|
|
||||||||
Division of Nephrology, The Pennsylvania State College of Medicine, Hershey 17033, and Lebanon Veterans Affairs Medical Center, Lebanon, Pennsylvania 17042
Submitted 12 March 2003 ; accepted in final form 9 June 2003
| ABSTRACT |
|---|
|
|
|---|
in mouse
kidney and that inhibition of either the release or action of TNF-
protects the kidney from cisplatin-induced nephrotoxicity. In this study, we
examined the effect of cisplatin on the expression of TNF receptors TNFR1 and
TNFR2 in the kidney and the role of each receptor in mediating cisplatin
nephrotoxicity. Injection of cisplatin into C57BL/6 mice led to an
upregulation of TNFR1 and TNFR2 mRNA levels in the kidney. The upregulation of
TNFR2 but not TNFR1 was blunted in TNF-
-deficient mice, indicating
ligand-dependent upregulation of TNFR2. To study the roles of each receptor,
we administered cisplatin to TNFR1- or TNFR2-deficient mice. TNFR2-deficient
mice developed less severe renal dysfunction and showed reduced necrosis and
apoptosis and leukocyte infiltration into the kidney compared with either
TNFR1-deficient or wild-type mice. Moreover, renal TNF-
expression,
ICAM-1 expression, and serum TNF-
levels were lower in TNFR2-deficient
mice compared with wild-type or TNFR1-deficient mice treated with cisplatin.
These results indicate that TNFR2 participates in cisplatin-induced renal
injury in mice and may play an important role in TNF-
-mediated
inflammation in the kidney in response to cisplatin. acute tubular necrosis; gene expression; tumor necrosis factor; tumor necrosis factor receptor; cytokines
pathways are activated in
cisplatin injury (15,
23,
44). Indeed, TNF-
is a
central figure in a large network of chemokines and cytokines expressed in the
kidney after cisplatin injection
(44). Moreover, inhibition of
either TNF-
production or its activity ameliorated cisplatin-induced
renal dysfunction and reduced cisplatin-induced structural damage
(44). However, the pathway
through which TNF-
mediates its toxicity in cisplatin injury is not
known.
TNF-
is a potent proinflammatory cytokine that plays important roles
in chronic inflammation and autoimmune diseases, such as rheumatoid arthritis,
autoimmune diabetes, and multiple sclerosis
(2,
10). The biological activities
of TNF-
are mediated by two functionally distinct receptors, TNFR1
(p55) and TNFR2 (p75). Many of the cytotoxic and proinflammatory actions of
TNF-
are mediated by TNFR1
(7,
32). TNFR1-deficient mice are
resistant to endotoxic shock and show abrogated induction of adhesion
molecules by TNF-
(38,
46). In contrast,
TNFR2-deficient mice exhibit only subtle defects
(18), and the role of TNFR2 in
disease is unclear (9,
11). TNFR2 is thought to
cooperate with TNFR1 by passing ligands to TNFR1
(53) or forming
heterocomplexes with TNFR1
(40). However, the engagement
of TNFR2 by TNF-
also leads to TNFR1-independent cellular events,
including apoptosis of activated T cells
(39,
57), thymocyte proliferation
(52), and inhibition of early
hematopoiesis (55). In this
study, we have used TNFR1-, TNFR2-, and TNF-
-deficient mice to examine
the TNF-
receptor subtype that mediates cisplatin-induced renal injury
and the regulation of their expression in response to cisplatin. Our results
indicate that TNFR2 expression in the kidney is regulated in a
ligand-dependent manner and participates in both necrosis and apoptosis of
renal epithelial cells in cisplatin nephrotoxicity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
(B6;129-Tnftm1
Gkl)-deficient mice weighing
30 g. Mice were obtained from Jackson
Laboratory (Bar Harbor, ME) and maintained on a standard diet, and water was
freely available. PCR genotyping was performed on selected animals from each
strain to confirm the correct genotype. Cisplatin (Sigma-Aldrich, St. Louis,
MO) was dissolved in saline at a concentration of 1 mg/ml. Mice were given a
single intraperitoneal injection of either vehicle (saline) or cisplatin (20
mg/kg body wt). This dose of cisplatin produces severe renal failure in mice
(44). Animals were killed 72 h
after cisplatin injection, and blood and kidney tissues were collected. Renal function. Renal function was assessed by measurement of urea nitrogen in the serum using a commercially available kit.
Quantitation of mRNA by real-time RT-PCR. Total RNA was isolated
from kidneys using the TRIzol reagent. Real-time RT-PCR was performed using
the Applied Biosystems 7700 Sequence Detection System. Total RNA (5 µg) was
reverse transcribed in a reaction volume of 20 µl using Superscript II
reverse transcriptase and random primers. The product was diluted to a volume
of 500 µl, and either 2 (actin)- or 10-µl (all others) aliquots were
used as templates for amplification using the SYBR green PCR amplification
reagent (PE Biosystems, Foster City, CA) and gene-specific primers. The primer
sets used were actin (forward: CATGGATGACGATATCGCT; reverse:
CATGAGGTAGTCTGTCAGGT); TNF-
(forward: GCATGATCCGCGACGTGGAA; reverse:
AGATCCATGCCGTTG GCCAG); TNFR1 (forward: CCGGGCCACCTGGTCCG; reverse:
CAAGTAGGTTCCTTTGTG); TNFR2 (forward: GTCGCGCTGGTCTTCGAACTG; reverse:
GGTATACATGCTTGCCTCACAGTC); and ICAM-1 (forward: AGATCACATTCACGGTGCTG; reverse:
CTTCAGAGGCAGGAAACAGG).
TNF-
and soluble TNFR2 quantitation by ELISA.
Levels of TNF-
and soluble TNFR2 in serum were determined using an
ELISA assay (Quantikine Mouse TNF-
and Quantikine Mouse sTNFRII kits,
R&D Systems, Minneapolis, MN) according to the manufacturer's
instructions.
Western blot analysis. Kidneys were homogenized in PBS, and the protein concentration was quantitated (BCA protein assay reagent, Pierce, Rockford, IL). Samples of protein (100 µg) were separated by 10% SDS-PAGE and then transferred onto a polyvinylidene difluoride membrane. Western blot analysis was performed with an anti-TNFR2 antibody (1: 1,000 dilution, Santa Cruz Biotechnology, Santa Cruz, CA). Proteins were detected using enhanced chemiluminescence detection reagents (Amersham Pharmacia Biotech, Piscataway, NJ).
Histology and immunohistochemistry. Kidney tissue was fixed in buffered formalin for 12 h and then embedded in paraffin wax. Sections (5 µm) were stained with periodic acid-Schiff (PAS) or naphthol AS-D chloroacetate esterase (Sigma kit 91A). The esterase stain identifies infiltrating neutrophils and monocytes. Thirty x40 fields of esterase-stained sections of kidney cortex were examined for quantitation of leukocytes. Tubular injury was assessed in PAS-stained sections using a semiquantitative scale (23, 26, 43) in which the percentage of cortical tubules showing epithelial necrosis was assigned a score: 0 = normal; 1 = <10%; 2 = 1025%; 3 = 2675%; and 4 = >75%. Apoptosis was scored by counting the number of apoptotic cells, as defined by chromatin condensation or nuclear fragmentation (apoptotic bodies), on PAS-stained sections of cortex. The individual scoring the slides was blinded to the treatment and strain of the animal.
Statistical methods. All assays were performed in duplicate. The data are reported as means ± SE. Statistical significance was assessed by an unpaired, two-tailed Student t-test for single comparison or ANOVA for multiple comparisons.
| RESULTS |
|---|
|
|
|---|
B and other transcription
factor binding sites in its promoter
(47), can be altered in
disease states. Therefore, we studied the expression of TNFR1 and TNFR2 mRNA
in response to cisplatin injection. As shown in
Fig. 1, cisplatin increased the
expression of TNFR1 about threefold and increased TNFR2 expression six- to
ninefold over saline-treated controls in either C57BL/6 or B6;129J mice. To
examine whether the upregulation of either TNFR1 or TNFR2 is TNF-
dependent, receptor mRNA was quantified in cisplatin-treated
TNF-
-deficient mice. The expression of TNFR1 was unaltered between the
wild-type mice treated with cisplatin and TNF-
-deficient mice
(Fig. 1). However, the
upregulation of TNFR2 mRNA was blunted in TNF-
-deficient mice. We also
examined the effect of cisplatin on kidney TNFR2 protein levels
(Fig. 2). As shown in
Fig. 2 (top), kidney
TNFR2 protein levels were increased by cisplatin, and this increase was
blunted in TNF-
-deficient mice. These results indicate ligand-dependent
regulation of TNFR2 in cisplatin nephrotoxicity. As shown in
Fig. 2 (bottom), TNFR2
protein was measured in C57BL/6 and TNFR1-deficient and TNFR2-deficient mice.
Little or no TNFR2 was detectable in kidneys of saline-treated mice.
Consistent with the above results, cisplatin produced a marked increase in
TNFR2 content in C57BL/6 mice. Moreover, a similar increase occurred in
TNFR1-deficient mice. As expected, no TNFR2 protein was present in the
TNFR2-deficient kidneys. These results confirm that TNFR2 expression is
increased in cisplatin-treated kidneys and indicate that the upregulation is
not mediated via TNFR1.
|
|
Serum levels of soluble TNFR2 were measured in wild-type mice and in mice
deficient in either TNF-
, TNFR1, or TNFR2
(Fig. 3). Treatment of mice
with cisplatin increased soluble TNFR2 levels in wild-type mice (either
B6;129J or C57BL/6 strains) and TNFR1-deficient mice. TNF-
-deficient
mice had lower levels of soluble TNFR2 in the presence or absence of
cisplatin. As expected, TNFR2-deficient mice had undetectable levels of
soluble TNFR2. These results are also consistent with TNF-
-dependent
regulation of TNFR2 expression.
|
Cisplatin upregulates TNF-
expression in
TNFR1-deficient but not in TNFR2-deficient mice. Cisplatin increases
kidney TNF-
expression and serum TNF-
levels
(15,
23,
44). To determine whether this
upregulation is mediated through TNF-
receptors, we measured
TNF-
mRNA in kidney and TNF-
protein in the serum of TNFR1- or
TNFR2-deficient mice after cisplatin injection. As shown in
Fig. 4A,
TNFR1-deficient mice showed a similar increase in kidney TNF-
mRNA as
seen in wild-type mice treated with cisplatin. However, the increase was
blunted significantly in TNFR2-deficient mice. Similarly, serum TNF-
protein levels (Fig.
4B) were also significantly lower in TNFR2-deficient mice
than in wild-type or TNFR1-deficient mice, suggesting TNFR2-dependent
regulation of TNF-
production in the kidney in response to
cisplatin.
|
TNFR2-deficient mice are resistant to cisplatin nephrotoxicity. To address the role of TNFR1 and TNFR2 in the pathogenesis of cisplatin-induced acute renal failure, we examined cisplatin nephrotoxicity in mice with targeted deletions of either TNFR1 or TNFR2. As shown in Fig. 5, wild-type and TNFR1-deficient mice developed severe renal failure after injection with cisplatin [72-h urea = 135 ± 7 and 161 ± 14 mg/dl for wild-type (n = 17) and TNFR1-deficient mice (n = 15), respectively, P = not significant (NS)]. In contrast, TNFR2-deficient mice had better preservation of function (72-h urea = 88 ± 8 mg/dl, n = 16, P = 0.015 vs. wild-type). The histological findings also revealed less severe damage in the TNFR2-deficient mice. As shown in Fig. 6, cisplatin treatment of wild-type and TNFR1-deficient mice resulted in severe tubular injury as reflected by cast formation, loss of brush-border membranes, sloughing of tubular epithelial cells, and dilation of tubules. This injury was present throughout the cortex and outer medulla. These changes were minimal in kidneys from TNFR2-deficient mice treated with cisplatin.
|
|
TNFR2 induces apoptosis and necrosis in cisplatin nephrotoxicity.
Cisplatin produces both necrosis and apoptosis of renal epithelial cells in
vitro (31,
37). The contribution of
necrosis and apoptosis to cisplatin injury in vivo is less clear. Moreover,
the contribution of TNFR2 signaling to apoptosis in vivo is not well
established. Therefore, we quantitated the extent of cisplatin-induced
necrosis and apoptosis in vivo and determined the role of TNF-
and
TNFR1 and TNFR2 in both processes. The results in
Fig. 7 show that cisplatin
treatment resulted in both necrosis and apoptosis in vivo. Deletion of
TNF-
resulted in a decrease in both necrosis and apoptosis. Deletion of
TNFR2 also reduced apoptosis and necrosis, although to a lesser extent than
did TNF-
deletion. Deletion of TNFR1 resulted in a slight reduction in
histological necrosis but no decrease in apoptosis.
|
TNFR2 induces leukocyte infiltration and ICAM-1 expression.
Cisplatin nephrotoxicity is associated with the infiltration of leukocytes
into the kidney and up-regulation of ICAM-1
(15,
23,
44). Inhibition of TNF-
(44) or ICAM-1
(23) reduces leukocyte
infiltration and also lessens cisplatin nephrotoxicity. Accordingly, we
examined the dependence of leukocyte infiltration and ICAM-1 expression on the
presence of TNFR1 and TNFR2. Leukocyte infiltration was measured using the
naphthol AS-D chloroacetate esterase stain. As shown in
Fig. 8, in either C57BL/6 or
TNFR1-deficient mice, cisplatin injection produced a large increase in
leukocytes within the kidney cortex. In contrast, TNFR2 knockout mice had
little or no increase in leukocytes.
|
A similar pattern was observed for ICAM-1 expression (Fig. 9). Namely, cisplatin increased ICAM-1 expression in wild-type and TNFR1-deficient mice six- to ninefold over saline-treated control mice. In contrast, ICAM-1 expression was significantly blunted in TNFR2-deficient mice compared with wild-type mice (n = 4, P < 0.05).
|
| DISCUSSION |
|---|
|
|
|---|
is a highly pleiotrophic cytokine that plays a role in immune
inflammatory response. Intracellular signaling through TNF receptors may lead
to apoptosis, cell activation, and/or cell proliferation. Whereas TNFR1
signaling is clearly involved in a number of pathological states
(41), the role of TNFR2 in
organ pathology is not widely established. Recently, a role for TNF-
in
toxic and ischemic acute renal failure has been recognized
(14,
16,
26,
44,
51). The mechanisms whereby
TNF-
mediates acute renal failure are not clear. We used a clinically
relevant model of acute renal failure, cisplatin nephrotoxicity, to
investigate the TNF-
signaling pathways during acute renal injury.
Several results are noteworthy.
First, we found that the expressions of both TNFR1 and TNFR2 are
upregulated after cisplatin injection. This upregulation may serve to
sensitize the kidney to the effects of TNF-
. In this regard, serum
levels of TNF-
in cisplatin nephrotoxicity, although increased
(44), are lower than those
that occur in some other disorders mediated by TNF-
, such as sepsis. A
dissociation between serum TNF-
levels and TNFR2 expression has been
noted in other settings (1),
possibly reflecting a need for high levels of TNFR2 expression to mediate
biological actions. In addition, elegant studies by Douni and Kollias
(17) and Akassoglou et al.
(3) demonstrated that high
levels of TNFR2 expression can mediate inflammation in a ligand-independent
fashion. We did not directly test for ligand-independent actions of TNFR2 in
cisplatin nephrotoxicity. However, the observation that deletion of either
TNF-
(44) or TNFR2
(Fig. 5) results in similar
degrees of protection suggests that ligand-independent actions of TNFR2 do not
play a major role. Upregulation of kidney TNF receptors has also been reported
in kidney transplant rejection
(4). Al-Lamki et al.
(4) found relatively little
expression of TNFR1 and TNFR2 in normal human kidney allografts. During acute
transplant rejection, however, the expression of TNFR1 and TNFR2 was increased
in areas of lymphocytic infiltration. TNFR2 expression and/or serum levels of
soluble TNFR2 are also elevated in a number of inflammatory conditions,
including inflammatory bowel diseases
(35), sepsis
(48), acute respiratory
distress syndrome (33), and
cerebral malaria (33).
We determined that the upregulation of TNFR2 was dependent, in part, on
TNF-
. TNF-
, via receptor-interacting protein (RIP), activates
I
B kinase and subsequent NF-
B transcriptional activity
(22). Because the promoter of
TNFR2 contains NF-
B binding sites
(47), this pathway is a
plausible mechanism to account for the observed TNF-
-dependent
upregulation of TNFR2. Similarly, the expression of TNF-
was dependent
on TNFR2. TNFR2 activation can result in NF-
B activation
(34). The presence of
NF-
B binding sites within the TNF-
promoter
(56), then, provides a
mechanism whereby TNF-
can stimulate its own production via TNFR2. The
mechanism for the TNF-
-independent upregulation of both TNFR1 and TNFR2
is unknown. We have found that cisplatin activates multiple signaling pathways
in the kidney, including ERK, JNK, and p38 (preliminary data). It is possible
that one or more of these pathways may influence TNF receptor expression.
Finally, the actions of TNF-
in a heterogenous organ like the kidney
are likely determined by both the quantity and spatial distribution of TNF
receptors. Accordingly, it will be informative to determine the specific sites
of TNFR1 and TNFR2 expression in cisplatin nephrotoxicity.
Second, cisplatin-induced tissue injury is mediated, at least in part, via
TNFR2. In many pathological states, including some kidney diseases (see
below), the actions of TNF-
are mediated through TNFR1. In other
settings, TNFR2 may contribute to tissue injury by enhancing TNFR1-mediated
toxicity (40,
53,
55). In contrast, we found
that TNFR2, independently of TNFR1, was responsible for cisplatin
nephrotoxicity. There was a tendency, although not statistically significant,
for renal function to be worse in TNFR1-deficient mice than in wild-type mice,
raising the possibility that TNFR1 activation may oppose the cytotoxicity of
TNFR2 in this model. Further studies with TNFR1/TNFR2-deficient mice will be
needed to examine the interactions between these receptors.
Our finding that TNFR2 mediates acute renal injury expands a small but
growing list of disorders in which TNFR2 has been shown to play an important
role. For example, TNFR2 is upregulated in intestinal inflammation and
TNFR2-deficient mice develop less severe intestinal inflammation
(35). TNFR2 also participates
in intestinal graft vs. host disease
(10) and accelerates the early
phase of collagen-induced arthritis
(50). The recent report by
Akassoglou et al. (3)
demonstrated that overexpression of TNFR2, in the absence of TNFR1 and even
TNF-
, induces vascular inflammation and ischemic necrosis in the
central nervous system (CNS). Few studies have assigned the actions of
TNF-
to a specific receptor in the kidney. In a model of obstructive
uropathy, Guo et al. (21)
found that both TNFR1 and TNFR2 contributed to interstitial fibrosis,
NF-
B activation, and TNF-
expression. Cunningham et al.
(13) determined that
endotoxin-induced acute renal injury was dependent on intrarenal TNFR1,
consistent with the known role of TNFR1 in mediating endotoxic shock
(38). There are a number of
possible explanations for the differences between our results and the results
of Cunningham et al. (13).
Injection of endotoxin causes rapid and massive release of TNF-
, the
prime mediator of endotoxic shock. In comparison, TNF-
secretion in
cisplatin nephrotoxicity is much slower and more modest
(44). TNFR2 may be more
important in cell death induced by low levels of TNF-
(18). The
TNF-
-dependent induction of TNFR2 expression may also affect the
relative importance of TNFR1 and TNFR2 in this model. Moreover, soluble
TNF-
is a more efficient agonist of TNFR1
(20), whereas membrane-bound
TNF-
preferentially activates TNFR2
(19). Accordingly, with
endotoxin injection, the high levels of secreted TNF-
might be expected
to act primarily via TNFR1, which has a broader constitutive level of
expression than TNFR2, whereas, in cisplatin nephrotoxicity, upregulation of
TNFR2 along with local production of TNF-
may favor TNFR2 pathways.
Third, cisplatin produces both necrotic and apoptotic cell death in vivo,
and TNF-
/TNFR2 signaling contributes to both processes
(Fig. 7). Apoptotic signaling
has been clearly demonstrated to occur through TNFR1
(6). However, the role of
TNFR2, which lacks an intracellular death domain, in apoptosis and
inflammation is less clear. TNFR2 can potentiate the proapoptotic effects of
TNFR1 activation (55,
57). TNFR2-mediated
ubiquitination and degradation of TNF receptor-associated factor 2 may account
for this phenomenon (30).
TNFR2 may also mediate apoptosis and inflammation independently of TNFR1
(3,
39,
57). In T cells, the ability
of TNFR2 to initiate apoptosis in vitro was dependent on high levels of RIP
expression (39). However, in
vivo demonstrations of TNFR2-dependent apoptosis are lacking. Overexpression
of TNFR2 in the CNS, for example, produced vasculitis and necrosis but not
apoptosis, whereas TNFR1 expression resulted in apoptosis of oligodendrocytes
(3). In cisplatin-induced acute
renal failure, we found that TNFR2 mediates, either directly or indirectly,
both apoptotic and necrotic death of renal epithelial cells. The relative
roles of apoptosis and necrosis in the pathogenesis of renal dysfunction after
cisplatin injection are not known. In ischemic injury, recent evidence points
to an important role for apoptosis rather than necrosis
(24,
25). However, because both
necrosis and apoptosis were reduced in TNFR2-deficient mice, our results do
not allow any conclusions regarding their relative importance in cisplatin
toxicity. Further studies are required to determine whether the cells
expressing TNFR2 are the cells that subsequently undergo necrotic or apoptotic
death. Similarly, we do not understand the factors that determine whether
renal epithelial cells die by necrosis or apoptosis. Intracellular ATP
(36) and dGTP concentrations
(8) and the concentration of
cisplatin to which cells are exposed
(31) have all been proposed as
cellular determinants of the mode of cell death.
Fourth, TNFR2 plays a role in ICAM-1 expression and leukocyte infiltration in cisplatin acute renal injury. Inflammatory mechanisms are believed to play an important role in the pathogenesis of acute renal failure (42, 49). The inflammatory response is characterized predominantly by an early neutrophil and a late monocyte influx and is preceded by the expression of adhesion molecules, such as ICAM-1, as well as the induction of various chemokines responsible for monocyte and neutrophil migration (29, 44). Renal ICAM-1 expression is increased after either ischemic or toxic (15, 23, 26, 44) renal insults. Blockade of ICAM-1 reduces acute renal injury after ischemia (26) or cisplatin exposure (23). The signals that result in ICAM-1 expression in these settings are unknown. In many systems, induction of ICAM-1 expression occurs via TNFR1 (5, 27, 54). In the kidney, however, Burne et al. (12) demonstrated that ischemia-induced ICAM-1 expression is independent of TNFR1. The dependence on TNFR2 was not examined in that study. Our results indicate that TNFR2 contributes to ICAM-1 upregulation in cisplatin and perhaps other forms of acute renal injury. TNFR2-dependent ICAM-1 expression was also noted in transgenic mice overexpressing TNFR2 in the CNS (3).
In summary, we demonstrated, using TNF-
- and TNF receptor-deficient
mice, that cisplatin-induced renal inflammation, cell death, and organ
dysfunction are mediated, in part, through TNFR2. Moreover, the induction of
TNF-
and TNFR2 expression is interdependent. We also demonstrated that
both apoptosis and necrosis of renal epithelial cells were dependent on TNFR2.
We conclude that TNFR2 may play a greater role in ischemic and toxic organ
injury than had been previously appreciated. Antagonism of TNF-
production or action may have a therapeutic benefit in these settings.
| DISCLOSURES |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
. In: Cytokine
Reference, edited by Oppenheim JJ and Feldmann M. San Diego, CA:
Academic, 2001, p.
413434.
cytotoxic and proinflammatory
activities by p55 receptor- and p75 receptor-selective TNF-
mutants.
EMBO J 14:
843850, 1994.
C57BL/6J x bm12) F1 mice. J
Immunol 168:
30653071, 2002.
in renal ischemia-reperfusion injury.
Transplantation 67:
792799, 1999.[Web of Science][Medline]
expression mediates neutrophil infiltration and injury after renal
ischemia-reperfusion. Am J Physiol Regul Integr Comp
Physiol 277:
R922R929, 1999.
, or
the p55TNF-R. J Exp Med 188:
13431352, 1998.
B signal.
Immunity 8:
297303, 1998.[Web of Science][Medline]
mediates chemokine and cytokine expression and
renal injury in cisplatin nephrotoxicity. J Clin
Invest 110:
835842, 2002.[Web of Science][Medline]
-induced expression of adhesion molecules in the liver is
under the control of TNFR1 relevance for concanavalin A-induced
hepatitis. J Immunol 166:
13001307, 2001.
-induced
apoptosis in cord blood T lymphocytes: involvement of both tumour necrosis
factor receptor types 1 and 2. Br J Haematol
115: 435441,
2001.[Web of Science][Medline]
promoter in human monocytic cells. J Biol
Chem 272:
1779517801, 1997.This article has been cited by other articles:
![]() |
G. Dong, J. Luo, V. Kumar, and Z. Dong Inhibitors of histone deacetylases suppress cisplatin-induced p53 activation and apoptosis in renal tubular cells Am J Physiol Renal Physiol, February 1, 2010; 298(2): F293 - F300. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wu, R. Guo, P. Chen, Q. Wang, and P. N. Cunningham TNF induces caspase-dependent inflammation in renal endothelial cells through a Rho- and myosin light chain kinase-dependent mechanism Am J Physiol Renal Physiol, August 1, 2009; 297(2): F316 - F326. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Misaki, T. Yamamoto, S. Suzuki, H. Fukasawa, A. Togawa, N. Ohashi, H. Suzuki, Y. Fujigaki, T. Oda, C. Uchida, et al. Decrease in Tumor Necrosis Factor-{alpha} Receptor-Associated Death Domain Results from Ubiquitin-Dependent Degradation in Obstructive Renal Injury in Rats Am. J. Pathol., July 1, 2009; 175(1): 74 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Han, J. Yue, and R. W. Chesney Functional TauT Protects Against Acute Kidney Injury J. Am. Soc. Nephrol., June 1, 2009; 20(6): 1323 - 1332. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Elizur, T. L. Adair-Kirk, D. G. Kelley, G. L. Griffin, D. E. deMello, and R. M. Senior Tumor Necrosis Factor-{alpha} from Macrophages Enhances LPS-Induced Clara Cell Expression of Keratinocyte-Derived Chemokine Am. J. Respir. Cell Mol. Biol., January 1, 2008; 38(1): 8 - 15. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Lu, D.-J. Oh, B. Dursun, Z. He, T. S. Hoke, S. Faubel, and C. L. Edelstein Increased Macrophage Infiltration and Fractalkine Expression in Cisplatin-Induced Acute Renal Failure in Mice J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 111 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Yu, J. Megyesi, R. L. Safirstein, and P. M. Price Involvement of the CDK2-E2F1 pathway in cisplatin cytotoxicity in vitro and in vivo Am J Physiol Renal Physiol, July 1, 2007; 293(1): F52 - F59. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ramesh, B. Zhang, S. Uematsu, S. Akira, and W. B. Reeves Endotoxin and cisplatin synergistically induce renal dysfunction and cytokine production in mice Am J Physiol Renal Physiol, July 1, 2007; 293(1): F325 - F332. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ramesh, S. R. Kimball, L. S. Jefferson, and W. B. Reeves Endotoxin and cisplatin synergistically stimulate TNF-{alpha} production by renal epithelial cells Am J Physiol Renal Physiol, February 1, 2007; 292(2): F812 - F819. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, N. Pabla, C.-Y. Wang, W. Wang, P. V. Schoenlein, and Z. Dong Caspase-mediated cleavage of ATM during cisplatin-induced tubular cell apoptosis: inactivation of its kinase activity toward p53 Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1300 - F1307. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kadhim, M. Khalifa, P. Deltenre, G. Casimir, and G. Sebire Molecular mechanisms of cell death in periventricular leukomalacia. Neurology, July 25, 2006; 67(2): 293 - 299. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Zager, A. C. M. Johnson, S. Y. Hanson, and S. Lund Ischemic proximal tubular injury primes mice to endotoxin-induced TNF-{alpha} generation and systemic release Am J Physiol Renal Physiol, August 1, 2005; 289(2): F289 - F297. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Li, N. Gokden, M. D. Okusa, R. Bhatt, and D. Portilla Anti-inflammatory effect of fibrate protects from cisplatin-induced ARF Am J Physiol Renal Physiol, August 1, 2005; 289(2): F469 - F480. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jiang, X. Yi, S. Hsu, C.-Y. Wang, and Z. Dong Role of p53 in cisplatin-induced tubular cell apoptosis: dependence on p53 transcriptional activity Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1140 - F1147. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Li, R. Bhatt, J. Megyesi, N. Gokden, S. V. Shah, and D. Portilla PPAR-{alpha} ligand ameliorates acute renal failure by reducing cisplatin-induced increased expression of renal endonuclease G Am J Physiol Renal Physiol, November 1, 2004; 287(5): F990 - F998. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |