AJP - Renal AJP: Cell Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 285: F784-F791, 2003. First published July 1, 2003; doi:10.1152/ajprenal.00109.2003
0363-6127/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/F784    most recent
00109.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (20)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pribanic, S.
Right arrow Articles by Murer, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pribanic, S.
Right arrow Articles by Murer, H.

Interactions of MAP17 with the NaPi-IIa/PDZK1 protein complex in renal proximal tubular cells

Sandra Pribanic,1 Serge Mike Gisler,1 Desa Bacic,1,2 Caveh Madjdpour,1,2 Nati Hernando,1 Victor Sorribas,3 Andrea Gantenbein,2 Jürg Biber,1 and Heini Murer1

Institutes of 1Physiology and 2Anatomy, University of Zürich, 8057 Zürich, Switzerland; and 3Department of Toxicology, University of Zaragoza, E-50.013 Zaragoza, Spain

Submitted 19 March 2003 ; accepted in final form 26 June 2003


    ABSTRACT
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
An essential role in phosphate homeostasis is played by Na/Pi cotransporter IIa that is localized in the brush borders of renal proximal tubular cells. Recent studies identified several PDZ proteins interacting with the COOH-terminal tail of NaPi-IIa, such as PDZK1 and NHERF-1. Here, by using yeast two-hybrid screen of mouse kidney cDNA library, we attempted to find proteins interacting with the NH2-terminal part of NaPi-IIa. We identified MAP17, a 17-kDa membrane protein that has been described to be associated with various human carcinomas, but it is also expressed in normal kidneys. Results obtained by various in vitro analyses suggested that MAP17 interacts with the fourth domain of PDZK1 but not with other PDZ proteins localized in proximal tubular brush borders. As revealed by immunofluorescence, MAP17 was abundant in S1 but almost absent in S3 segments. No alterations of the apical abundance of MAP17 were observed after maneuvers undertaken to change the content of NaPi-IIa (parathyroid hormone treatment, different phosphate diets). In agreement, no change in the amount of MAP17 mRNA was observed. Results obtained from transfection studies using opossum kidney cells indicated that the apical localization of MAP17 is independent of PDZK1 but that MAP17 is required for apical localization of PDZK1. In summary, we conclude that MAP17 1) interacts with PDZK1 only, 2) associates with the NH2 terminus of NaPi-IIa within the PDZK1/NaPi-IIa/MAP17 complex, and 3) acts as an apical anchoring site for PDZK1.

interacting proteins; Na/Pi cotransport; PDZ proteins; NHERF-1; opossum kidney cells


THE Na-DEPENDENT PHOSPHATE transport protein NaPi-IIa (SLC34A1) is the major mediator in renal reabsorption of inorganic phosphate (Pi) (2; for review, see Ref. 24). In proximal tubules, NaPi-IIa is localized in the brush border membrane and is a part of heteromultimeric complexes scaffolded by the PDZ proteins PDZK1 and NHERF-1 (4, 9, 11, 12, 17, 19, 26, 30). Interaction of NaPi-IIa with these PDZ proteins was shown to occur via the COOH-terminal PDZ binding motif (TRL) of NaPi-IIa. Moreover, these interactions occur only with distinct PDZ domains of PDZK1 and NHERF-1 (11). Recent data suggested that these interactions play important roles for the apical positioning of NaPi-IIa. Overexpression of single PDZ domains in opossum kidney (OK) cells resulted in an impairment of apical sorting/positioning of NaPi-IIa cotransporters (12), and the complete lack of NHERF-1, as demonstrated with a mouse knockout, resulted in reduced abundance of NaPi-IIa and urinary wasting of phosphate (26). On the other hand, recent experiments on targeted PDZK1 gene disruption did not result in a significant renal phenotype, suggesting that functional compensation of the lack of PDZK1 might occur by other PDZ proteins (19).

To explore the interactions of NaPi-IIa in more detail, we attempted to find proteins that interact with the NH2 terminus of NaPi-IIa. Results obtained by a yeast two-hybrid screen against a mouse kidney cDNA library suggested that MAP17, a 17-kDa membrane-associated protein, interacts with the NH2 terminus of NaPi-IIa. MAP17 was earlier identified based on differential display performed with mRNA isolated from normal and carcinogenic tissues and was documented to be upregulated in various human carcinomas originating from the colon, breasts, lung, and kidney (15, 16). Interestingly, MAP17 was also detected in normal tissue, such as renal proximal tubules (15), and was shown to interact with the PDZ protein PDZK1 (10, 15). Moreover, MAP17 was shown to be part of the heteromultimeric protein complex formed by the PDZ protein PDZK1 and the multidrug resistance-associated protein MRP2 (17). The interaction with PDZK1 is suggested to be via the last three amino acids (TPM) contained in the COOH terminus of MAP17, representing a PDZ binding domain (17).

The physiological role of MAP17 in proximal tubules is not known. In the present study, we therefore further investigated the interaction pattern of MAP17 with known PDZ proteins located in the apical/subapical site of proximal tubular cells. Our results demonstrated that MAP17 interacts only with PDZK1 and that within this protein complex MAP17 may interact with the NH2 terminus of NaPi-IIa. Furthermore, based on results obtained from transfection studies using OK cells, we conclude that the apical location of MAP17 is not dependent on its interaction with PDZK1.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Yeast two-hybrid screen and trap assays. A cDNA library of adult mice (Clonetech, Basel, Switzerland) was screened against the entire NH2 terminus (Nt, aa 1–109) of the NaPi-IIa cotransporter (SLC34A1, Acc. No. AAC52361 [GenBank] ). NaPi-IIa-Nt was inserted into the vector pFBL23 (3) using the restriction sites EcoRI and SalI (Promega, Madison, WI). The same sites were used to insert the full-length MAP17 (Acc. No. AK002288 [GenBank] .1) plus two additional NH2-terminal glycines into pBTM116. For various yeast two-hybrid trap assays, the following preys were inserted into pACT2, as described (11): full-lengths or single PDZ domains of PDZK1, NaPi-Cap2 and NHERF-1. The vector pBTM116, empty or containing the subunit p51 of HIV reverse transcriptase (1RTp51) (27), was used as control baits.

All baits were expressed in Saccharomyces cerevisiae (L40) containing his3 and lacZ reporter genes (29). Transformations were performed by the LiAc/SS-DNA/PEG procedure using 1 µg of plasmid (8, 11). Yeast transformants were grown on synthetic medium lacking leu, trp, and his for 4 days, and expression of LacZ was assayed by a filter assay (7) using 5-bromo-4-chloro-3-indolyl {beta}-D-galactopyranoside (Alexis, Lausen, Switzerland). Single, positive clones were rescued by electroporation into E. coli KC8 cells as described (13).

GST fusion constructs and pull-down experiments. The construction of GST fusions with full-length PDZK1, NaPi-Cap2, and NHERF-1 has been previously described (11). Pull-downs were performed using proximal tubular brush border membrane vesicles (BBMV) isolated from mice kidney (5). BBMV were solubilized in binding buffer (50 mM Tris·HCl, 120 mM NaCl, 0.5% Igepal CA-630; pH 8) for 5 min at 4°C and centrifuged at 16,000 g for 3 min. Preequilibrated glutathione-agarose beads (Sigma, Buchs, Switzerland) were loaded with GST-fused proteins (~2 µg) and incubated by rocking with 0.05–0.3 mg of solubilized BBMV protein for 1 h at 4°C. After four washing steps with binding buffer, the samples were analyzed by Western blot analysis.

Immunofluorescence and Western blots. Tissue distributions of various proteins in kidneys of 8- to 12-wk-old mice (NMRI, Janvier, France) were assayed by immunofluorescence as described (23). All animals used were kept on a standard chow with free access to tap water. Some animals were fed for 5 days with low- or high-phosphate diet or injected with parathyroid hormone (bovine, 1–34 PTH; Bachem, Bubendorf, Switzerland) as described by Bacic et al. (1).

Cryosections of 5-µm thickness were incubated with the following primary antibodies. MAP17 was detected by a custom-made rabbit antiserum raised against a cytoplasmatic COOH-terminal peptide (17-mer) of mouse MAP17 or by affinity-purified polyclonal antibodies directed against the COOH terminus of human MAP17 (kindly provided by Dr. O. Kocher, see Ref. 16; both used with a dilution 1:1,000). NaPi-IIa (1:1,000) and PDZK1 (1:500) were detected using polyclonal antisera raised against the NH2 terminus of each (6, 11).

For Western blots, isolated proximal tubular BBMV proteins were separated on SDS-PAGE gels, transferred to nitrocellulose membranes, and processed as previously described (6). The blots were incubated overnight at 4°C with primary antibody (MAP17 1:3,000) and subsequently with secondary HRP-coupled IgGs (Amersham Pharmacia Biotech Europe GmbH, Dübendorf, Switzerland). Immunoreactivity was visualized by enhanced chemiluminescence (Pierce, Socochim SA, Lausanne, Switzerland).

Cell culture, transfections, and immunostainings. OK cells (clone 3B/2) were cultured, transfected, and analyzed by confocal microscopy as described previously (12, 25). Where indicated, cells were transfected with NH2-terminally tagged myc-PDZK1 (12), HA-MAP17 (HA-tag positioned between Met65 and Met66 of the original rat clone, accession no. AF402772 [GenBank] ) or HA-MAP17 lacking the last three amino acids (TPM). HA-MAP17-TPM was produced by site-directed mutagenesis (Quick change, Stratagene GmbH, Basel, Switzerland), introducing a stop codon TGA at the position –3. All transfections were done in the presence of Lipofectamine (GIBCO BRL, Basel, Switzerland). After reaching confluency, transfected cells were processed for staining with antibodies against the endogenus NaPi-IIa cotransporter NaPi-4 (1:100) (21), MAP17 (1:100), HA (1:1,000), or myc (1:5,000) epitopes (Sigma and Invitrogen AG, Basel, Switzerland, respectively), as well as phalloidin-AlexaFluor (1:20; Molecular Probes, Juro, Luzern, Switzerland) for actin. Swine anti-rabbit FITC-IgG (1:50; Sigma) and goat or donkey anti-mouse Cy3-IgG (1:500) and Texas Red (1:200) (Jackson, Milan, Italy) were used as secondary markers.

mRNA content in nephron segments. Mice (males, NMRI, 8 wk old) were fed a high (1.2% P)- or a low (0.1% P)-phosphate diet for 5 days. Each group consisted of three animals. Animals were killed, and single kidneys were prepared for laser microdissection as described by Gisler et al. (9). Briefly, both S1 and S3 segments of superficial and juxtamedullary nephrons were identified by phase-contrast microscopy. A total area corresponding to 100,000 µm2 (+/– 1%) was microdissected for each sample, and RNA was extracted (Absolutely RNA Nanoprep Kit, Stratagene GmbH). First-strand cDNA synthesis in a reaction volume of 50 µl was made from total RNA using TaqMan Reverse Transcription Reagents (Applied Biosystems, Rotkreutz, Switzerland) with random hexameres according to the manufacturer's protocol. Relative quantization of MAP17 mRNA was achieved by using ABI PRISM 7700 Sequence Detection System (Applied Biosystems) with {beta}-actin as an internal standard. Expression means obtained from three animals per sample group were averaged, and one-way ANOVA with Student-Newman-Keuls multiple comparisons test was applied for statistical analysis between S1 and S3 segments. A probability of P < 0.05 was taken to be statistically significant.

The sequences of TaqMan probes (Biosearch Technologies, Novato, CA) and primers (Microsynth, Balgach, Switzerland) were as follows: 5'-(6-FAM) TCCCAGGCTCCGGCTCCTCCT (BHQ-1)-3' (probe), 5'-AGGACCCCATCTGCCTTGTT-3' (forward), 5'-CTTCGCCGTCAACCACTTCT-3' (reverse) for MAP17, 5'-(6-FAM) CCATGAAGATCAAGATCATTGCTCCTCCT (BHQ-1)-3' (probe), 5'-GACAGGATGCAGAAGGAGATTACTG-3' (forward), and 5'-CCACCGATCCACACAGAGTACTT-3' (reverse) for {beta}-actin. TaqMan probes were chosen to be located across exon-exon boundaries to exclude any amplification of genomic DNA. PCR reaction was performed as described previously in detail (9). Relative MAP17 expression was calculated with the standard curve method (ABI PRISM 7700 Sequence Detection System, user bulletin #2). Standard curves for MAP17 and {beta}-actin were generated using total kidney mouse RNA.


    RESULTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
By performing a yeast two-hybrid screen against the cytoplasmatically oriented NH2 terminus of the type IIa Na/Pi-cotransporter one clone, encoding of the small membrane protein MAP17 was identified. MAP17 was originally identified by differential display using mRNA isolated from normal and carcinogenic renal tissue (15). Interestingly, MAP17 is also found in normal tissue, specifically in the apical membranes of renal proximal tubule cells, where it was described as part of the heteromultimeric complex comprising PDZK1 and MRP2 (17, 18). In addition to PDZK1, other PDZ proteins, such as NHERF-1 and NaPi-Cap2, were shown to be localized in the brush borders of proximal tubules as well (11, 30). It was therefore of interest to establish if, besides with PDZK1, MAP17 may interact with the other PDZ proteins. As listed in Table l, in yeast two-hybrid trap assays, interaction of MAP17 was observed only with PDZK1 but not with NHERF-1 or NaPi-Cap2. Furthermore, the interaction with PDZK1 was found to be specific for the PDZ domain number four. These findings were confirmed by pull-down experiments using isolated renal proximal brush border membranes and GST fusions of PDZK1, NHERF-1, and NaPi-Cap2. In agreement with the former data, a pull-down of MAP17 was observed with GST-PDZK1 only but not with the other GST constructs (Fig. 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Interaction of MAP17 with different PDZ proteins

 


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. GST pull-downs of MAP17 from mouse kidney brush border membrane vesicles (BBMVs). MAP17 was recovered from solubilized mouse proximal tubular BBMVs by the GST-fusion construct of PDZK1 but not by GST/NaPi-Cap2 or GST/NHERF-1 or by GST alone. After pull-down, MAP17 was detected by Western blot analysis. Positive controls for GST/NaPi-Cap2 and GST/NHERF-1 constructs (ability to pull down NaPi-IIa from BBMV) were described by Gisler et al. (11).

 

Further analyses concerning the renal distribution and expression of MAP17 were performed with renal tissue obtained from animals kept under normal conditions. As revealed by immunofluorescence (Fig. 2), MAP17 was localized in kidney cortex only, exhibiting similar abundances in proximal tubules of superficial and juxtamedullar nephrons, and was absent in medullary rays and in the outer stripe of the outer medulla. Highest intensity was observed in S1 segments and gradually decreased toward the S3 segments. Often, in latter segments, the presence of MAP17 was not detectable. Overall, the distribution of MAP17 was found to be similar to that of the type IIa Na/Pi-cotransporter (Fig. 2A). In contrast to MAP17 and NaPi-IIa, PDZK1-mediated immunostaining was observed of equal intensity along the entire proximal segments of all nephron generations (Fig. 2A). As seen at higher magnification, MAP17 entirely overlapped with NaPi-IIa and PDZK1 in the brush borders of S1 segments (Fig. 2B). Additionally, we determined the content of MAP17 mRNA relatively to that of {beta}-actin in S1 and S3 segments, which were collected by laser microdissection. As illustrated in Fig. 3, highest amount of MAP17 mRNA was found in the S1 segments of both superficial and deep nephrons. Although MAP17 was not detectable in S3 segments by immunofluorescence, the mRNA content was still around 50% of that found in the S1 segments.



View larger version (105K):
[in this window]
[in a new window]
 
Fig. 2. Immunolocalization of MAP17 in mouse kidney. A: overview pictures show proximal tubular localization of MAP17, NaPi-IIa, and PDZK1. NaPi-IIa and MAP17 showed an intranephron heterogeneity (S1 > S3), whereas PDZK1 was equally distributed throughout the whole proximal tubule. M, medulla; MR, medullary ray. Bar size = 200 µm. B: colocalization of MAP17 and NaPi-IIa in the brush borders of S1 cells. The specificity of the anti-MAP17 antiserum was tested in the absence (C) or presence (D) of the antigenic peptide (50 µg/ml).

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. MAP17 mRNA expression in mouse kidney proximal tubules. S1 and S3 segments of both superficial (sup) and juxtamedullary (juxt) nephrons of animals fed a high- or a low-phosphate diet for 5 days were isolated by laser-assisted microdissection. Relative quantification of MAP17 mRNA was performed by RT-PCR, with {beta}-actin as an internal control. No significant differences of the Ct values for {beta}-actin were observed between the different samples. Bars represent means ± SD of 3 individual experiments using samples obtained from 3 individual animals. *P < 0.05, **P < 0.01. Pi, inorganic phosphate.

 

Several factors were shown to regulate the brush border content of NaPi-IIa (14, 22, 24, 28). To investigate whether the abundance of MAP17 may be influenced similarly, mice were treated with parathyroid hormone or fed diets containing a high or a low amount of phosphate. As indicated in Fig. 4, NaPi-IIa was to a large extent downregulated by parathyroid hormone, yet the distribution of MAP17 remained unchanged. Similarly, the distribution of PDZK1 was not affected by parathyroid hormone. A comparison of the abundances of these proteins between renal tissues obtained from mice fed either a high- or a low-Pi diet also showed a change of the NaPi-IIa abundance but no changes of MAP17 or PDZK1. Real-time PCR experiments demonstrated that the amount of MAP17 mRNA in different proximal tubular segments did not change by a low-phosphate diet compared with a high-phosphate diet (Fig. 3).



View larger version (103K):
[in this window]
[in a new window]
 
Fig. 4. Apical abundance of MAP17, NaPi-IIa, and PDZK1 in proximal tubular S1 segments after different treatments. The abundance of NaPi-IIa was found to be altered by the dietary content of phosphate and after a treatment with parathyroid hormone (PTH), whereas no such alterations were observed for the abundance of MAP17 and PDZK1.

 

The interaction of MAP17 with PDZK1 was further investigated in OK cells. These cells were chosen because of their endogenous apical expression of the type IIa Na/Pi-cotransporter and NHERF-1 (12, 25), whereas neither the presence of endogenous PDZK1 nor MAP17 could be demonstrated (12; Sorribas V, unpublished data). As shown in Fig. 5A, after transfection of HA-tagged MAP17 (HA-MAP17), it localized in the apical membrane and colocalized with NaPi-IIa within the actin-containing apical patches. After truncation of the COOH-terminal PDZ-binding domain (TPM) of MAP17, the apical appearance was not completely prevented (HA-MAP17-TPM; Fig. 5B2) and in most transfected cells HA-MAP17-TPM was observed in the cytoplasm (Fig. 5B1). Whether the presence of MAP17 in the apical membrane of OK cells (see Fig. 5A) would affect the inhibition of Na/Pi cotransport by parathyroid hormone was investigated by phosphate uptake measurements. Results obtained showed that MAP17 (at a transfection efficiency >50%) did not influence the kinetic of parathyroid hormone-mediated inhibition of Na/Pi cotransport (not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 5. Cellular location of MAP17 after transfection in opossum kidney (OK) cells. OK cells were transfected with HA-fused MAP17 (A) or MAP17-TPM (B) and stained for HA (red, A2), MAP17 (green, B1 and B2), endogenously expressed NaPi-IIa (green, A3), and {beta}-actin (white, A1). HA-MAP17 was consistently observed in the apical patches of OK cells, a pattern reminiscent to {beta}-actin clusters and NaPi-IIa, as reflected by the yellow signal of the merge composite (A4). After transfection of a COOH termininally truncated MAP17 (HA-MAP17-TPM; B1 and B2), MAP17 was observed to be mostly intracellular (B1). B2: some cells also exhibited an apical localization of MAP17.

 

In contrast to MAP17, myc-tagged PDZK1 was, after transfection, found to be distributed throughout the cytoplasm of OK cells (Ref. 12 and Fig. 6A1), suggesting that apical anchoring sites for PDZK1 in OK cells are missing. To test this possibility, OK cells were cotransfected with HA-MAP17 and myc-PDZK1. As shown in Fig. 6, A2-A4, in the presence of HA-MAP17, myc-PDZK1 colocalized with HA-MAP17 at the apical site and was almost absent in the cytoplasm. After cotransfection with the truncated form HA-MAP17-TPM and myc-PDZK1, two different cell populations were identified (Fig. 6B). In one population of cells in which HA-MAP17-TPM was localized apically, myc-PDZK1 also exhibited an apical localization (Fig. 6, B1-B3). However, in cells showing a more cytoplasmic localization of HA-MAP17-TPM, myc-PDZK1 remained in the cytoplasm as well (Fig. 6, B4-B6).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 6. PDZK1 distribution in OK cells after coexpression with MAP17 or MAP17-TPM. When expressed alone in OK cells, myc-tagged PDZK1 showed a strong cytoplasmatic distribution (stained for myc in red; A1). In contrast, when coexpressed (A2 to A4) with HA-MAP17, PDZK1 underwent a shift in its cellular distribution from the cytoplasm (A1) toward a patchy, apical localization (A2). A3: merge of A2 with A3. B: in the case of a coexpression of PDZK1 with HA-MAP17-TPM, the distribution of PDZK1 was found to be consistent with that of HA-MAP17-TPM. Cells exhibiting apical HA-MAP17-TPM (green, B2) also showed apical location of PDZK1 (B1); in cells exhibiting a cytoplasmatic distribution of HA-MAP17-TPM, PDZK1 remained in cytoplasm as well (B4 to B6). Squares represent apical focal planes, and rectangles represent confocal cross sections.

 


    DISCUSSION
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In renal proximal tubular cells, the Na/Pi cotransporter NaPi-IIa was described to interact with the multiple PDZ protein PDZK1 via a PDZ-binding motif contained in its COOH terminus (11). On the basis of the yeast two-hybrid screen, we obtained evidence that NaPi-IIa, via its NH2 terminus, interacts with MAP17, which was described to interact also with PDZK1 (16, 18). The interaction of MAP17 was specific for the NH2-terminal tail because no positive reaction could be observed when either the cytoplasmatically oriented COOH terminus of NaPi-IIa or a proposed intracellular loop (ICL3, see Ref. 20) was used as bait in yeast two-hybrid trap assays (data not shown). However, by applying several in vitro assays (GST pull-downs or gel overlays; data not shown), we could not confirm an in vitro interaction of the NH2 terminus of NaPi-IIa with MAP17. Therefore, we conclude that the NaPi-IIa/MAP17 interaction may be of a weak nature but could be stabilized in the complex MAP17/NaPi-IIa/PDZK1.

Apart from PDZK1, NaPi-IIa was shown to interact with other PDZ proteins such as NHERF-1 and NaPi-Cap2 (11). As demonstrated in this study, MAP17 exclusively interacted with PDZK1, because by yeast two-hybrid trap assays and GST pull-downs, no interaction of MAP17 with either NHERF-1 or with NaPi-Cap2 was observed. In contrast to interaction described for human isoforms of MAP17 and PDZK1, where MAP17 was shown to interact with both the first and the fourth PDZ domain of PDZK1 (using yeast two-hybrid trap assay; see Ref. 17), we show that by using the same method the mouse isoform of MAP17 interacts exclusively with the fourth PDZ domain of PDZK1.

The abundance of MAP17 has been associated with a number of different tumors, but MAP17 is also expressed in proximal tubules of normal, healthy kidneys (15, 16). As shown in the present study, the abundance of MAP17 in adult mice kidney was found to be highest in the S1 proximal segments and gradually decreased along the proximal tubule, being almost absent in the S3 segments. No differences were observed between superficial and juxtamedullary nephrons. The observed intranephron heterogeneity of MAP17 entirely matched the distribution of NaPi-IIa but not that of PDZK1, which was uniformly abundant along the entire proximal tubule. Uniform intranephron abundance of NaPi-IIa can be achieved by a low-Pi diet (22). Under such conditions, we could not observe a parallel increase of MAP17 in the S3 segments. Thus these findings suggest that the proposed heteromultimeric protein complex comprising PDZK1, NaPi-IIa, and MAP17 is, with regard to the stochiometry MAP17/NaPi-IIa, inhomogeneous (after upregulation of NaPi-IIa) along the entire proximal tubular segment. Whereas in the S1 segments MAP17 is part of the PDZK1/NaPi-IIa complex, in S3 segments this appeared not to be the case.

On the basis of the observations that unlike NaPi-IIa, PDZK1 is not internalized by various stimuli, it is assumed that the NaPi-IIa/PDZK1 interaction is dynamic. As the distribution of MAP17 was not affected after treatment with parathyroid hormone, it is concluded that the interaction of MAP17 with PDZK1 is not regulated, at least not by parathyroid hormone-activated signaling cascades.

Because OK cells do not endogenously express MAP17 (Sorribas V, unpublished data) nor could the presence of PDZK1 at the protein level be demonstrated in these cells (12), OK cells were used as a model for transfection studies aiming to investigate the interaction of MAP17 and PDZK1. When transfected alone, MAP17 was found to be localized in the apical membrane and showed the same distribution pattern (patches) as the NaPi-IIa cotransporter. Therefore, this observation suggested that PDZK1 is not necessary for the apical sorting and/or positioning of MAP17. Interestingly, in proximal tubules of a PDZK1 knockout mouse model, the abundance of MAP17 was not affected by the lack of PDZK1 (19) supporting our hypothesis that the apical positioning/sorting of MAP17 does not depend on PDZK1 but that other, yet unknown, interactions may be required. Although NHERF-1 was shown to be apical in OK cells and proximal tubules (12, 30), an interaction of MAP17 with NHERF-1 can be excluded because by in vitro studies and yeast two-hybrid trap assays no evidence for such an interaction was obtained. In contrast to MAP17, when transfected alone, PDZK1 did not exhibit an apical distribution but was found uniformly distributed throughout the cytoplasm, which may be due to the lack of an appropriate interaction site at the apical membrane. Our results obtained by cotransfecting OK cells with MAP17 and PDZK1 provided evidence that such an apical anchoring site could be provided by MAP17.

Despite the lack of endogenously expressed MAP17 and PDZK1, regulation of the Na/Pi-IIa cotransporter in OK cells closely resembles the one observed in proximal tubules (14, 25). That discrepancy with respect to possible roles of PDZK1 and/or MAP17 in the regulation of NaPi-IIa could be explained by the existence of compensatory mechanisms in OK cells, such as the known interaction between NaPi-IIa and endogenously expressed NHERF-1 (12) or interactions with other not known proteins. In future, it will be of interest to explore the impact of deficiencies of MAP17 and/or PDZK1 on the hormonal regulation of Na/Pi cotransporter under in vivo conditions.

In summary, our studies provided evidence that MAP17 is part of the PDZK1/NaPi-IIa complex in brush border membranes of proximal tubular cells (S1 segments), that within this complex MAP17 may weakly interact with NaPi-IIa as well, and that the abundance of MAP17 is not affected by maneuvers known to alter the content of NaPi-IIa. Furthermore, our data suggest that the apical localization of MAP17 does not depend on the presence of PDZK1 and that a recruitment of PDZK1 to the apical membrane is at least partially dependent on the presence of MAP17. This finding could be of interest regarding the still unknown role of MAP17 in various tumors. As the abundance of MAP17 is increased in a number of carcinomas, our results imply that by increasing the amount of MAP17, additional PDZK1 may be positioned to distinct cellular sites. In fact, it was shown that in carcinomas the abundance of PDZK1 is increased as well (17, 18). Because PDZK1 encompasses several PDZ domains that, in addition to NaPi-IIa, interact with numerous membrane transporters such as MRP2 (17) and CFEX, URAT1 or OCTN1 (10), it could be speculated that increased amounts of MAP17 as observed in numerous cancers could recruit or stabilize more PDZK1, resulting in a cancer-typical organization of different membrane transporters.


    DISCLOSURES
 
This work was supported by the Swiss National Foundations (Grant 31–65397.01 to H. Murer) and the Fridericus-Stiftung (Vaduz, FL).


    ACKNOWLEDGMENTS
 
RTp51 was a gift from Dr. U. Hübscher, Veterinary Biochemistry, University of Zürich. The antibody against the endogenous NaPi-4 from the OK cells was kindly provided by Dr. E. D. Lederer. We thank C. Gasser for assistance in preparing the figures.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. Biber, Institute of Physiology, Univ. of Zürich, Winterthurerstr. 190, 8057 Zürich, Switzerland (E-mail: JuergBiber{at}access.unizh.ch).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bacic D, Schulz N, Biber J, Kaissling B, Murer H, and Wagner CA. Involvement of the MAPK-kinase pathway in the PTH mediated regulation of the proximal tubule type IIa Na/Pi cotransporter in mouse kidney. Pflügers Arch 446: 52–60, 2003.[Web of Science][Medline]
  2. Beck L, Karaplis AC, Amizuka N, Hewson AS, Ozawa H, and Tenenhouse HS. Targeted inactivation of Npt2 in mice leads to severe renal phosphate wasting, hypercalciuria, and skeletal abnormalities. Proc Natl Acad Sci USA 95: 5372–5377, 1998.[Abstract/Free Full Text]
  3. Béranger F, Aresta S, de Gunzburg J, and Camonis J. Getting more from the two-hybrid system: N-terminal fusions to LexA are efficient and sensitive baits for two-hybrid studies. Nucleic Acids Res 25: 2035–2036, 1997.[Abstract/Free Full Text]
  4. Biber J. Emerging roles of transporter-PDZ complexes in renal proximal tubular reabsorption. Pflügers Arch 443: 3–5, 2001.[Web of Science][Medline]
  5. Biber J, Stieger B, Haase W, and Murer H. A high yield preparation for rat kidney brush border membranes. Different behaviour of lysosomal markers. Biochim Biophys Acta 647: 169–176, 1981.[Medline]
  6. Custer M, Lotscher M, Biber J, Murer H, and Kaissling B. Expression of Na-Pi cotransport in rat kidney: localization by RT-PCR and immunohistochemistry. Am J Physiol Renal Fluid Electrolyte Physiol 266: F767–F774, 1994.[Abstract/Free Full Text]
  7. Dalton S and Treisman R. Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element. Cell 68: 597–612, 1992.[Web of Science][Medline]
  8. Gietz RD, Schiestl RH, Willems AR, and Woods RA. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11: 355–360, 1995.[Web of Science][Medline]
  9. Gisler SM, Madjdpour C, Bacic D, Pribanic S, Taylor SS, Biber J, and Murer H. PDZK1. II. An anchoring site for the PKA-binding protein D-AKAP2 in renal proximal tubular cells. Kidney Int In press.
  10. Gisler SM, Pribanic S, Bacic D, Forrer P, Gantenbein A, Sabourin LA, Tsuji A, Zhao Z, Manser E, Biber J, and Murer H. PDZK1. I. A major scaffolder in brush borders of proximal tubular cells. Kidney Int In press.
  11. Gisler SM, Stagljar I, Traebert M, Bacic D, Biber J, and Murer H. Interaction of the type IIa Na/Pi cotransporter with PDZ proteins. J Biol Chem 276: 9206–9213, 2001.[Abstract/Free Full Text]
  12. Hernando N, Déliot N, Gisler SM, Lederer E, Weinman EJ, Biber J, and Murer H. PDZ-domain interactions and apical expression of type IIa Na/Pi cotransporters. Proc Natl Acad Sci USA 99: 11957–11962, 2002.[Abstract/Free Full Text]
  13. Inoue H, Nojima H, and Okayama H. High efficiency transformation of Escherichia coli with plasmids. Gene 96: 23–28, 1990.[Web of Science][Medline]
  14. Keusch I, Traebert M, Lötscher M, Kaissling B, Murer H, and Biber J. Parathyroid hormone and dietary phosphate provoke a lysosomal routing of the proximal tubular Na/Pi-cotransporter type II. Kidney Int 54: 1224–1232, 1998.[Web of Science][Medline]
  15. Kocher O, Cheresh P, Brown LF, and Lee SW. Identification of a novel gene selectively upregulated in human carcinomas, using the differential display technique. Clin Cancer Res 1: 1209–1215, 1995.[Abstract]
  16. Kocher O, Cheresh P, and Lee SW. Identification and partial characterization of a novel membrane-associated protein (MAP17) upregulated in human carcinomas and modulating cell replication and tumor growth. Am J Pathol 149: 493–500, 1996.[Abstract]
  17. Kocher O, Comella N, Gilchrist A, Pal R, Tongazzi K, Brown LF, and Knoll JHM. PDZK1, a novel PDZ domain-containing protein upregulated in carcinomas and mapped to chromosome 1q21 [PDB] , interacts with cMOAT (MRP2), the multidrug resistance-associated protein. Lab Invest 79: 1161–1170, 1999.[Web of Science][Medline]
  18. Kocher O, Comella N, Tognazzi K, and Brown LF. Identification and partial characterization of PDZK1: a novel protein containing PDZ interaction domains. Lab Invest 78: 117–125, 1998.[Web of Science][Medline]
  19. Kocher O, Pal R, Roberts M, Cirovic C, and Gilchrist A. Targeted disruption of the PDZK1 gene by homologous recombination. Mol Cell Biol 23: 1175–1180, 2003.[Abstract/Free Full Text]
  20. Lambert G, Traebert M, Hernando N, Biber J, and Murer H. Studies on the topology of the renal type II NaPi-cotransporter. Pflügers Arch 437: 972–978, 1999.[Web of Science][Medline]
  21. Lederer ED, Sohi SS, Mathiesen JM, and Klein JB. Regulation of expression of type II sodium-phosphate cotransporters by protein kinases A and C. Am J Physiol Renal Physiol 275: F270–F277, 1998.[Abstract/Free Full Text]
  22. Levi M, Lötscher M, Sorribas V, Custer M, Arar M, Kaissling B, Murer H, and Biber J. Cellular mechanisms of acute and chronic adaptation of rat renal Pi transporter to alterations in dietary Pi. Am J Physiol Renal Fluid Electrolyte Physiol 267: F900–F908, 1994.[Abstract/Free Full Text]
  23. Loffing J, Loffing-Cueni D, Valderrabano V, Klausli L, Hebert SC, Rossier BC, Hoenderop JG, Bindels RJ, and Kaissling B. Distribution of transcellular calcium and sodium transport pathways along mouse distal nephron. Am J Physiol Renal Physiol 281: F1021–F1027, 2001.[Abstract/Free Full Text]
  24. Murer H, Hernando N, Forster I, and Biber J. Proximal tubular phosphate reabsorbtion: molecular mechanisms. Physiol Rev 80: 1373–1400, 2000.[Abstract/Free Full Text]
  25. Pfister MF, Lederer E, Forgo J, Ziegler U, Lötscher M, Quabius ES, Biber J, and Murer H. Parathyroid hormone-dependent degradation of type II Na+/Pi cotransporters. J Biol Chem 272: 20125–20130, 1997.[Abstract/Free Full Text]
  26. Shenolikar S, Voltz JW, Minkoff CM, Wade JB, and Weinman EJ. Targeted disruption of the mouse NHERF-1 gene promotes internalization of proximal tubule sodium-phosphate cotransporter type IIa and renal phosphate wasting. Proc Natl Acad Sci USA 99: 11470–11475, 2002.[Abstract/Free Full Text]
  27. Tasara T, Amacker M, and Hübscher U. Intramolecular chimeras of the p51 subunit between HIV-1 and FIV reverse transcriptases suggest a stabilizing function for the p66 subunit in the heterodimeric enzyme. Biochemistry 38: 1633–1642, 1999.[Medline]
  28. Traebert M, Roth J, Biber J, Murer H, and Kaissling B. Internalization of proximal tubular type II Na-Pi cotransporter by PTH: immunogold electron microscopy. Am J Physiol Renal Physiol 278: F148–F154, 2000.[Abstract/Free Full Text]
  29. Vojtek AB, Hollenberg SM, and Cooper JA. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74: 205–214, 1993.[Web of Science][Medline]
  30. Weinman EJ, Steplock D, Wang Y, and Shenolikar S. Characterization of a protein cofactor that mediates protein kinase A regulation of the renal brush border membrane Na+-H+ exchanger. J Clin Invest 95: 2143–2149, 1995.[Web of Science][Medline]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
M. V. Guijarro, W. Link, A. Rosado, J. F.M. Leal, and A. Carnero
MAP17 inhibits Myc-induced apoptosis through PI3K/AKT pathway activation
Carcinogenesis, December 1, 2007; 28(12): 2443 - 2450.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. V. Guijarro, J. F.M. Leal, C. Blanco-Aparicio, S. Alonso, J. Fominaya, M. Lleonart, J. Castellvi, S. Ramon y Cajal, and A. Carnero
MAP17 enhances the malignant behavior of tumor cells through ROS increase
Carcinogenesis, October 1, 2007; 28(10): 2096 - 2104.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. V. Guijarro, J. F.M. Leal, J. Fominaya, C. Blanco-Aparicio, S. Alonso, M. Lleonart, J. Castellvi, L. Ruiz, S. Ramon y Cajal, and A. Carnero
MAP17 overexpression is a common characteristic of carcinomas
Carcinogenesis, August 1, 2007; 28(8): 1646 - 1652.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. Donowitz and X. Li
Regulatory Binding Partners and Complexes of NHE3
Physiol Rev, July 1, 2007; 87(3): 825 - 872.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. A. Lanaspa, H. Giral, S. Y. Breusegem, N. Halaihel, G. Baile, J. Catalan, J. A. Carrodeguas, N. P. Barry, M. Levi, and V. Sorribas
Interaction of MAP17 with NHERF3/4 induces translocation of the renal Na/Pi IIa transporter to the trans-Golgi
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F230 - F242.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
N Hernando, S. M Gisler, S Pribanic, N Deliot, P Capuano, C. A Wagner, O. W Moe, J Biber, and H Murer
NaPi-IIa and interacting partners
J. Physiol., August 15, 2005; 567(1): 21 - 26.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
B. Brone and J. Eggermont
PDZ proteins retain and regulate membrane transporters in polarized epithelial cell membranes
Am J Physiol Cell Physiol, January 1, 2005; 288(1): C20 - C29.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
E. K. Malmberg, C. X. Andersson, M. Gentzsch, J. H. Chen, A. Mengos, L. Cui, G. C. Hansson, and J. R. Riordan
Bcr (breakpoint cluster region) protein binds to PDZ-domains of scaffold protein PDZK1 and vesicle coat protein Mint3
J. Cell Sci., November 1, 2004; 117(23): 5535 - 5541.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/F784    most recent
00109.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (20)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pribanic, S.
Right arrow Articles by Murer, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pribanic, S.
Right arrow Articles by Murer, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.