alpha} mRNA levels are expressed relative to the levels in saline-injected mice. *P < 0.05 vs. cisplatin-treated C57BL/6 (n = 3 for mRNA and n = 8 for protein measurements).

 

TNFR2-deficient mice are resistant to cisplatin nephrotoxicity. To address the role of TNFR1 and TNFR2 in the pathogenesis of cisplatin-induced acute renal failure, we examined cisplatin nephrotoxicity in mice with targeted deletions of either TNFR1 or TNFR2. As shown in Fig. 5, wild-type and TNFR1-deficient mice developed severe renal failure after injection with cisplatin [72-h urea = 135 ± 7 and 161 ± 14 mg/dl for wild-type (n = 17) and TNFR1-deficient mice (n = 15), respectively, P = not significant (NS)]. In contrast, TNFR2-deficient mice had better preservation of function (72-h urea = 88 ± 8 mg/dl, n = 16, P = 0.015 vs. wild-type). The histological findings also revealed less severe damage in the TNFR2-deficient mice. As shown in Fig. 6, cisplatin treatment of wild-type and TNFR1-deficient mice resulted in severe tubular injury as reflected by cast formation, loss of brush-border membranes, sloughing of tubular epithelial cells, and dilation of tubules. This injury was present throughout the cortex and outer medulla. These changes were minimal in kidneys from TNFR2-deficient mice treated with cisplatin.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. Role of TNFR1 and TNFR2 in cisplatin nephrotoxicity. Mice from each strain were injected with saline or cisplatin (CP). Blood urea nitrogen was measured at the indicated times after injection as a measure of renal function. Cisplatin caused marked elevations of urea in the C57BL/6 and TNFR1-KO mice. TNFR2-KO mice had significantly lower urea levels. *P < 0.015 vs. C57BL/6 (n = 5–7/group).

 


View larger version (133K):
[in this window]
[in a new window]
 
Fig. 6. Kidney histology after cisplatin injection. C57BL/6 (A and D), TNFR1-KO (B and E), or TNFR2-KO (C and F) mice were killed 72 h after cisplatin injection. Kidney cortex from C57BL/6 and TNFR1-KO mice showed extensive histological damage, such as tubular dilation, cast formation (*) and necrosis, and sloughing of renal epithelial cells (arrowheads). Kidneys from TNFR2-KO mice had better preserved morphology. Magnification: x10 (AC); x40 (DF).

 

TNFR2 induces apoptosis and necrosis in cisplatin nephrotoxicity. Cisplatin produces both necrosis and apoptosis of renal epithelial cells in vitro (31, 37). The contribution of necrosis and apoptosis to cisplatin injury in vivo is less clear. Moreover, the contribution of TNFR2 signaling to apoptosis in vivo is not well established. Therefore, we quantitated the extent of cisplatin-induced necrosis and apoptosis in vivo and determined the role of TNF-{alpha} and TNFR1 and TNFR2 in both processes. The results in Fig. 7 show that cisplatin treatment resulted in both necrosis and apoptosis in vivo. Deletion of TNF-{alpha} resulted in a decrease in both necrosis and apoptosis. Deletion of TNFR2 also reduced apoptosis and necrosis, although to a lesser extent than did TNF-{alpha} deletion. Deletion of TNFR1 resulted in a slight reduction in histological necrosis but no decrease in apoptosis.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 7. Role of TNFR2 in cisplatin-induced necrosis and apoptosis. Mice from each indicated strain were injected with either saline or cisplatin and killed 72 h later. Kidneys were harvested and processed for light microscopy. Tubular necrosis (A) and apoptosis (B) were measured using a semiquantitative scoring method. Cisplatin injection produced a large increase in necrosis and apoptosis in B6;129J, C57BL/6, and TNFR1-KO mice. TNF-KO and TNFR2-KO mice sustained less tubular necrosis and less apoptosis than the corresponding wild-type mice. TNFR1-KO mice had less tubular necrosis than but apoptosis equivalent to that in C57BL/6 mice. *P < 0.01 vs. wild-type mice. +P < 0.05 vs. C57BL/6. **P < 0.001 vs. C57BL/6 and P < 0.05 vs. TNFR1-KO.

 

TNFR2 induces leukocyte infiltration and ICAM-1 expression. Cisplatin nephrotoxicity is associated with the infiltration of leukocytes into the kidney and up-regulation of ICAM-1 (15, 23, 44). Inhibition of TNF-{alpha} (44) or ICAM-1 (23) reduces leukocyte infiltration and also lessens cisplatin nephrotoxicity. Accordingly, we examined the dependence of leukocyte infiltration and ICAM-1 expression on the presence of TNFR1 and TNFR2. Leukocyte infiltration was measured using the naphthol AS-D chloroacetate esterase stain. As shown in Fig. 8, in either C57BL/6 or TNFR1-deficient mice, cisplatin injection produced a large increase in leukocytes within the kidney cortex. In contrast, TNFR2 knockout mice had little or no increase in leukocytes.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 8. Role of TNFR1 and TNFR2 in renal neutrophil infiltration. Neutrophils and monocytes were counted in sections of kidney cortex stained with naphol AS-D chloroacetate esterase. Cisplatin-treated C57BL/6 and TNFR1-KO mice had a large number of infiltrating leukocytes. Kidneys from TNFR2-KO mice had fewer infiltrating leukocytes. *P < 0.05 vs. cisplatin-treated C57BL/6 mice (n = 5).

 

A similar pattern was observed for ICAM-1 expression (Fig. 9). Namely, cisplatin increased ICAM-1 expression in wild-type and TNFR1-deficient mice six- to ninefold over saline-treated control mice. In contrast, ICAM-1 expression was significantly blunted in TNFR2-deficient mice compared with wild-type mice (n = 4, P < 0.05).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 9. Role of TNFR2 in renal ICAM-1 expression. ICAM-1 mRNA was measured in kidneys from cisplatin-treated C57BL/6, TNFR1-KO, and TNFR2-KO mice using quantitative RT-PCR. ICAM-1 expression was markedly increased in C57BL/6 mice. Significantly less ICAM-1 expression was seen in TNFR2-KO mice. *P < 0.05 vs. C57BL/6 (n = 3).

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
TNF-{alpha} is a highly pleiotrophic cytokine that plays a role in immune inflammatory response. Intracellular signaling through TNF receptors may lead to apoptosis, cell activation, and/or cell proliferation. Whereas TNFR1 signaling is clearly involved in a number of pathological states (41), the role of TNFR2 in organ pathology is not widely established. Recently, a role for TNF-{alpha} in toxic and ischemic acute renal failure has been recognized (14, 16, 26, 44, 51). The mechanisms whereby TNF-{alpha} mediates acute renal failure are not clear. We used a clinically relevant model of acute renal failure, cisplatin nephrotoxicity, to investigate the TNF-{alpha} signaling pathways during acute renal injury. Several results are noteworthy.

First, we found that the expressions of both TNFR1 and TNFR2 are upregulated after cisplatin injection. This upregulation may serve to sensitize the kidney to the effects of TNF-{alpha}. In this regard, serum levels of TNF-{alpha} in cisplatin nephrotoxicity, although increased (44), are lower than those that occur in some other disorders mediated by TNF-{alpha}, such as sepsis. A dissociation between serum TNF-{alpha} levels and TNFR2 expression has been noted in other settings (1), possibly reflecting a need for high levels of TNFR2 expression to mediate biological actions. In addition, elegant studies by Douni and Kollias (17) and Akassoglou et al. (3) demonstrated that high levels of TNFR2 expression can mediate inflammation in a ligand-independent fashion. We did not directly test for ligand-independent actions of TNFR2 in cisplatin nephrotoxicity. However, the observation that deletion of either TNF-{alpha} (44) or TNFR2 (Fig. 5) results in similar degrees of protection suggests that ligand-independent actions of TNFR2 do not play a major role. Upregulation of kidney TNF receptors has also been reported in kidney transplant rejection (4). Al-Lamki et al. (4) found relatively little expression of TNFR1 and TNFR2 in normal human kidney allografts. During acute transplant rejection, however, the expression of TNFR1 and TNFR2 was increased in areas of lymphocytic infiltration. TNFR2 expression and/or serum levels of soluble TNFR2 are also elevated in a number of inflammatory conditions, including inflammatory bowel diseases (35), sepsis (48), acute respiratory distress syndrome (33), and cerebral malaria (33).

We determined that the upregulation of TNFR2 was dependent, in part, on TNF-{alpha}. TNF-{alpha}, via receptor-interacting protein (RIP), activates I{kappa}B kinase and subsequent NF-{kappa}B transcriptional activity (22). Because the promoter of TNFR2 contains NF-{kappa}B binding sites (47), this pathway is a plausible mechanism to account for the observed TNF-{alpha}-dependent upregulation of TNFR2. Similarly, the expression of TNF-{alpha} was dependent on TNFR2. TNFR2 activation can result in NF-{kappa}B activation (34). The presence of NF-{kappa}B binding sites within the TNF-{alpha} promoter (56), then, provides a mechanism whereby TNF-{alpha} can stimulate its own production via TNFR2. The mechanism for the TNF-{alpha}-independent upregulation of both TNFR1 and TNFR2 is unknown. We have found that cisplatin activates multiple signaling pathways in the kidney, including ERK, JNK, and p38 (preliminary data). It is possible that one or more of these pathways may influence TNF receptor expression. Finally, the actions of TNF-{alpha} in a heterogenous organ like the kidney are likely determined by both the quantity and spatial distribution of TNF receptors. Accordingly, it will be informative to determine the specific sites of TNFR1 and TNFR2 expression in cisplatin nephrotoxicity.

Second, cisplatin-induced tissue injury is mediated, at least in part, via TNFR2. In many pathological states, including some kidney diseases (see below), the actions of TNF-{alpha} are mediated through TNFR1. In other settings, TNFR2 may contribute to tissue injury by enhancing TNFR1-mediated toxicity (40, 53, 55). In contrast, we found that TNFR2, independently of TNFR1, was responsible for cisplatin nephrotoxicity. There was a tendency, although not statistically significant, for renal function to be worse in TNFR1-deficient mice than in wild-type mice, raising the possibility that TNFR1 activation may oppose the cytotoxicity of TNFR2 in this model. Further studies with TNFR1/TNFR2-deficient mice will be needed to examine the interactions between these receptors.

Our finding that TNFR2 mediates acute renal injury expands a small but growing list of disorders in which TNFR2 has been shown to play an important role. For example, TNFR2 is upregulated in intestinal inflammation and TNFR2-deficient mice develop less severe intestinal inflammation (35). TNFR2 also participates in intestinal graft vs. host disease (10) and accelerates the early phase of collagen-induced arthritis (50). The recent report by Akassoglou et al. (3) demonstrated that overexpression of TNFR2, in the absence of TNFR1 and even TNF-{alpha}, induces vascular inflammation and ischemic necrosis in the central nervous system (CNS). Few studies have assigned the actions of TNF-{alpha} to a specific receptor in the kidney. In a model of obstructive uropathy, Guo et al. (21) found that both TNFR1 and TNFR2 contributed to interstitial fibrosis, NF-{kappa}B activation, and TNF-{alpha} expression. Cunningham et al. (13) determined that endotoxin-induced acute renal injury was dependent on intrarenal TNFR1, consistent with the known role of TNFR1 in mediating endotoxic shock (38). There are a number of possible explanations for the differences between our results and the results of Cunningham et al. (13). Injection of endotoxin causes rapid and massive release of TNF-{alpha}, the prime mediator of endotoxic shock. In comparison, TNF-{alpha} secretion in cisplatin nephrotoxicity is much slower and more modest (44). TNFR2 may be more important in cell death induced by low levels of TNF-{alpha} (18). The TNF-{alpha}-dependent induction of TNFR2 expression may also affect the relative importance of TNFR1 and TNFR2 in this model. Moreover, soluble TNF-{alpha} is a more efficient agonist of TNFR1 (20), whereas membrane-bound TNF-{alpha} preferentially activates TNFR2 (19). Accordingly, with endotoxin injection, the high levels of secreted TNF-{alpha} might be expected to act primarily via TNFR1, which has a broader constitutive level of expression than TNFR2, whereas, in cisplatin nephrotoxicity, upregulation of TNFR2 along with local production of TNF-{alpha} may favor TNFR2 pathways.

Third, cisplatin produces both necrotic and apoptotic cell death in vivo, and TNF-{alpha}/TNFR2 signaling contributes to both processes (Fig. 7). Apoptotic signaling has been clearly demonstrated to occur through TNFR1 (6). However, the role of TNFR2, which lacks an intracellular death domain, in apoptosis and inflammation is less clear. TNFR2 can potentiate the proapoptotic effects of TNFR1 activation (55, 57). TNFR2-mediated ubiquitination and degradation of TNF receptor-associated factor 2 may account for this phenomenon (30). TNFR2 may also mediate apoptosis and inflammation independently of TNFR1 (3, 39, 57). In T cells, the ability of TNFR2 to initiate apoptosis in vitro was dependent on high levels of RIP expression (39). However, in vivo demonstrations of TNFR2-dependent apoptosis are lacking. Overexpression of TNFR2 in the CNS, for example, produced vasculitis and necrosis but not apoptosis, whereas TNFR1 expression resulted in apoptosis of oligodendrocytes (3). In cisplatin-induced acute renal failure, we found that TNFR2 mediates, either directly or indirectly, both apoptotic and necrotic death of renal epithelial cells. The relative roles of apoptosis and necrosis in the pathogenesis of renal dysfunction after cisplatin injection are not known. In ischemic injury, recent evidence points to an important role for apoptosis rather than necrosis (24, 25). However, because both necrosis and apoptosis were reduced in TNFR2-deficient mice, our results do not allow any conclusions regarding their relative importance in cisplatin toxicity. Further studies are required to determine whether the cells expressing TNFR2 are the cells that subsequently undergo necrotic or apoptotic death. Similarly, we do not understand the factors that determine whether renal epithelial cells die by necrosis or apoptosis. Intracellular ATP (36) and dGTP concentrations (8) and the concentration of cisplatin to which cells are exposed (31) have all been proposed as cellular determinants of the mode of cell death.

Fourth, TNFR2 plays a role in ICAM-1 expression and leukocyte infiltration in cisplatin acute renal injury. Inflammatory mechanisms are believed to play an important role in the pathogenesis of acute renal failure (42, 49). The inflammatory response is characterized predominantly by an early neutrophil and a late monocyte influx and is preceded by the expression of adhesion molecules, such as ICAM-1, as well as the induction of various chemokines responsible for monocyte and neutrophil migration (29, 44). Renal ICAM-1 expression is increased after either ischemic or toxic (15, 23, 26, 44) renal insults. Blockade of ICAM-1 reduces acute renal injury after ischemia (26) or cisplatin exposure (23). The signals that result in ICAM-1 expression in these settings are unknown. In many systems, induction of ICAM-1 expression occurs via TNFR1 (5, 27, 54). In the kidney, however, Burne et al. (12) demonstrated that ischemia-induced ICAM-1 expression is independent of TNFR1. The dependence on TNFR2 was not examined in that study. Our results indicate that TNFR2 contributes to ICAM-1 upregulation in cisplatin and perhaps other forms of acute renal injury. TNFR2-dependent ICAM-1 expression was also noted in transgenic mice overexpressing TNFR2 in the CNS (3).

In summary, we demonstrated, using TNF-{alpha}- and TNF receptor-deficient mice, that cisplatin-induced renal inflammation, cell death, and organ dysfunction are mediated, in part, through TNFR2. Moreover, the induction of TNF-{alpha} and TNFR2 expression is interdependent. We also demonstrated that both apoptosis and necrosis of renal epithelial cells were dependent on TNFR2. We conclude that TNFR2 may play a greater role in ischemic and toxic organ injury than had been previously appreciated. Antagonism of TNF-{alpha} production or action may have a therapeutic benefit in these settings.


    DISCLOSURES
 
This work was supported by the Veterans Affairs Medical Research Service and grants from the American Heart Association and the Four Diamonds Fund.


    FOOTNOTES
 

Address for reprint requests and other correspondence: W. B. Reeves, Div. of Nephrology, H040, Pennsylvania State College of Medicine, 500 University Dr., Hershey, PA 17033 (E-mail: Wreeves{at}psu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Aderka D, Sorkine P, Abu-Abid S, Lev D, Setton A, Cope AP, Wallach D, and Klausner J. Shedding kinetics of soluble tumor necrosis factor (TNF) receptors after systemic TNF leaking during isolated limb perfusion. Relevance to the pathophysiology of septic shock. J Clin Invest 101: 650–659, 1998.[ISI][Medline]
  2. Aggarwal BB, Samanta A, and Feldmann M. TNF{alpha}. In: Cytokine Reference, edited by Oppenheim JJ and Feldmann M. San Diego, CA: Academic, 2001, p. 413–434.
  3. Akassoglou K, Douni E, Bauer J, Lassmann H, Kollias G, and Probert L. Exclusive tumor necrosis factor (TNF) signaling by the p75TNF receptor triggers inflammatory ischemia in the CNS of transgenic mice. Proc Natl Acad Sci USA 100: 709–714, 2003.[Abstract/Free Full Text]
  4. Al-Lamki R, Wang J, Skepper J, Thiru S, Pober J, and Bradley J. Expression of tumor necrosis factor receptors in normal kidney and rejecting renal transplants. Lab Invest 81: 1503–1515, 2001.[ISI]
  5. Amrani Y, Lazaar AL, Hoffman R, Amin K, Ousmer S, and Panettieri RA Jr. Activation of p55 tumor necrosis factor-alpha receptor-1 coupled to tumor necrosis factor receptor-associated factor 2 stimulates intercellular adhesion molecule-1 expression by modulating a thapsigargin-sensitive pathway in human tracheal smooth muscle cells. Mol Pharmacol 58: 237–245, 2000.[Abstract/Free Full Text]
  6. Ashkenazi A and Dixit VM. Death receptors: signaling and modulation. Science 281: 1305–1308, 1998.[Abstract/Free Full Text]
  7. Barbara JAJ, Smith W, Gamble J, Ostade X, Vandenabelle P, Tavernier J, Fiers W, Vadas M, and Lopez A. Dissociation of TNF-{alpha} cytotoxic and proinflammatory activities by p55 receptor- and p75 receptor-selective TNF-{alpha} mutants. EMBO J 14: 843–850, 1994.
  8. Batiuk TD, Schnizlein-Bick C, Plotkin Z, and Dagher PC. Guanine nucleosides and Jurkat cell death: roles of ATP depletion and accumulation of deoxyribonucleotides. Am J Physiol Cell Physiol 281: C1776–C1784, 2001.[Abstract/Free Full Text]
  9. Baud V and Karin M. Signal transduction by tumor nercrosis factor and its relatives. Trends Cell Biol 11: 372–377, 2001.[ISI][Medline]
  10. Brown GR, Lee E, and Thiele DL. TNF-TNFR2 interactions are critical for the development of intestinal graft-versus-host disease in MHC class II-disparate (C57BL/6J-> C57BL/6J x bm12) F1 mice. J Immunol 168: 3065–3071, 2002.[Abstract/Free Full Text]
  11. Budd RC. Death receptors couple to both cell proliferation and apoptosis. J Clin Invest 109: 437–441, 2002.[ISI][Medline]
  12. Burne M, Elghandour A, Haq M, Saba S, Norman J, Condon T, Bennett F, and Rabb H. IL-1 and TNF independent pathways mediate ICAM-1/VCAM-1 up-regulation in ischemia reperfusion injury. J Leukoc Biol 70: 192–198, 2001.[Abstract/Free Full Text]
  13. Cunningham PN, Dyanov HM, Park P, Wang J, Newell KA, and Quigg RJ. Acute renal failure in endotoxemia is caused by TNF acting directly on TNF receptor-1 in kidney. J Immunol 168: 5817–5823, 2002.[Abstract/Free Full Text]
  14. Daemen M, Ven M, Heineman E, and Buurman W. Involvement of endogenous interleukin-10 and tumor necrosis factor-{alpha} in renal ischemia-reperfusion injury. Transplantation 67: 792–799, 1999.[ISI][Medline]
  15. Deng J, Kohda Y, Chiao H, Wang Y, Hu X, Hewitt S, Miyaja T, McLeroy P, Nibhanupudy B, Li S, and Star R. Interleukin-10 inhibits ischemic and cisplatin-induced acute renal injury. Kidney Int 60: 2118–2128, 2001.[ISI][Medline]
  16. Donnahoo K, Meng X, Ayala A, Cain M, Harken A, and Meldrum D. Early kidney TNF-{alpha} expression mediates neutrophil infiltration and injury after renal ischemia-reperfusion. Am J Physiol Regul Integr Comp Physiol 277: R922–R929, 1999.[Abstract/Free Full Text]
  17. Douni E and Kollias G. A critical role of the p75 tumor necrosis factor receptor (p75TNF-R) in organ inflammation independent of TNF, lymphotoxin {alpha}, or the p55TNF-R. J Exp Med 188: 1343–1352, 1998.[Abstract/Free Full Text]
  18. Erickson S, de Sauvage F, Kikly K, Carver-Moore K, Pitts-Meek S, Gillett N, Sheehan K, Schreiber R, Goeddel D, and Moore M. Decreased sensitivity to tumor necrosis factor but normal T-cell development in TNF receptor-2-deficient mice. Nature 372: 560–563, 1994.[Medline]
  19. Grell M, Douni E, Wajant H, Lohden M, Clauss M, Maxeiner B, Georgopoulos S, Lesslauer W, Kollias G, Pfizenmaier K, and Scheurich P. The transmembrane form of tumor necrosis factor in the prime activating ligand of the 80 kDa tumor necrosis factor receptor. Cell 83: 793–802, 1995.[ISI][Medline]
  20. Grell M, Wajant H, Zimmermann G, and Scheurich P. The type 1 receptor (CD120a) is the high-affinity receptor for tumor necrosis factor. Proc Natl Acad Sci USA 95: 570–575, 1998.[Abstract/Free Full Text]
  21. Guo G, Morrissey J, McCracken R, Tolley T, and Klahr S. Role of TNFR1 and TNFR2 receptors in tubulointerstitial fibrosis of obstructive nephropathy. Am J Physiol Renal Physiol 277: F766–F772, 1999.[Abstract/Free Full Text]
  22. Kelliher MA, Grimm S, Ishida Y, Kuo F, Stanger BZ, and Leder P. The death domain kinase RIP mediates the TNF-induced NF-{kappa}B signal. Immunity 8: 297–303, 1998.[ISI][Medline]
  23. Kelly KJ, Meehan SM, Colvin RB, Williams WW, and Bonventre JV. Protection from toxicant-mediated renal injury in the rat with anti-CD54 antibody. Kidney Int 56: 922–931, 1999.[ISI][Medline]
  24. Kelly KJ, Plotkin Z, and Dagher PC. Guanosine supplementation reduces apoptosis and protects renal function in the setting of ischemic injury. J Clin Invest 108: 1291–1298, 2001.[ISI][Medline]
  25. Kelly KJ, Plotkin Z, Vulgamott SL, and Dagher PC. P53 mediates the apoptotic response to GTP depletion after renal ischemia-reperfusion: protective role of a p53 inhibitor. JAmSoc Nephrol 14: 128–138, 2003.[Abstract/Free Full Text]
  26. Kelly KJ, Williams WW, Colvin RB, and Bonventre JV. Antibody to intercellular adhesion molecule-1 protects the kidney against ischemic injury. Proc Natl Acad Sci USA 91: 812–816, 1994.[Abstract/Free Full Text]
  27. Krunkosky TM, Fischer BM, Akley NJ, and Adler KB. Tumor necrosis factor alpha-induced ICAM-1 surface expression in airway epithelial cells in vitro: possible signal transduction mechanisms. Ann NY Acad Sci 796: 30–37, 1996.[Abstract]
  28. Lebwohl D and Canetta R. Clinical development of platinum complexes in cancer therapy: an historical perspective and an update. Eur J Cancer 34: 1522–1534, 1998.[ISI][Medline]
  29. Lemay S, Rabb H, Postler G, and Singh A. Prominent and sustained up-regulation of GP130-signaling cytokines and of the chemokine MIP-2 in murine renal ischemia-reperfusion injury. Transplantation 69: 959–963, 2000.[ISI][Medline]
  30. Li X, Yang Y, and Ashwell J. TNF-RII and c-IAP1 mediate ubiquitination and degradation of TRAF2. Nature 416: 345–349, 2002.[Medline]
  31. Lieberthal W, Triaca V, and Levine J. Mechanisms of death induced by cisplatin in proximal tubular epithelial cells: apoptosis vs. necrosis. Am J Physiol Renal Fluid Electrolyte Physiol 270: F700–F708, 1996.[Abstract/Free Full Text]
  32. Locksley R, Killeen N, and Lenardo M. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104: 487–501, 2001.[ISI][Medline]
  33. Lucas R, Lou J, Morel DR, Ricou B, Suter PM, and Grau GE. TNF receptors in the microvascular pathology of acute respiratory distress syndrome and cerebral malaria. J Leukoc Biol 61: 551–558, 1997.[Abstract]
  34. MacEwan DJ. TNF receptor subtype signalling: differences and cellular consequences. Cell Signal 14: 477–492, 2002.[ISI][Medline]
  35. Mizoguchi E, Mizoguchi A, Takedatsu H, Cario E, Jong Y, Ooi C, Xavier R, Terhorst C, Podolsky D, and Bhan A. Role of tumor necrosis factor receptor 2 (TNFR2) in colonic epithelial hyperplasia and chronic intestinal inflammation in mice. Gastroenterology 122: 134–144, 2002.[ISI][Medline]
  36. Nicotera P, Leist M, and Ferrando-May E. Intracellular ATP, a switch in the decision between apoptosis and necrosis. Toxicol Lett 102–103: 139–142, 1998.[Medline]
  37. Okuda M, Masaki K, Fukatsu S, Hashimoto Y, and Inui K. Role of apoptosis in cisplatin-induced toxicity in the renal epithelial cell line LLC-PK1. Biochem Pharmacol 59: 195–201, 2000.[ISI][Medline]
  38. Pfeffer K, Matsuyama T, Kundig TM, Wakeman A, Kishihara K, Shahinian A, Wiegmann K, Ohashi PS, Kronke M, and Mak TW. Mice deficient for the 55kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenese infection. Cell 73: 457–467, 1993.[ISI][Medline]
  39. Pimentel-Muinos FX and Seed B. Regulated commitment of TNF receptor signaling: a molecular switch for death or activation. Immunity 11: 783–793, 1999.[ISI][Medline]
  40. Pinckard JK, Sheehan KC, and Schreiber RD. Ligand-induced formation of the p55 and p75 tumor necrosis factor receptor heterocomplexes on intact cells. J Biol Chem 272: 10784–10789, 1997.[Abstract/Free Full Text]
  41. Probert L, Akassoglou K, Alexopoulou L, Douni E, Haralambous S, Hill S, Kassiotis G, Kontoyiannis D, Pasparakis M, Plows D, and Kollias G. Dissection of the pathologies induced by transmembrane and wild-type tumor necrosis factor in transgenic mice. J Leukoc Biol 59: 518–525, 1996.[Abstract]
  42. Rabb H. The T cell as a bridge between innate and adaptive immune systems: implications for the kidney. Kidney Int 61: 1935–1946, 2002.[ISI][Medline]
  43. Rabb H, Daniels F, O'Donnell M, Haq M, Saba S, Keane W, and Tang W. Pathophysiological role of T lymphocytes in renal ischemia-reperfusion injury in mice. Am J Physiol Renal Physiol 279: F525–F531, 2000.[Abstract/Free Full Text]
  44. Ramesh G and Reeves WB. TNF-{alpha} mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J Clin Invest 110: 835–842, 2002.[ISI][Medline]
  45. Ries F and Klastersky J. Nephrotoxicity induced by cancer chemotherapy with special emphasis on cisplatin toxicity. Am J Kidney Dis 13: 368–379, 1986.
  46. Rothe J, Lesslauer W, Lotscher H, Lang Y, Koebel P, Kontgen F, Althage A, Zinkernagel R, Steinmetz M, and Bluethmann H. Mice lacking the tumor necrosis factor receptor 1 are resistant to TNF-mediated toxicity but highly susceptible to infection by Listeria monocytogenese. Nature 364: 798–802, 1993.[Medline]
  47. Santee S and Owen-Schaub L. Human tumor necrosis factor receptor p75/80 (CD120b) gene structure and promoter characterization. J Biol Chem 271: 21151–21159, 1996.[Abstract/Free Full Text]
  48. Schroder J, Stuber F, Gallati H, Schade FU, and Kremer B. Pattern of soluble TNF receptors I and II in sepsis. Infection 23: 143–148, 1995.[ISI][Medline]
  49. Sheridan A and Bonventre J. Cell biology and molecular mechanisms of injury in ischemic acute renal failure. Curr Opin Nephrol Hypertens 9: 427–434, 2000.[ISI][Medline]
  50. Tada Y, Ho A, Koarada S, Morito F, Ushiyama O, Suzuki N, Kikuchi Y, Ohta A, Mak T, and Nagasawa K. Collagen-induced arthritis in TNF receptor-1-deficient mice: TNF receptor-2 can modulate arthritis in the absence of TNF receptor-1. Clin Immunol 99: 325–333, 2001.[ISI][Medline]
  51. Takada M, Nadeau K, Shaw G, Marquette K, and Tilney N. The cytokine-adhesion molecule cascade in ischemia/reperfusion injury of the rat kidney. J Clin Invest 99: 2682–2690, 1997.[ISI][Medline]
  52. Tartaglia LA, Goeddel DV, Reynolds C, Figari IS, Weber RF, Fendly BM, and Palladino MA. Stimulation of human T-cell proliferation by specific activation of the 75-kDa tumor necrosis factor receptor. J Immunol 151: 4637–4641, 1993.[Abstract]
  53. Tartaglia LA, Pennica D, and Goeddel DV. Ligand passing: the 75-kDa tumor necrosis factor (TNF) receptor recruits TNF for signalling by the 55-kDa TNF receptor. J Biol Chem 268: 18542–18548, 1993.[Abstract/Free Full Text]
  54. Wolf D, Hallmann R, Sass G, Sixt M, Kusters S, Fregien B, Trautwein C, and Tiegs G. TNF-{alpha}-induced expression of adhesion molecules in the liver is under the control of TNFR1— relevance for concanavalin A-induced hepatitis. J Immunol 166: 1300–1307, 2001.[Abstract/Free Full Text]
  55. Yang Y, Hsu T, Chen J, Yang C, and Lin R. Tumour necrosis factor-{alpha}-induced apoptosis in cord blood T lymphocytes: involvement of both tumour necrosis factor receptor types 1 and 2. Br J Haematol 115: 435–441, 2001.[ISI][Medline]
  56. Yao J, Mechman N, Edgington T, and Fan S. Lipopolysaccharide induction of the tumor necrosis factor-{alpha} promoter in human monocytic cells. J Biol Chem 272: 17795–17801, 1997.[Abstract/Free Full Text]
  57. Zheng L, Fisher G, Miller RE, Peschon J, Lynch DH, and Lenardo MJ. Induction of apoptosis in mature T cells by tumor necrosis factor. Nature 377: 348–351, 1995.[Medline]



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. Elizur, T. L. Adair-Kirk, D. G. Kelley, G. L. Griffin, D. E. deMello, and R. M. Senior
Tumor Necrosis Factor-{alpha} from Macrophages Enhances LPS-Induced Clara Cell Expression of Keratinocyte-Derived Chemokine
Am. J. Respir. Cell Mol. Biol., January 1, 2008; 38(1): 8 - 15.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
L. H. Lu, D.-J. Oh, B. Dursun, Z. He, T. S. Hoke, S. Faubel, and C. L. Edelstein
Increased Macrophage Infiltration and Fractalkine Expression in Cisplatin-Induced Acute Renal Failure in Mice
J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 111 - 117.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
F. Yu, J. Megyesi, R. L. Safirstein, and P. M. Price
Involvement of the CDK2-E2F1 pathway in cisplatin cytotoxicity in vitro and in vivo
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F52 - F59.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Ramesh, B. Zhang, S. Uematsu, S. Akira, and W. B. Reeves
Endotoxin and cisplatin synergistically induce renal dysfunction and cytokine production in mice
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F325 - F332.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Ramesh, S. R. Kimball, L. S. Jefferson, and W. B. Reeves
Endotoxin and cisplatin synergistically stimulate TNF-{alpha} production by renal epithelial cells
Am J Physiol Renal Physiol, February 1, 2007; 292(2): F812 - F819.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Wang, N. Pabla, C.-Y. Wang, W. Wang, P. V. Schoenlein, and Z. Dong
Caspase-mediated cleavage of ATM during cisplatin-induced tubular cell apoptosis: inactivation of its kinase activity toward p53
Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1300 - F1307.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
H. Kadhim, M. Khalifa, P. Deltenre, G. Casimir, and G. Sebire
Molecular mechanisms of cell death in periventricular leukomalacia.
Neurology, July 25, 2006; 67(2): 293 - 299.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. A. Zager, A. C. M. Johnson, S. Y. Hanson, and S. Lund
Ischemic proximal tubular injury primes mice to endotoxin-induced TNF-{alpha} generation and systemic release
Am J Physiol Renal Physiol, August 1, 2005; 289(2): F289 - F297.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Li, N. Gokden, M. D. Okusa, R. Bhatt, and D. Portilla
Anti-inflammatory effect of fibrate protects from cisplatin-induced ARF
Am J Physiol Renal Physiol, August 1, 2005; 289(2): F469 - F480.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Jiang, X. Yi, S. Hsu, C.-Y. Wang, and Z. Dong
Role of p53 in cisplatin-induced tubular cell apoptosis: dependence on p53 transcriptional activity
Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1140 - F1147.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Li, R. Bhatt, J. Megyesi, N. Gokden, S. V. Shah, and D. Portilla
PPAR-{alpha} ligand ameliorates acute renal failure by reducing cisplatin-induced increased expression of renal endonuclease G
Am J Physiol Renal Physiol, November 1, 2004; 287(5): F990 - F998.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/F610    most recent
00101.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services