AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 285: F664-F673, 2003. First published May 27, 2003; doi:10.1152/ajprenal.00353.2002
0363-6127/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/F664    most recent
00353.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (23)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gumz, M. L.
Right arrow Articles by Cain, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gumz, M. L.
Right arrow Articles by Cain, B. D.

Early transcriptional effects of aldosterone in a mouse inner medullary collecting duct cell line

Michelle L. Gumz,1 Michael P. Popp,2 Charles S. Wingo,3 and Brian D. Cain1

1Department of Biochemistry and Molecular Biology and 2Interdisciplinary Center for Biotechnology Research, University of Florida, and 3Department of Veteran Affairs Medical Center, Gainesville, Florida 32610-0245

Submitted 2 October 2002 ; accepted in final form 21 May 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The mineralocorticoid aldosterone is a major regulator of Na+ and acid-base balance and control of blood pressure. Although the long-term effects of aldosterone have been extensively studied, the early aldosterone-responsive genes remain largely unknown. Using DNA array technology, we have characterized changes in gene expression after 1 h of exposure to aldosterone in a mouse inner medullary collecting duct cell line, mIMCD-3. Results from three independent microarray experiments revealed that the expression of many transcripts was affected by aldosterone treatment. Northern blot analysis confirmed the upregulation of four distinct transcripts identified by the microarray analysis, namely, the serum and glucose-regulated kinase sgk, connective tissue growth factor, period homolog, and preproendothelin. Immunoblot analysis for preproendothelin demonstrated increased protein expression. Following the levels of the four transcripts over time showed that each had a unique pattern of expression, suggesting that the cellular response to aldosterone is complex. The results presented here represent a novel list of early aldosterone-responsive transcripts and provide new avenues for elucidating the mechanism of acute aldosterone action in the kidney.

kidney; sgk; period homolog; connective tissue growth factor; endothelin-1


THE MINERALOCORTICOID ALDOSTERONE is released by the cells of the adrenal zona glomerulosa in response to stimulation of the renal juxtaglomerular apparatus or changes in Na+ or K+ concentrations. Aldosterone acts directly to increase Na+ absorption in tight epithelia, including the renal collecting duct. Increased Na+ reabsorption expands blood volume, thereby leading to an increase in central venous filling pressure, cardiac output, and systemic arterial blood pressure (21). In this capacity, aldosterone plays a critical role in regulating blood pressure. To date, all cases of inherited hypertension result from abnormal regulation of aldosterone or its downstream effects (4, 31).

Known molecular targets of aldosterone action include the basolateral Na+-K+-ATPase and the apical epithelial sodium channel (ENaC), both of which are critical for Na+ absorption. Aldosterone has both short- and long-term effects on these ion transporters. The transcriptional effects of aldosterone on ENaC and the Na+-K+-ATPase occur after 4 h; these late effects of aldosterone on ion transport are well characterized (34). The more immediate transcriptional effects of aldosterone have not been fully investigated, but certain candidate genes have been identified. For example, aldosterone induces the expression of the serum and glucocorticoid-regulated kinase (sgk) as soon as 30 min after hormone treatment (19, 27). sgk has been linked to increases in both the number and the activity of ENaC (5). Expression of sgk in Xenopus laevis oocytes results in a threefold increase in the number of functional ENaCs at the cell surface (2). sgk-mediated phosphorylation of the ubiquitin ligase Nedd4 leads to inhibition of ENaC subunit degradation and therefore an increase in ENaC activity (7, 27). Aside from sgk, there is limited information on early aldosterone-responsive genes. Serial analysis of gene expression technology has recently been used to identify 34 aldosterone-induced transcripts and 29 aldosterone-repressed transcripts in a mouse kidney cortical collecting duct cell line after 4 h of aldosterone treatment (24). However, the acute transcriptional effects of aldosterone should occur in a much shorter time frame.

Studies with primary cultures derived from the inner medullary collecting duct (IMCD) have suggested that this is a target epithelium for the action of aldosterone and may be an important terminal site of Na+ absorption and acid secretion in the collecting duct (28, 29, 35). There is a dramatic increase in Na+ transport in cultured IMCD cells in response to aldosterone (12, 13). However, the factors that mediate the acute effects of aldosterone largely remain to be defined.

Previous studies that have examined the early aldosterone-responsive genes used nonmammalian cell lines or considered responses several hours after exposure to the hormone (24, 30). Here, we report the use of microarray technology to analyze a mouse kidney IMCD cell line (mIMCD3) for acute aldosterone regulation after 1 h of exposure to the hormone. Numerous, previously unreported aldosterone-regulated transcripts have been identified using this method, and the regulation of selected genes has been verified using traditional biochemical approaches. These findings represent a novel list of early aldosterone-regulated transcripts.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue culture. mIMCD3 cells between passages 15 and 25 were used for all experiments. Cells were grown in a T-75 flask (Corning) in DMEM-F-12 media plus 10% FBS (Invitrogen) before being plated on collagen-coated Costar Transwell-COL inserts (Fisher) in DMEM-F-12 plus 10% FBS. Cells were grown 1 day past confluency. Twenty-four hours before treatment with aldosterone, the media were changed to phenol red-free DMEM-F-12 (Invitrogen) plus 10% charcoal/dextran-stripped FBS (Biosource). Cells grown for this length of time on Transwell-COL inserts typically exhibit a transepithelial resistance of 703.3 ± 24.7 {Omega}/cm2 (Xia S.-L., personal communication). Cells were treated for varying lengths of time with vehicle (ethanol) or aldosterone (Sigma) at concentrations ranging from 1010 to 106 M. Inhibitor studies were performed using 1 µM mifepristone (RU-486) and/or 1 µM spironolactone (Sigma). For the microarray experiment, cells were treated for 1 h with vehicle or 106 M aldosterone.

RNA isolation. Total RNA was isolated using TRIzol reagent (Invitrogen) essentially according to the manufacturer's instructions with the following modifications. Cells were lysed directly on the Transwell-COL inserts for 5 min using 1 ml of TRIzol reagent/insert. The organic and aqueous phases were separated by centrifugation at 3,200 g for 20 min. RNA was precipitated from the aqueous layer by addition of 3 ml of isopropanol. The solution was allowed to sit at room temperature for 15 min, and then the RNA was pelleted by centrifugation at 3,200 g for 15 min. The RNA pellet was washed in 6 ml of 75% ethanol and resuspended in 100 µl diethyl pyrocarbonate-treated water.

RT-PCR. Two micrograms of total RNA were used in a reverse transcriptase (Superscript II, Invitrogen) reaction primed with random decamers (Ambion). Of the RT reaction, 25% was used as a template in the subsequent PCR reaction. Primers MG24 and MG25 (GCAGATCAGCCTTCAGTTCGTGCGG/CATGCATGGAGTCTAGAAGCTT) were designed based on the published mouse mineralocorticoid receptor (MR; AW910225 [GenBank] ) to amplify a 238-bp product. Primers MG81 and MG82 (GTGCTCTCCCACACCCCCTGCAGC/CTGGCCCCCGTCACTGTGGACAGC) were designed to the published sequence of the {alpha}-subunit of the ENaC (ENaC-{alpha}; AF112185 [GenBank] ) to amplify a 505-bp product. Primers MG83 and MG84 (CTGGAAATCACCAAGGCCCACACG/CAGGAACTGCCCGTGCACGTGCTC) were designed to the published sequence of 11{beta}-hydroxysteroid dehydrogenase type 2 (11{beta}HSD2; NM_008289 [GenBank] ) to amplify a 480-bp product. PCR was performed using Taq PCR Master Mix plus Q solution (Qiagen) and the following cycling parameters: 94°C x 5-min presoak; 25 cycles of 94°C x 30 s, 62.5°C (ENaC-{alpha}) or 61.8°C (11{beta}HSD2) or 56.6°C (MR) x 30 s, 72°C x 1 min; and 72°C x 10-min final extension. Products were purified from a 1% agarose gel and either cloned into the TA cloning vector (pCR2.1, Invitrogen) or sent directly for sequence analysis. Probes for connective tissue growth factor (CTGF), period homolog, sgk, and endothelin were prepared in the manner described above (Table 1). Primer sets were as follows: sgk MG34/35 CCTCCAACCCTCACGCCAAAC/CTTCCAGGAGGTGCCTTGCCG; CTGF KF3/4 CCCCTGTCCGAATCCAGGCTC/GCGCACGTCCATGCTGCATAG; period homolog MG52/53 CACGCGTCCGGCGGAGCTTCTGGG/GGCAATGGAGCTGCTGGGTGGGGA; and preproendothelin MG54/54 GTTCGTGACTTTCCAAGGAGCTCC/CTCAGCTTTCAACTTTGCAACACG.


View this table:
[in this window]
[in a new window]
 
Table 1. Probe generation and comparison of fold-induction values

 

Affymetrix GeneChip. The murine genome array U74Av2 was purchased from Affymetrix through the Interdisciplinary Center for Biotechnology Research at the University of Florida. Using total RNA from aldosterone- or vehicle-treated cells, first- and second-strand syntheses were performed using Invitrogen reagents according to the protocol provided in the Affymetrix GeneChip Expression Analysis Manual. In vitro transcription reactions were then carried out using the BioArray High Yield RNA Transcript Labeling Kit (ENZO). Biotin-labeled CTP and UTP were included in the reaction cocktail. Fragmentation of the cRNA, hybridization, staining, and scanning of the microarray were performed according to the GeneChip Expression Analysis Manual provided by Affymetrix. Three independent microarray experiments were performed.

Affymetrix GeneChip Expression Analysis. Analysis of intensity data was performed using Microarray Suite Version 4 (MAS4; Affymetrix). Global scaling was applied to all arrays such that the mean intensity of each array was equivalent. In global scaling, the raw signal value of each probe cell is multiplied by a scaling factor. The scaling factor is determined by first calculating the mean intensity of each array that is equivalent to the mean raw signal value, minus background, of probe cells, excluding the highest and lowest 2% of values. The mean intensity is multiplied by the scaling factor to equal the target intensity. The target value of all chips was 2,500. The scaled signal from each probe cell was used to generate a quantitative hybridization signal for each gene with MAS4. MAS4 was also used to perform comparison expression analyses to examine the intensity data between two different arrays. Initially, a comparison expression analysis was performed for two samples, untreated and treated, where the untreated cells served as the baseline. MAS4 algorithms, which use both qualitative and quantitative metrics, produced a list of differentially expressed genes. The list was further filtered to include only genes whose expression was altered at least twofold. The experiment was repeated two additional times in independent RNA samples isolated from untreated and treated cells. The scaled signal values from all six hybridization experiments have been deposited in the Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/). The accession numbers are GSM6603, GSM6604, GSM6605, GSM6606, GSM6607, and GSM6623. The data series is represented by the accession number GSE434.

Northern blot analysis. Northern blot analysis was done according to the method of Davis et al. (6). The generation of 32P-labeled probes was performed using the Redi Prime II random labeling kit (Amersham) and 25 ng of template DNA. Blots were washed at 65°C three times for 15 min in wash solution (20 mM Na2HPO4, 1% SDS, pH 7.2). After the washes, blots were exposed to Kodak Biomax MS film for an appropriate length of time. A probe for the mRNA of GAPDH was used to control for loading.

Real-time RT-PCR. Reactions were performed using TaqMan One-Step RT-PCR Master Mix Reagents (Applied Biosystems) according to the manufacturer's instructions. Cycling parameters were as follows: 48°C x 30 min, 95°C x 10-min presoak; 45 cycles of 95°C x 15 s, 60°C x 1 min. Primers and TaqMan probes were generated via Assays-by-Design (Applied Biosystems). The sequences of the primers and probes were as follows: sgk forward CGCCAAGTCCCTCTCAACAA, sgk reverse TTGGCGTGAGGGTTGGA, sgk probe 6FAM TCAACCTGGGTCCGTC MGBNFQ; preproendothelin forward TGCCACCTGGACATCATCTG, preproendothelin reverse CTCCCAGTCCATACGGTACGA, preproendothelin probe 6FAM AACACTCCCGAGCGC MGBFNQ; period homolog forward CCAGGTGTCGTGATTAAATTAGTCA, period homolog reverse GGGCTTTTGAGGTCTGGATAAA, period homolog probe 6FAMTCAGAGACAGGCGTCCT MGBFNQ. As a negative control, TaqMan Rodent GAPDH Control Reagents were used to perform real-time RT-PCR for GAPDH. Reactions were carried out in a DNA Engine Opticon 2 Continuous Fluorescence Detector, and data were analyzed using Opticon Monitor 2 software (MJ Research).

Western blot analysis. mIMCD3 cells were treated as described above with aldosterone or vehicle for 6 h. Cells were trypsinized and collected in PBS. After 5 min of centrifugation at 150 g, cells were resuspended in 1 ml cell lysis buffer (50 mM Tris, pH 7.8, 150 mM NaCl, 1% Nonidet P-40). One hundred fifty micrograms of total cellular protein were run on an 18% Tris-glycine SDS-PAGE gel. Proteins were electrically blotted onto nitrocellulose in transfer buffer [25 mM Tris-base, 192 mM glycine, 20% (vol/vol) methanol, pH 8.3]. Blocking was performed in 5% nonfat milk (Bio-Rad) in TBS plus 0.1% Tween at room temperature for 1 h. To detect endothelin, either a rabbit polyclonal antibody (AB3280, Chemicon) or a mouse monoclonal antibody was used (E0771, Sigma), both at a dilution of 1:1,000. The primary antibody incubation was done in 5% nonfat milk in TBS plus 0.1% Tween overnight at 4°C. Secondary antibody incubation was performed using a 1:5,000 dilution of horseradish peroxidase-linked donkey anti-rabbit or sheep anti-mouse immunoglobulin for 1 h at room temperature in 5% nonfat milk in TBS plus 0.1% Tween. After the secondary antibody incubation, blots were washed three times for 15 min in TBS plus 0.1% Tween (Sigma). Chemiluminescence was used to detect antibody binding via the enhanced chemiluminescence system (Amersham).

Statistical analysis. Values are means ± SE. A two-way ANOVA was performed on the real-time PCR data to compare fluorescence intensity at each time point with control. The Dunnett test for error protection was used with a confidence interval of 95%. A one-way ANOVA was performed on the fold-change data for the inhibitor study to compare each condition with control. The least significant difference test for error protection was used with a confidence interval of 90%. A one-way ANOVA with the Dunnett test for error protection and a confidence interval of 95% was used to evaluate the Western blot analysis fold-change data.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To demonstrate that the mIMCD3 cell line had retained properties reflecting collecting duct cells, the presence of the ENaC-{alpha} was investigated as a representative collecting duct-specific transcript (17). RT-PCR was performed to amplify a 505-bp fragment of ENaC-{alpha} (Fig. 1). The resulting product was gel purified and sequenced; the product was identical to the published ENaC-{alpha} sequence. The presence of this transcript indicated that mIMCD3 cells were indeed representative of the collecting duct.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1. Characterization of mouse inner medullary collecting duct (mIMCD3) cells. Primers were designed according to published sequences to amplify fragments of epithelial Na+ channel (ENaC)-{alpha}, 11{beta}-hydroxysteroid dehydrogenase type 2 (11{beta}HSD2), and mineralocorticoid receptor (MR) from mIMCD3 cells. RT-PCR products were separated on a 1% agarose gel and visualized with ethidium bromide. +/–, Presence or absence of RT and template. In the absence of an RNA template, an equal volume of H2O was used.

 

Next, the aldosterone responsiveness of mIMCD3 cells was assessed. RT-PCR was performed to amplify 480- and 238-bp fragments of 11{beta}HSD2 and the MR, respectively (Fig. 1). 11{beta}HSD2 and the MR represent transcripts specific to aldosterone-responsive cells. The resulting products were gel purified, and their sequences were determined. Both sequences were identical to the published sequence of the transcript in question. Another marker of aldosterone responsiveness is induction of a known aldosterone-responsive transcript, sgk. As a preliminary indication of whether aldosterone regulates sgk in this cell line, cells were treated for 1 h with 106 M aldosterone or vehicle (ethanol), total RNA was isolated, and Northern blot analysis was performed (Fig. 2). Densitometry analysis of the results revealed an approximate fivefold increase in sgk expression over that in control cells (Table 1), a value comparable to levels observed in other studies (19, 27). In summary, mIMCD3 cells were found to be representative of the collecting duct and also to be aldosterone responsive. These cells were therefore selected to study the acute transcriptional effects of aldosterone.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2. Upregulation of serum and glucose-regulated kinase (sgk) by aldosterone. Total RNA was isolated from mIMCD3 cells treated with vehicle or 106 M aldosterone (Aldo) for 1 h. Shown at the top is an ethidium bromide-stained 1% agarose gel containing the RNA samples in which 28S and 18S ribosomal RNA bands are indicated. Northern blot analysis was performed using cDNA probes for sgk (middle) and GAPDH (bottom).

 

Microarray analysis. To prepare RNA samples for microarray analysis, mIMCD3 cells were treated for 1 h with vehicle or 106 M aldosterone. Northern blot analysis for sgk was conducted to confirm the hormone response before the samples were used in the microarray experiments. Three independently prepared sets of control and treated RNA samples were used to generate targets for hybridization of the Affymetrix murine U74Av2 array, an oligonucleotide array that contains probe sets representing 12,000 mouse genes. The expression of numerous genes was affected by aldosterone treatment in mIMCD3 cells. Those transcripts that increased or decreased in the same manner in response to aldosterone in at least two of the three hybridization experiments are listed in Tables 2 and 3, respectively. Numerous expressed sequence tags (ESTs) appeared in the lists of both up- and downregulated transcripts, shown in Tables 2 and 3, respectively. Subsequently, the online Affymetrix analysis tool NetAffx (www.Affymetrix.com) has now identified many of these ESTs; sgk was among the recently annotated ESTs.


View this table:
[in this window]
[in a new window]
 
Table 2. Transcripts downregulated by aldosterone

 

View this table:
[in this window]
[in a new window]
 
Table 3. Transcripts upregulated by aldosterone

 

Analysis of aldosterone-responsive mRNAs. As expected, sgk was upregulated in all three expression analysis experiments. Several other transcripts were consistently upregulated in the expression analysis experiments. These include CTGF, period homolog, and preproendothelin. These three transcripts, along with sgk, were selected as a representative group of upregulated transcripts. Northern blot analyses were performed to confirm the regulation effects indicated by the initial data analysis of the microarray experiments. cDNA probes were constructed by RT-PCR for each of the four transcripts. sgk, CTGF, period homolog, and preproendothelin all showed clear evidence of increased mRNA in response to acute exposure to aldosterone. Northern blot analyses and real-time PCR data suggested greater induction than those calculated from the microarray data (Table 1). No significant changes in expression of GAPDH mRNA, used as a loading control throughout this study, were observed. Of the four transcripts tested, period homolog underwent the greatest induction according to the microarray data, the Northern blot data, and the real-time PCR data. The period homolog transcript was induced more than sevenfold in mIMCD3 cells exposed to aldosterone for 1 h, as measured by Northern blot analysis and real-time PCR.

To examine the effects of a range of aldosterone concentrations, mIMCD3 cells were treated with increasing amounts of the hormone for 1 h (Fig. 3). The most dramatic increase in expression for all transcripts tested was observed after treatment with 106 M aldosterone. Although the concentration of the hormone in these in vitro experiments was greater than the physiological concentration of aldosterone, the actual effective intracellular concentration was probably much lower. Recent studies have indicated that steroid hormones may not diffuse across cell membranes as freely as was once thought (23).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 3. Dose-response to aldosterone. mIMCD3 cells were treated for 1 h with vehicle or increasing concentrations of aldosterone (from 1010 to 106 M). The 28S and 18S ribosomal RNA bands are indicated. Northern blot analysis of RNA samples was performed using probes for the transcripts indicated. CTGF, connective tissue growth factor.

 

The next experiments examined the levels of expression of sgk, CTGF, period homolog, and preproendothelin as a function of time. Northern blot analysis results revealed that all four messages show a clear increase in expression after 1 h (Fig. 4). sgk mRNA decreased over the next 12 h and then showed a sharp increase beyond 24 h. A similar pattern was observed for CTGF message. In contrast, period homolog expression slightly decreased at 6 h and then remained relatively low for the duration of the experiment. Preproendothelin mRNA showed a biphasic response similar to sgk and CTGF, but with different timing. The recovery of preproendothelin mRNA was evident at 12 h and continued to increase. To control for a feeding effect, cells were treated with vehicle alone over these same time points. Northern blot analysis of these samples did not show any significant changes in expression of any of the four transcripts tested (data not shown).



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 4. Time course of responses to aldosterone. mIMCD3 cells were treated with 106 M aldosterone for the time periods indicated. The 28S and 18S ribosomal RNA bands are indicated. Northern blot analysis of RNA samples from vehicle or aldosterone-treated cells was conducted using probes for the transcripts indicated.

 

To further validate, in a quantitative manner, the time-course Northern blot analysis results, real-time PCR was performed using the same RNA samples as a template (Fig. 5). Expression patterns similar to those seen in the Northern blot analysis were observed for all transcripts tested. sgk showed a sharp fivefold increase at 1 h, which decreased to threefold at 6 h. The level of sgk transcript continued to climb from 12 to 48 h, hitting a peak of approximately sevenfold at the final time point. Period homolog peaked at 1 h with an increase of greater than sevenfold. Period homolog levels then dropped and stayed between three- and fourfold for the remainder of the experiment. Preproendothelin showed a gradual increase from threefold at 1 h to a peak of greater than sixfold at 12 h. Preproendothelin levels remained high for the duration of the experiment. GAPDH showed no significant changes in expression over time.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5. Real-time PCR analysis of time course. RNA samples from duplicate time course experiments were used as template in duplicate real-time RT-PCR reactions. Time of aldosterone treatment is indicated. Stippled bars, sgk; vertically striped bars, period homolog; checkered bars, preproendothelin; diagonally hatched bars, GAPDH. Values are means ± SE; n = 4. *Significantly different from control, P < 0.05.

 

The effects of aldosterone can be mediated through the MR as well as the glucocorticoid receptor (GR). The effects of GR and MR often overlap, and the two receptors can heterodimerize to drive transcription of some genes (3, 8). It has previously been shown in primary cultures of IMCD cells that either MR or GR can activate electrogenic Na+ transport (12). Specific inhibitors of both receptors were used alone or in combination to determine the contribution of each to the aldosterone-mediated changes in gene expression (Fig. 6). Densitometry analysis of repeated Northern blot data demonstrated similar patterns of expression for all messages tested. MR and GR inhibitors, used alone or in combination, dropped expression to levels that were not significantly different from control. Use of GR- or MR-specific inhibitors suggested, then, that both receptors contribute to the aldosterone-mediated effects on gene expression in mIMCD3 cells. This is not a surprising result, given that MR and GR are known to heterodimerize with each other.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6. Effect of mineralocorticoid and glucocorticoid receptor inhibitors. mIMCD3 cells were treated for 1 h with vehicle, 106 M aldosterone (A), aldosterone plus 106 M mifepristone (A+M), aldosterone plus 106 M spironolactone (A+S), or aldosterone plus mifepristone and spironolactone (A+M+S). Densitometry was performed on repeated Northern blot analysis data. All values were normalized against GAPDH mRNA levels. Stippled bars, sgk; diagonally striped bars, CTGF; vertically striped bars, period homolog; checkered bars, preproendothelin. Values are means ± SE; n = 3. *Significantly different from control, P < 0.1.

 

Induction of preproendothelin. To correlate protein expression with the changes in mRNA levels, a cell lysate was prepared from aldosterone- or vehicle-treated cells after 6 h of hormone exposure. Western blot analysis was conducted using a monoclonal antibody raised against endothelin-1. A representative blot is pictured in Fig. 7A. In addition, an anti-endothelin-1 polyclonal antibody was used (data not shown). Both antibodies recognized the same band at ~23 kDa, which is the expected size of unprocessed preproendothelin. As determined by densitometry, preproendothelin protein levels were increased more than fivefold in aldosterone-treated cells compared with control cells in four independent experiments (Fig. 7B). Equal loading of samples was visualized on a duplicate gel stained with Coomassie brilliant blue (data not shown).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 7. Increased preproendothelin protein expression in aldosterone-treated cells. A: mIMCD3 cells were treated for 6 h with vehicle or 1061 M aldosterone. Western blot analysis was performed on cell lysates using a monoclonal antibody raised against endothelin. Equal loading was visualized on a duplicate gel stained with Coomassie brilliant blue. B: densitometry analysis was performed on repeated Western blot analysis data. Values are means ± SE; n = 4. *Significantly different from control, P < 0.05.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The late effects of aldosterone on ion channels and transporters such as ENaC and the Na+-K+-ATPase have been well characterized, but the genes that are immediately affected by aldosterone are not as well known. We have used oligonucleotide array technology to examine the effects of aldosterone on gene expression after 1 h in a mouse IMCD cell line. Not surprisingly, the results of three hybridization experiments suggested that the expression of numerous genes changed in aldosterone-treated cells compared with control cells. Northern blot analysis directly confirmed the upregulation of sgk, CTGF, period homolog, and preproendothelin transcripts. Time course studies showed a biphasic response of sgk and preproendothelin mRNAs to aldosterone treatment, indicating that aldosterone signaling is complex in mIMCD3 cells, with a long-term component in addition to the acute response. The use of MR- and GR-specific inhibitors indicated that both receptors contribute to the aldosterone-mediated regulation of the transcripts tested. Western blot analysis demonstrated that the increases in preproendothelin mRNA levels also resulted in increased levels of protein expression.

The human genes for sgk (36), CTGF (26), period homolog (33) and preproendothelin (14) have been reported. Acute transcriptional regulation suggested that each gene should be directly under the control of a hormone receptor, so the human gene promoters were examined for sterol-response elements (SREs) using the TRANSFAC program (10). Apparent SRE sequences were found in all four promoters. These sites matched the consensus sequence ATCACCCCAC (16), with a threshold value of at least 80%. Whether these SREs mediate the acute effects of aldosterone in IMCD3 cells remains to be seen.

These findings represent a novel list of aldosterone-regulated transcripts. The physiological significance of these studies must be viewed at two levels. The first level is composed of the immediate mediators of aldosterone action. Endothelin and CTGF have emerged from the present study as two candidates that may underlie the mechanism of the known physiological actions of aldosterone; these actions are the enhancement of renal net acid excretion with the attendant metabolic alkalosis and the effects of aldosterone on cardiac and renal fibrosis.

The second level is only made possible with the use of oligonucleotide array technology, which enables us to examine the global, genomic effects of aldosterone. Although caution must be exercised because these effects reflect changes at the mRNA level, several of the transcripts listed in Tables 2 and 3 have well-known functions and, in many cases, are part of well-established signaling pathways. Three independent methods, i.e., microarray analysis, Northern blot analysis, and real-time PCR, were used to validate the aldosterone responsiveness of sgk, period homolog, and preproendothelin. Induction of CTGF was verified by two of these methods. The consistent aldosterone-mediated response of these transcripts lends validity to the remaining transcripts on the lists. The aldosterone-induced and -repressed transcripts contain several kinases, transcription factors, and signaling proteins. It is becoming apparent that these molecules must play a vital role in mediating aldosterone action by regulating existing transporters or causing changes in the expression of transporters.

To our knowledge, these results represent the first investigation into aldosterone regulation as early as 1 h after treatment using microarray technology. Previous studies (24) examined the effect of aldosterone at 4 h, at which time the most immediate effects of aldosterone have likely already occurred. There are far-reaching implications of these genes being regulated by a mineralocorticoid. Recently, a role for sgk in Na+ absorption was proposed. When coexpressed with ENaC, sgk is able to stimulate Na+ current (22). In addition, sgk activity has been shown to lead to translocation of ENaC subunits to the apical membrane (18). CTGF functions in several renal diseases (38). Increased expression of CTGF was observed in diabetic nephropathy and glomerulonephritis (15). Period homolog regulates circadian rhythms, and at least one other circadian rhythm gene, Per 2, also appeared in the list of upregulated transcripts. Expression of period homolog in the kidney has been observed previously, and a circadian pattern of expression in the suprachiasmatic nucleus was also seen (32).

Preproendothelin undergoes significant posttranslational processing with enzymatic hydrolysis by two enzymes before the production of the active form, a 21-amino acid peptide (1). Endothelin-1 is a peptide hormone secreted by vascular endothelial cells and is the most potent vasoconstrictor known. In the mature animal, endothelin-1 has other effects aside from vasoconstriction. Most notably, endothelin-1 has been shown to affect both Na+ transport (9) and H+ secretion (37) in the collecting duct. In addition, evidence supports the role of endothelin-1 in the pathogenesis of renal interstitial fibrosis, K+ depletion, and diabetic nephropathy (11). Aldosterone is a known stimulator of H+ secretion (20). The finding that preproendothelin is one of the early genes stimulated by aldosterone suggests an important role for this hormone as a mediator of aldosterone action. Given aldosterone's known effect on cardiac fibrosis (25) and our observation that aldosterone also stimulates CTGF, a more coordinated action of aldosterone may emerge from these studies. Further investigation into the relationship among aldosterone, CTGF, and endothelin-1 must be made to elucidate the mechanisms governing each of their roles in cardiovascular disease.

The expression of several additional transcripts was affected by aldosterone as described by the microarray data, and these effects remain to be confirmed and studied. The identity of these genes indicates that the aldosterone-signaling pathways are more complex than previously thought. Subsequent investigation into the functions of these early-response genes, together with the results presented here, will provide greater insight into the signaling pathways initiated by aldosterone and will further clarify our knowledge of the critical role aldosterone plays in regulating ion homeostasis and cardiovascular disease.


    DISCLOSURES
 
This work was supported by Public Health Service Grant RO1-54721 (to B. D. Cain), Department of Veteran Affairs Merit Review Award 0001 (to C. S. Wingo), and National Institute of Diabetes and Digestive and Kidney Diseases Training Grant DK-07518 (to M. L. Gumz.).


    ACKNOWLEDGMENTS
 
We thank Dr. Rena Bahjat for assistance with statistical analysis programs.


    FOOTNOTES
 

Address for reprint requests and other correspondence: B. D. Cain, Dept. of Biochemistry and Molecular Biology, PO Box 100245, Gainesville, FL 32610-0245 (E-mail: bcain{at}biochem.med.ufl.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Agapitov AV and Haynes WG. Role of endothelin in cardiovascular disease. J Renin Angiotensin Aldosterone Syst 3: 1–15, 2002.[Abstract/Free Full Text]
  2. Alvarez de la Rosa D, Zhang P, Naray-Fejes-Toth A, Fejes-Toth G, and Canessa CM. The serum and glucocorticoid kinase sgk increases the abundance of epithelial sodium channels in the plasma membrane of Xenopus oocytes. J Biol Chem 274: 37834–37839, 1999.[Abstract/Free Full Text]
  3. Arriza JL, Weinberger C, Cerelli G, Glaser TM, Handelin BL, Housman DE, and Evans RM. Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237: 268–275, 1987.[Abstract/Free Full Text]
  4. Booth RE, Johnson JP, and Stockand JD. Aldosterone. Adv Physiol Educ 26: 8–20, 2002.[Abstract/Free Full Text]
  5. Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, and Pearce D. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci USA 96: 2514–2519, 1999.[Abstract/Free Full Text]
  6. Davis LG, Kuehl WM, and Battey JF. Basic Methods in Molecular Biology (2nd ed.). Norwalk, CT: Appleton and Lange, 1994.
  7. Debonneville C, Flores SY, Kamynina E, Plant PJ, Tauxe C, Thomas MA, Munster C, Chraibi A, Pratt JH, Horisberger JD, Pearce D, Loffing J, and Staub O. Phosphorylation of Nedd4–2 by Sgk1 regulates epithelial Na+ channel cell surface expression. EMBO J 20: 7052–7059, 2001.[ISI][Medline]
  8. Farman N and Rafestin-Oblin ME. Multiple aspects of mineralocorticoid selectivity. Am J Physiol Renal Physiol 280: F181–F192, 2001.[Abstract/Free Full Text]
  9. Gallego MS and Ling BN. Regulation of amiloride-sensitive Na+ channels by endothelin-1 in distal nephron cells. Am J Physiol Renal Fluid Electrolyte Physiol 271: F451–F460, 1996.[Abstract/Free Full Text]
  10. Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA, Podkolodny NL, and Kolchanov NA. Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26: 362–367, 1998.[Abstract/Free Full Text]
  11. Hocher B, Lun A, Priem F, Neumayer HH, and Raschack M. Renal endothelin system in diabetes: comparison of angiotensin-converting enzyme inhibition and endothelin-A antagonism. J Cardiovasc Pharmacol 31: S492–S495, 1998.[Medline]
  12. Husted RF, Laplace JR, and Stokes JB. Enhancement of electrogenic Na+ transport across rat inner medullary collecting duct by glucocorticoid and by mineralocorticoid hormones. J Clin Invest 86: 498–506, 1990.[ISI][Medline]
  13. Husted RF and Stokes JB. Separate regulation of Na+ and anion transport by IMCD: location, aldosterone, hypertonicity, TGF-{beta}1, and cAMP. Am J Physiol Renal Fluid Electrolyte Physiol 271: F433–F439, 1996.[Abstract/Free Full Text]
  14. Inoue A, Yanagisawa M, Takuwa Y, Mitsui Y, Kobayashi M, and Masaki T. The human preproendothelin-1 gene. Complete nucleotide sequence and regulation of expression. J Biol Chem 264: 14954–14959, 1989.[Abstract/Free Full Text]
  15. Ito Y, Aten J, Bende RJ, Oemar BS, Rabelink TJ, Weening JJ, and Goldschmeding R. Expression of connective tissue growth factor in human renal fibrosis. Kidney Int 53: 853–861, 1998.[ISI][Medline]
  16. Kim JB, Spotts GD, Halvorsen YD, Shih HM, Ellenberger T, Towle HC, and Spiegelman BM. Dual DNA binding specificity of ADD1/SREBP1 controlled by a single amino acid in the basic helix-loop-helix domain. Mol Cell Biol 15: 2582–2588, 1995.[Abstract]
  17. Loffing J, Pietri L, Aregger F, Bloch-Faure M, Ziegler U, Meneton P, Rossier BC, and Kaissling B. Differential subcellular localization of ENaC subunits in mouse kidney in response to high- and low-Na diets. Am J Physiol Renal Physiol 279: F252–F258, 2000.[Abstract/Free Full Text]
  18. Loffing J, Zecevic M, Feraille E, Kaissling B, Asher C, Rossier BC, Firestone GL, Pearce D, and Verrey F. Aldosterone induces rapid apical translocation of ENaC in early portion of renal collecting system: possible role of SGK. Am J Physiol Renal Physiol 280: F675–F682, 2001.[Abstract/Free Full Text]
  19. Naray-Fejes-Toth A, Canessa C, Cleaveland ES, Aldrich G, and Fejes-Toth G. sgk is an aldosterone-induced kinase in the renal collecting duct. Effects on epithelial Na+ channels. J Biol Chem 274: 16973–16978, 1999.[Abstract/Free Full Text]
  20. Oberleithner H, Steigner W, Silbernagl S, Vogel U, Gstraunthaler G, and Pfaller W. Madin-Darby canine kidney cells. III. Aldosterone stimulates an apical H+/K+ pump. Pflügers Arch 416: 540–547, 1990.[ISI][Medline]
  21. Pan YJ and Young DB. Experimental aldosterone hypertension in the dog. Hypertension 4: 279–287, 1982.[Abstract/Free Full Text]
  22. Pearce D, Verrey F, Chen SY, Mastroberardino L, Meijer OC, Wang J, and Bhargava A. Role of SGK in mineralocorticoid-regulated sodium transport. Kidney Int 57: 1283–1289, 2000.[ISI][Medline]
  23. Pietras RJ, Nemere I, and Szego CM. Steroid hormone receptors in target cell membranes. Endocrine 14: 417–427, 2001.[ISI][Medline]
  24. Robert-Nicoud M, Flahaut M, Elalouf JM, Nicod M, Salinas M, Bens M, Doucet A, Wincker P, Artiguenave F, Horisberger JD, Vandewalle A, Rossier BC, and Firsov D. Transcriptome of a mouse kidney cortical collecting duct cell line: effects of aldosterone and vasopressin. Proc Natl Acad Sci USA 98: 2712–2716, 2001.[Abstract/Free Full Text]
  25. Rossi GP, Cavallin M, Nussdorfer GG, and Pessina AC. The endothelin-aldosterone axis and cardiovascular diseases. J Cardiovasc Pharmacol 38, Suppl 2: S49–S52, 2001.
  26. Ryseck RP, Macdonald-Bravo H, Mattei MG, and Bravo R. Structure, mapping, and expression of fisp-12, a growth factor-inducible gene encoding a secreted cysteine-rich protein. Cell Growth Differ 2: 225–233, 1991.[Abstract]
  27. Shigaev A, Asher C, Latter H, Garty H, and Reuveny E. Regulation of sgk by aldosterone and its effects on the epithelial Na+ channel. Am J Physiol Renal Physiol 278: F613–F619, 2000.[Abstract/Free Full Text]
  28. Sonnenberg H, Cheema-Dhadli S, Goldstein MB, Stinebaugh BJ, Wilson DR, and Halperin ML. Ammonia addition into the medullary collecting duct of the rat. Kidney Int 19: 281–287, 1981.[ISI][Medline]
  29. Sonnenberg H and Chong C. Comparison of micropuncture of microcatheterization in papillary collecting duct. Am J Physiol Renal Fluid Electrolyte Physiol 239: F95–F105, 1980.[Abstract]
  30. Spindler B, Mastroberardino L, Custer M, and Verrey F. Characterization of early aldosterone-induced RNAs identified in A6 kidney epithelia. Pflügers Arch 434: 323–331, 1997.[ISI][Medline]
  31. Stockand JD. New ideas about aldosterone signaling in epithelia. Am J Physiol Renal Physiol 282: F559–F576, 2002.[Abstract/Free Full Text]
  32. Sun ZS, Albrecht U, Zhuchenko O, Bailey J, Eichele G, and Lee CC. RIGUI, a putative mammalian ortholog of the Drosophila period gene. Cell 90: 1003–1011, 1997.[ISI][Medline]
  33. Taruscio D, Zoraqi GK, Falchi M, Iosi F, Paradisi S, Di Fiore B, Lavia P, and Falbo V. The human per1 gene: genomic organization and promoter analysis of the first human orthologue of the Drosophila period gene. Gene 253: 161–170, 2000.[ISI][Medline]
  34. Verrey F, Pearce D, Pfeiffer R, Spindler B, Mastroberardino L, Summa V, and Zecevic M. Pleiotropic action of aldosterone in epithelia mediated by transcription and posttranscription mechanisms. Kidney Int 57: 1277–1282, 2000.[ISI][Medline]
  35. Volk KA, Sigmund RD, Snyder PM, McDonald FJ, Welsh MJ, and Stokes JB. rENaC is the predominant Na+ channel in the apical membrane of the rat renal inner medullary collecting duct. J Clin Invest 96: 2748–2757, 1995.[ISI][Medline]
  36. Waldegger S, Erdel M, Nagl UO, Barth P, Raber G, Steuer S, Utermann G, Paulmichl M, and Lang F. Genomic organization and chromosomal localization of the human SGK protein kinase gene. Genomics 51: 299–302, 1998.[ISI][Medline]
  37. Wesson DE and Dolson GM. Endothelin-1 increases rat distal tubule acidification in vivo. Am J Physiol Renal Physiol 273: F586–F594, 1997.[Abstract/Free Full Text]
  38. Yokoi H, Mukoyama M, Sugawara A, Mori K, Nagae T, Makino H, Suganami T, Yahata K, Fujinaga Y, Tanaka I, and Nakao K. Role of connective tissue growth factor in fibronectin expression and tubulointerstitial fibrosis. Am J Physiol Renal Physiol 282: F933–F942, 2002.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Physiol.Home page
M. Bertog, J. E. Cuffe, S. Pradervand, E. Hummler, A. Hartner, M. Porst, K. F. Hilgers, B. C. Rossier, and C. Korbmacher
Aldosterone responsiveness of the epithelial sodium channel (ENaC) in colon is increased in a mouse model for Liddle's syndrome
J. Physiol., January 15, 2008; 586(2): 459 - 475.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Li, C. S. Wingo, and S.-L. Xia
Downregulation of SGK1 by nucleotides in renal tubular epithelial cells
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1751 - F1757.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. A. Strait, P. K. Stricklett, J. L. Kohan, M. B. Miller, and D. E. Kohan
Calcium regulation of endothelin-1 synthesis in rat inner medullary collecting duct
Am J Physiol Renal Physiol, August 1, 2007; 293(2): F601 - F606.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon
(Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.
Physiol Rev, October 1, 2006; 86(4): 1151 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. Zhang, X. Xia, D. I. Jalal, T. Kuncewicz, W. Xu, G. D. Lesage, and B. C. Kone
Aldosterone-sensitive repression of ENaC{alpha} transcription by a histone H3 lysine-79 methyltransferase
Am J Physiol Cell Physiol, March 1, 2006; 290(3): C936 - C946.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
C. Saha, G. J. Eckert, W. T. Ambrosius, T.-Y. Chun, M. A. Wagner, Q. Zhao, and J. H. Pratt
Improvement in Blood Pressure With Inhibition of the Epithelial Sodium Channel in Blacks With Hypertension
Hypertension, September 1, 2005; 46(3): 481 - 487.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Klar, H. Vitzthum, and A. Kurtz
Aldosterone enhances renin gene expression in juxtaglomerular cells
Am J Physiol Renal Physiol, February 1, 2004; 286(2): F349 - F355.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/F664    most recent
00353.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (23)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gumz, M. L.
Right arrow Articles by Cain, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gumz, M. L.
Right arrow Articles by Cain, B. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.