|
|
||||||||
Institutes of 1Physiology and 2Anatomy, University of Zürich, 8057 Zürich, Switzerland; and 3Department of Toxicology, University of Zaragoza, E-50.013 Zaragoza, Spain
Submitted 19 March 2003 ; accepted in final form 26 June 2003
| ABSTRACT |
|---|
|
|
|---|
interacting proteins; Na/Pi cotransport; PDZ proteins; NHERF-1; opossum kidney cells
To explore the interactions of NaPi-IIa in more detail, we attempted to find proteins that interact with the NH2 terminus of NaPi-IIa. Results obtained by a yeast two-hybrid screen against a mouse kidney cDNA library suggested that MAP17, a 17-kDa membrane-associated protein, interacts with the NH2 terminus of NaPi-IIa. MAP17 was earlier identified based on differential display performed with mRNA isolated from normal and carcinogenic tissues and was documented to be upregulated in various human carcinomas originating from the colon, breasts, lung, and kidney (15, 16). Interestingly, MAP17 was also detected in normal tissue, such as renal proximal tubules (15), and was shown to interact with the PDZ protein PDZK1 (10, 15). Moreover, MAP17 was shown to be part of the heteromultimeric protein complex formed by the PDZ protein PDZK1 and the multidrug resistance-associated protein MRP2 (17). The interaction with PDZK1 is suggested to be via the last three amino acids (TPM) contained in the COOH terminus of MAP17, representing a PDZ binding domain (17).
The physiological role of MAP17 in proximal tubules is not known. In the present study, we therefore further investigated the interaction pattern of MAP17 with known PDZ proteins located in the apical/subapical site of proximal tubular cells. Our results demonstrated that MAP17 interacts only with PDZK1 and that within this protein complex MAP17 may interact with the NH2 terminus of NaPi-IIa. Furthermore, based on results obtained from transfection studies using OK cells, we conclude that the apical location of MAP17 is not dependent on its interaction with PDZK1.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
All baits were expressed in Saccharomyces cerevisiae (L40)
containing his3 and lacZ reporter genes
(29). Transformations were
performed by the LiAc/SS-DNA/PEG procedure using 1 µg of plasmid
(8,
11). Yeast transformants were
grown on synthetic medium lacking leu, trp, and his for 4
days, and expression of LacZ was assayed by a filter assay
(7) using
5-bromo-4-chloro-3-indolyl
-D-galactopyranoside (Alexis,
Lausen, Switzerland). Single, positive clones were rescued by electroporation
into E. coli KC8 cells as described
(13).
GST fusion constructs and pull-down experiments. The construction
of GST fusions with full-length PDZK1, NaPi-Cap2, and NHERF-1 has been
previously described (11).
Pull-downs were performed using proximal tubular brush border membrane
vesicles (BBMV) isolated from mice kidney
(5). BBMV were solubilized in
binding buffer (50 mM Tris·HCl, 120 mM NaCl, 0.5% Igepal CA-630; pH 8)
for 5 min at 4°C and centrifuged at 16,000 g for 3 min.
Preequilibrated glutathione-agarose beads (Sigma, Buchs, Switzerland) were
loaded with GST-fused proteins (
2 µg) and incubated by rocking with
0.050.3 mg of solubilized BBMV protein for 1 h at 4°C. After four
washing steps with binding buffer, the samples were analyzed by Western blot
analysis.
Immunofluorescence and Western blots. Tissue distributions of various proteins in kidneys of 8- to 12-wk-old mice (NMRI, Janvier, France) were assayed by immunofluorescence as described (23). All animals used were kept on a standard chow with free access to tap water. Some animals were fed for 5 days with low- or high-phosphate diet or injected with parathyroid hormone (bovine, 134 PTH; Bachem, Bubendorf, Switzerland) as described by Bacic et al. (1).
Cryosections of 5-µm thickness were incubated with the following primary antibodies. MAP17 was detected by a custom-made rabbit antiserum raised against a cytoplasmatic COOH-terminal peptide (17-mer) of mouse MAP17 or by affinity-purified polyclonal antibodies directed against the COOH terminus of human MAP17 (kindly provided by Dr. O. Kocher, see Ref. 16; both used with a dilution 1:1,000). NaPi-IIa (1:1,000) and PDZK1 (1:500) were detected using polyclonal antisera raised against the NH2 terminus of each (6, 11).
For Western blots, isolated proximal tubular BBMV proteins were separated on SDS-PAGE gels, transferred to nitrocellulose membranes, and processed as previously described (6). The blots were incubated overnight at 4°C with primary antibody (MAP17 1:3,000) and subsequently with secondary HRP-coupled IgGs (Amersham Pharmacia Biotech Europe GmbH, Dübendorf, Switzerland). Immunoreactivity was visualized by enhanced chemiluminescence (Pierce, Socochim SA, Lausanne, Switzerland).
Cell culture, transfections, and immunostainings. OK cells (clone 3B/2) were cultured, transfected, and analyzed by confocal microscopy as described previously (12, 25). Where indicated, cells were transfected with NH2-terminally tagged myc-PDZK1 (12), HA-MAP17 (HA-tag positioned between Met65 and Met66 of the original rat clone, accession no. AF402772 [GenBank] ) or HA-MAP17 lacking the last three amino acids (TPM). HA-MAP17-TPM was produced by site-directed mutagenesis (Quick change, Stratagene GmbH, Basel, Switzerland), introducing a stop codon TGA at the position 3. All transfections were done in the presence of Lipofectamine (GIBCO BRL, Basel, Switzerland). After reaching confluency, transfected cells were processed for staining with antibodies against the endogenus NaPi-IIa cotransporter NaPi-4 (1:100) (21), MAP17 (1:100), HA (1:1,000), or myc (1:5,000) epitopes (Sigma and Invitrogen AG, Basel, Switzerland, respectively), as well as phalloidin-AlexaFluor (1:20; Molecular Probes, Juro, Luzern, Switzerland) for actin. Swine anti-rabbit FITC-IgG (1:50; Sigma) and goat or donkey anti-mouse Cy3-IgG (1:500) and Texas Red (1:200) (Jackson, Milan, Italy) were used as secondary markers.
mRNA content in nephron segments. Mice (males, NMRI, 8 wk old)
were fed a high (1.2% P)- or a low (0.1% P)-phosphate diet for 5 days. Each
group consisted of three animals. Animals were killed, and single kidneys were
prepared for laser microdissection as described by Gisler et al.
(9). Briefly, both S1 and S3
segments of superficial and juxtamedullary nephrons were identified by
phase-contrast microscopy. A total area corresponding to 100,000
µm2 (+/ 1%) was microdissected for each sample, and RNA
was extracted (Absolutely RNA Nanoprep Kit, Stratagene GmbH). First-strand
cDNA synthesis in a reaction volume of 50 µl was made from total RNA using
TaqMan Reverse Transcription Reagents (Applied Biosystems, Rotkreutz,
Switzerland) with random hexameres according to the manufacturer's protocol.
Relative quantization of MAP17 mRNA was achieved by using ABI PRISM 7700
Sequence Detection System (Applied Biosystems) with
-actin as an
internal standard. Expression means obtained from three animals per sample
group were averaged, and one-way ANOVA with Student-Newman-Keuls multiple
comparisons test was applied for statistical analysis between S1 and S3
segments. A probability of P < 0.05 was taken to be statistically
significant.
The sequences of TaqMan probes (Biosearch Technologies, Novato,
CA) and primers (Microsynth, Balgach, Switzerland) were as follows:
5'-(6-FAM) TCCCAGGCTCCGGCTCCTCCT (BHQ-1)-3' (probe),
5'-AGGACCCCATCTGCCTTGTT-3' (forward),
5'-CTTCGCCGTCAACCACTTCT-3' (reverse) for MAP17, 5'-(6-FAM)
CCATGAAGATCAAGATCATTGCTCCTCCT (BHQ-1)-3' (probe),
5'-GACAGGATGCAGAAGGAGATTACTG-3' (forward), and
5'-CCACCGATCCACACAGAGTACTT-3' (reverse) for
-actin.
TaqMan probes were chosen to be located across exon-exon boundaries
to exclude any amplification of genomic DNA. PCR reaction was performed as
described previously in detail
(9). Relative MAP17 expression
was calculated with the standard curve method (ABI PRISM 7700 Sequence
Detection System, user bulletin #2). Standard curves for MAP17 and
-actin were generated using total kidney mouse RNA.
| RESULTS |
|---|
|
|
|---|
|
|
Further analyses concerning the renal distribution and expression of MAP17
were performed with renal tissue obtained from animals kept under normal
conditions. As revealed by immunofluorescence
(Fig. 2), MAP17 was localized
in kidney cortex only, exhibiting similar abundances in proximal tubules of
superficial and juxtamedullar nephrons, and was absent in medullary rays and
in the outer stripe of the outer medulla. Highest intensity was observed in S1
segments and gradually decreased toward the S3 segments. Often, in latter
segments, the presence of MAP17 was not detectable. Overall, the distribution
of MAP17 was found to be similar to that of the type IIa Na/Pi-cotransporter
(Fig. 2A). In contrast
to MAP17 and NaPi-IIa, PDZK1-mediated immunostaining was observed of equal
intensity along the entire proximal segments of all nephron generations
(Fig. 2A). As seen at
higher magnification, MAP17 entirely overlapped with NaPi-IIa and PDZK1 in the
brush borders of S1 segments (Fig.
2B). Additionally, we determined the content of MAP17
mRNA relatively to that of
-actin in S1 and S3 segments, which were
collected by laser microdissection. As illustrated in
Fig. 3, highest amount of MAP17
mRNA was found in the S1 segments of both superficial and deep nephrons.
Although MAP17 was not detectable in S3 segments by immunofluorescence, the
mRNA content was still around 50% of that found in the S1 segments.
|
|
Several factors were shown to regulate the brush border content of NaPi-IIa (14, 22, 24, 28). To investigate whether the abundance of MAP17 may be influenced similarly, mice were treated with parathyroid hormone or fed diets containing a high or a low amount of phosphate. As indicated in Fig. 4, NaPi-IIa was to a large extent downregulated by parathyroid hormone, yet the distribution of MAP17 remained unchanged. Similarly, the distribution of PDZK1 was not affected by parathyroid hormone. A comparison of the abundances of these proteins between renal tissues obtained from mice fed either a high- or a low-Pi diet also showed a change of the NaPi-IIa abundance but no changes of MAP17 or PDZK1. Real-time PCR experiments demonstrated that the amount of MAP17 mRNA in different proximal tubular segments did not change by a low-phosphate diet compared with a high-phosphate diet (Fig. 3).
|
The interaction of MAP17 with PDZK1 was further investigated in OK cells. These cells were chosen because of their endogenous apical expression of the type IIa Na/Pi-cotransporter and NHERF-1 (12, 25), whereas neither the presence of endogenous PDZK1 nor MAP17 could be demonstrated (12; Sorribas V, unpublished data). As shown in Fig. 5A, after transfection of HA-tagged MAP17 (HA-MAP17), it localized in the apical membrane and colocalized with NaPi-IIa within the actin-containing apical patches. After truncation of the COOH-terminal PDZ-binding domain (TPM) of MAP17, the apical appearance was not completely prevented (HA-MAP17-TPM; Fig. 5B2) and in most transfected cells HA-MAP17-TPM was observed in the cytoplasm (Fig. 5B1). Whether the presence of MAP17 in the apical membrane of OK cells (see Fig. 5A) would affect the inhibition of Na/Pi cotransport by parathyroid hormone was investigated by phosphate uptake measurements. Results obtained showed that MAP17 (at a transfection efficiency >50%) did not influence the kinetic of parathyroid hormone-mediated inhibition of Na/Pi cotransport (not shown).
|
In contrast to MAP17, myc-tagged PDZK1 was, after transfection, found to be distributed throughout the cytoplasm of OK cells (Ref. 12 and Fig. 6A1), suggesting that apical anchoring sites for PDZK1 in OK cells are missing. To test this possibility, OK cells were cotransfected with HA-MAP17 and myc-PDZK1. As shown in Fig. 6, A2-A4, in the presence of HA-MAP17, myc-PDZK1 colocalized with HA-MAP17 at the apical site and was almost absent in the cytoplasm. After cotransfection with the truncated form HA-MAP17-TPM and myc-PDZK1, two different cell populations were identified (Fig. 6B). In one population of cells in which HA-MAP17-TPM was localized apically, myc-PDZK1 also exhibited an apical localization (Fig. 6, B1-B3). However, in cells showing a more cytoplasmic localization of HA-MAP17-TPM, myc-PDZK1 remained in the cytoplasm as well (Fig. 6, B4-B6).
|
| DISCUSSION |
|---|
|
|
|---|
Apart from PDZK1, NaPi-IIa was shown to interact with other PDZ proteins such as NHERF-1 and NaPi-Cap2 (11). As demonstrated in this study, MAP17 exclusively interacted with PDZK1, because by yeast two-hybrid trap assays and GST pull-downs, no interaction of MAP17 with either NHERF-1 or with NaPi-Cap2 was observed. In contrast to interaction described for human isoforms of MAP17 and PDZK1, where MAP17 was shown to interact with both the first and the fourth PDZ domain of PDZK1 (using yeast two-hybrid trap assay; see Ref. 17), we show that by using the same method the mouse isoform of MAP17 interacts exclusively with the fourth PDZ domain of PDZK1.
The abundance of MAP17 has been associated with a number of different tumors, but MAP17 is also expressed in proximal tubules of normal, healthy kidneys (15, 16). As shown in the present study, the abundance of MAP17 in adult mice kidney was found to be highest in the S1 proximal segments and gradually decreased along the proximal tubule, being almost absent in the S3 segments. No differences were observed between superficial and juxtamedullary nephrons. The observed intranephron heterogeneity of MAP17 entirely matched the distribution of NaPi-IIa but not that of PDZK1, which was uniformly abundant along the entire proximal tubule. Uniform intranephron abundance of NaPi-IIa can be achieved by a low-Pi diet (22). Under such conditions, we could not observe a parallel increase of MAP17 in the S3 segments. Thus these findings suggest that the proposed heteromultimeric protein complex comprising PDZK1, NaPi-IIa, and MAP17 is, with regard to the stochiometry MAP17/NaPi-IIa, inhomogeneous (after upregulation of NaPi-IIa) along the entire proximal tubular segment. Whereas in the S1 segments MAP17 is part of the PDZK1/NaPi-IIa complex, in S3 segments this appeared not to be the case.
On the basis of the observations that unlike NaPi-IIa, PDZK1 is not internalized by various stimuli, it is assumed that the NaPi-IIa/PDZK1 interaction is dynamic. As the distribution of MAP17 was not affected after treatment with parathyroid hormone, it is concluded that the interaction of MAP17 with PDZK1 is not regulated, at least not by parathyroid hormone-activated signaling cascades.
Because OK cells do not endogenously express MAP17 (Sorribas V, unpublished data) nor could the presence of PDZK1 at the protein level be demonstrated in these cells (12), OK cells were used as a model for transfection studies aiming to investigate the interaction of MAP17 and PDZK1. When transfected alone, MAP17 was found to be localized in the apical membrane and showed the same distribution pattern (patches) as the NaPi-IIa cotransporter. Therefore, this observation suggested that PDZK1 is not necessary for the apical sorting and/or positioning of MAP17. Interestingly, in proximal tubules of a PDZK1 knockout mouse model, the abundance of MAP17 was not affected by the lack of PDZK1 (19) supporting our hypothesis that the apical positioning/sorting of MAP17 does not depend on PDZK1 but that other, yet unknown, interactions may be required. Although NHERF-1 was shown to be apical in OK cells and proximal tubules (12, 30), an interaction of MAP17 with NHERF-1 can be excluded because by in vitro studies and yeast two-hybrid trap assays no evidence for such an interaction was obtained. In contrast to MAP17, when transfected alone, PDZK1 did not exhibit an apical distribution but was found uniformly distributed throughout the cytoplasm, which may be due to the lack of an appropriate interaction site at the apical membrane. Our results obtained by cotransfecting OK cells with MAP17 and PDZK1 provided evidence that such an apical anchoring site could be provided by MAP17.
Despite the lack of endogenously expressed MAP17 and PDZK1, regulation of the Na/Pi-IIa cotransporter in OK cells closely resembles the one observed in proximal tubules (14, 25). That discrepancy with respect to possible roles of PDZK1 and/or MAP17 in the regulation of NaPi-IIa could be explained by the existence of compensatory mechanisms in OK cells, such as the known interaction between NaPi-IIa and endogenously expressed NHERF-1 (12) or interactions with other not known proteins. In future, it will be of interest to explore the impact of deficiencies of MAP17 and/or PDZK1 on the hormonal regulation of Na/Pi cotransporter under in vivo conditions.
In summary, our studies provided evidence that MAP17 is part of the PDZK1/NaPi-IIa complex in brush border membranes of proximal tubular cells (S1 segments), that within this complex MAP17 may weakly interact with NaPi-IIa as well, and that the abundance of MAP17 is not affected by maneuvers known to alter the content of NaPi-IIa. Furthermore, our data suggest that the apical localization of MAP17 does not depend on the presence of PDZK1 and that a recruitment of PDZK1 to the apical membrane is at least partially dependent on the presence of MAP17. This finding could be of interest regarding the still unknown role of MAP17 in various tumors. As the abundance of MAP17 is increased in a number of carcinomas, our results imply that by increasing the amount of MAP17, additional PDZK1 may be positioned to distinct cellular sites. In fact, it was shown that in carcinomas the abundance of PDZK1 is increased as well (17, 18). Because PDZK1 encompasses several PDZ domains that, in addition to NaPi-IIa, interact with numerous membrane transporters such as MRP2 (17) and CFEX, URAT1 or OCTN1 (10), it could be speculated that increased amounts of MAP17 as observed in numerous cancers could recruit or stabilize more PDZK1, resulting in a cancer-typical organization of different membrane transporters.
| DISCLOSURES |
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. V. Guijarro, W. Link, A. Rosado, J. F.M. Leal, and A. Carnero MAP17 inhibits Myc-induced apoptosis through PI3K/AKT pathway activation Carcinogenesis, December 1, 2007; 28(12): 2443 - 2450. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Guijarro, J. F.M. Leal, C. Blanco-Aparicio, S. Alonso, J. Fominaya, M. Lleonart, J. Castellvi, S. Ramon y Cajal, and A. Carnero MAP17 enhances the malignant behavior of tumor cells through ROS increase Carcinogenesis, October 1, 2007; 28(10): 2096 - 2104. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Guijarro, J. F.M. Leal, J. Fominaya, C. Blanco-Aparicio, S. Alonso, M. Lleonart, J. Castellvi, L. Ruiz, S. Ramon y Cajal, and A. Carnero MAP17 overexpression is a common characteristic of carcinomas Carcinogenesis, August 1, 2007; 28(8): 1646 - 1652. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Donowitz and X. Li Regulatory Binding Partners and Complexes of NHE3 Physiol Rev, July 1, 2007; 87(3): 825 - 872. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Lanaspa, H. Giral, S. Y. Breusegem, N. Halaihel, G. Baile, J. Catalan, J. A. Carrodeguas, N. P. Barry, M. Levi, and V. Sorribas Interaction of MAP17 with NHERF3/4 induces translocation of the renal Na/Pi IIa transporter to the trans-Golgi Am J Physiol Renal Physiol, January 1, 2007; 292(1): F230 - F242. [Abstract] [Full Text] [PDF] |
||||
![]() |
N Hernando, S. M Gisler, S Pribanic, N Deliot, P Capuano, C. A Wagner, O. W Moe, J Biber, and H Murer NaPi-IIa and interacting partners J. Physiol., August 15, 2005; 567(1): 21 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Brone and J. Eggermont PDZ proteins retain and regulate membrane transporters in polarized epithelial cell membranes Am J Physiol Cell Physiol, January 1, 2005; 288(1): C20 - C29. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Malmberg, C. X. Andersson, M. Gentzsch, J. H. Chen, A. Mengos, L. Cui, G. C. Hansson, and J. R. Riordan Bcr (breakpoint cluster region) protein binds to PDZ-domains of scaffold protein PDZK1 and vesicle coat protein Mint3 J. Cell Sci., November 1, 2004; 117(23): 5535 - 5541. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |