|
|
||||||||
Departments of 1Toxicology, 2Pharmacology, 3Physiology, 4Genetics, and 5Anatomy, University of Zaragoza, Zaragoza E50013, Spain
Submitted 16 April 2003 ; accepted in final form 11 June 2003
| ABSTRACT |
|---|
|
|
|---|
-methyl-D-glucopyranoside are also
accepted substrates that are inhibited by phloridzin. The corresponding
transporter from the proximal tubule remains to be identified, but it is
different from the known mammalian SGLT-1, -2, and -3. expression cloning; kidney cortex; mannose reabsorption
-mannosidosis
(3). In addition to
glycosylation, sperm has the special feature of being able to directly use
mannose as an energy source
(23). D-Mannose
homeostasis seems to be controlled by the reabsorption activity of the kidney,
because most of the ultrafiltrated mannose is readily reabsorbed in the
proximal tubule (25,
27,
29,
39). This important role has
been studied for more than 30 years using in vivo and in vitro experiments and
different animal species (5,
10,
22,
25,
27,
29,
30,
33,
39). These studies have
concluded that the brush-border membrane of the renal tubular cells contains a
high-affinity (Km
0.1 mM) and very specific
Na-dependent D-mannose transport system. Stoichiometric
determinations have evidenced Na-D-mannose relationships of 1:1
(10,
22) and 2:1
(5), a difference that can be
explained by the use of different animal species, as well as experimental and
data analysis approaches. With respect to specificity, despite being inhibited
by D-glucose,
-methyl-D-glycoside, and
phloridzin, the Na-mannose cotransport system seems to be different from the
known Na-dependent D-glucose transport system
(5,
10,
22,
25,
27,
29,
30,
39). Several groups have also
reported a strong inhibition of renal mannose transport by
D-fructose, which could be explained by direct competition for the
same transport system (5,
22,
25,
27,
39).
The molecular characterization of this renal transport was initiated by our
group a few years ago (5). We
reported that the size of the rat kidney RNA responsible for
D-mannose transport expression in Xenopus laevis oocytes
was exceptionally small (
1 kb) compared with all other known transporters
(25 kb). The transport induced by the 1-kb-fraction-enriched mRNA in
oocytes was also very small (
100% greater than in water-injected
oocytes), but it exhibited kinetic characteristics similar to the transport
measured by the renal brush-border membrane vesicles.
To determine the physiological relationship of this small RNA to mannose transport in the kidney, we have identified by expression cloning the cDNA responsible for the Na-coupled D-mannose transport induction in X. laevis oocytes. The kinetic behavior is similar to that in the data published for mannose transport in rat kidney and other animal models. The cDNA sequence reveals that it is the rat counterpart to the human 17-kDa membrane-associated protein MAP17/DD96 (16, 17), whose molecular characteristics are very different from those of all known transporters. MAP17 was first cloned as an mRNA that was overexpressed in most carcinomas, which then led to the identification of type 1 PSD95-Dlg-zona occludens-1 (PDZK1), a PDZ domain-containing globular protein that interacts with the COOH terminus of MAP17 (18). In this work, we also show evidence of the need for interaction with an additional protein(s) in the oocyte, which is functionally similar to, but different from, the known Na-glucose cotransporters SGLT-1, -2, and -3 (38).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of MAP17. Directional cDNA library construction and expression cloning were performed as published (14, 31) using the Superscript Plasmid System (Invitrogen, Paisley, UK). The first cDNA strand was methylated using 5-methyl-dCTP, transformed into Epicurian Coli XL-Gold ultracompetent cells (Stratagene, La Jolla, CA), and screened at 500 colonies/plate. Sequencing was automatically performed using AbiPrism 377 (PerkinElmer Life Sciences, Boston, MA) and Vector NTI Suite software.
Culture and transfections of opossum kidney cells. Cell culture and uptake assays were performed as reported (32). For transient transfections, the cDNAs in pCMV Script (Stratagene) were transfected using Lipofectamine Plus reagent (Invitrogen) at 80% confluence for 4 h. Each six-well vessel received 2 µg DNA, 6 µl Plus reagent, and 8 µl lipofectamine, and an additional 24 h were allowed for protein expression. Permanently transfected clones were selected using 500 µg/ml G418 and maintained at 200 µg/ml (12).
Metabolic labeling and in vitro translation. The metabolic labeling of oocytes was performed using 5 ng cRNA/oocyte and, 8 h later, 0.5 µCi of a L-[35S]methionine/cystein mixture (Amersham). After 12 h, the oocyte cell membranes were purified as published (31). After SDS-PAGE, the gel was fixed, dried, and exposed to Kodak Biomax MR film at 80°C using Kodak Biomax TranScreen LE intensifying screens (both from Amersham Biosciences). In vitro translation of rat MAP17 was done using rabbit reticulocyte lysate in the absence or presence of canine pancreatic microsomal membranes (both from Promega, Madison, WI). Posttranslation modifications were analyzed by a combination of microsome addition and endoglycosidase H digestion exactly as published (15).
Northern blot analysis and in situ hybridization. Total RNA was purified using a QuickPrep Total RNA Extraction kit (Amersham Biosciences). For Northern blot analysis, 20 µg total RNA were electrophoresed in formaldehyde-denaturing agarose gels as explained elsewhere (2) and vacuum-blotted onto nylon membranes (Biodyne, Pall Gelman, Ann Arbor, MI). After hybridization in an ULTRAhyb solution (Ambion) with a 660-bp MAP17-derived 32P-labeled riboprobe, signals were obtained by exposure to Kodak Biomax MS film at 80°C for 48 h.
In situ hybridization histochemistry was done as published elsewhere (34). Five-micrometer cryosections, thaw-mounted onto gelatin-coated slides, were air dried, fixed in paraformaldehyde, and dehydrated in ethanol. Forty-mer antisense oligonucleotides (5'-AGATGGCTGTGATTCAAGAGAGGTGAGAGGTCAGCTTGTT) were 3'-labeled with [32P]dATP (New England Nuclear, Boston, MA) using terminal deoxynucleotidyl-transferase and hybridized with the tissue sections overnight under Nescofilm coverslips in a humid chamber at 42°C in a hybridization buffer. The slides were washed at high stringency, dehydrated with ethanol, dipped into LM-1 emulsion (Amersham Biosciences), and examined after development, using darkfield and Nomarski microscopy (Olympus BX60). As controls for in situ hybridization histochemistry, Northern blotting, the melting temperature of the hybrids formed, competition in cohybridization experiments, and hybridization with probes for other mRNAs were all used as explained elsewhere (34). The melting temperature of the hybrids was determined during the washing procedure and found to be close to the values predicted by Primer Analysis software (Oligo 6.0, MedProbe).
Mutant constructions. The hemagglutinin antigen (HA; YPYDVPDYA) was introduced in positions 5, 23, and 66 of the MAP17 protein by site-directed mutagenesis using a QuikChange kit (Stratagene) and the following primers (HA-encoding sequences are underlined):
For cystein mutants, they were mutated to serines using the following primers (point mutations for Cys conversion are underlined): Cys20 (C20S), CCGAAGTGGCACCTGCCAGCAGTCAACA; and Cys55 (C55S), GCTCTTCCTGGCTCCAGAAGTGGTTGAC.
Immunoblots, immunofluorescence, and confocal imaging. Crude membrane preparations were obtained from the oocytes expressing the HA-tagged MAP17 as published (31). Western blot analysis was performed using a rabbit polyclonal anti-HA antibody (Clontech, Palo Alto, CA), a goat anti-rabbit IgG secondary antibody conjugated to horseradish peroxidase (Chemicon, Temecula, CA), and enhanced chemiluminescence detection (ECL Plus, Amersham Biosciences). Opossum kidney (OK) cells expressing HA-tagged MAP17 were immunodecorated basically as described (21). Anti-HA antibody was diluted 1:100 in PBS and incubated for 2 h and then localized with a goat anti-rabbit IgG secondary antibody, FITC-conjugated (Sigma, St. Louis, MO), diluted 1:50, and incubated for 1 h. Mowiol 488 (Calbiochem, San Diego, CA) was used as an antifading agent in the mounting media (Merck, Darmstadt, Germany). Cells were visualized by epifluorescence with either an Olympus BX60 or a confocal Carl Zeiss LSM 310 microscope. Golgi staining and colocalization were performed using the ceramide analog BODIPY-TR (Molecular Probes, Eugene, OR) following the manufacturer's guidelines. In short, BODIPY-TR (1 mM) was dissolved in ethanol and incubated with the fixed cells as BSA-complexes, for 10 min at 5 µM, after a washing of the secondary antibody. When necessary, the cells were incubated for 30 min at 37°C with 10 µg/ml brefeldin A (Molecular Probes) before fixation, from a stock of 5 mg/ml in ethanol.
Hybrid depletion in oocytes. Hybrid depletion experiments were performed as described previously (31) using six oligodeoxyribonucleotides derived from the rat MAP17 sequence as follows: sense oligos: 105124 ATGTTGGCCCTCAGTCTGCT (S105), 251270 CGTCAACCACTTCTGGTGCC (S251), and 407426 TGTTCTGGAGGAAGAGGGCA (S407); and antisense oligonucleotides: 105124 AGCAGACTGAGGGCCAACAT (AS124), 335352 TATCTGCCATCCATGCCC (AS335), and 430449 TCACATGGGTGTGCTGCGGA (AS430). Rat kidney cortex (poly)A+ RNA was purified from total RNA using an mRNA Purification Kit (Amersham Biosciences). Mannose transport was assayed 5 days after injection.
Biochemical procedures. Treatment with
p-chloromercuribenzoate (pCMB) was done as published elsewhere
(11). Oocytes were incubated
for 5 min in uptake medium (without substrates) containing 1 mM pCMB, rinsed,
and then incubated 5 min in the same medium with or without 5 mM
-mercaptoethanol. Before substrate uptake, the oocytes were again rinsed
three times. The methanethiosulfonate (MTS) reagents (Toronto Research
Chemicals, Downsview, Ontario, Canada) [2-(trimethylammonium)ethyl]
methanethiosulfonate (MTSET) and 2-aminoethyl methanethiosulfonate (MTSEA)
were dissolved in DMSO and used at 1 or 5 mM for 5 or 10 min of preincubation
with the oocytes.
Coimmunoprecipitation. Groups of 30 oocytes were injected with 10 ng HA23-MAP17 cRNA, alone or in combination with 20 ng of rat kidney cortex poly(A)+ RNA, and metabolically labeled, as explained above. For cross-linking assays, groups of oocytes were washed twice in PBS2+ containing (in g/l) 8 NaCl, 1.15 Na2HPO4, 0.2 KCl, 0.2 KH2PO4, 0.132 CaCl2 x 2H2O, and 0.1 MgCl2 x 6H2O and incubated in 3 ml glycerol buffer (10% glycerol, 0.1% saponin, 1 mM orthovanadate, in PBS2+) for 20 min at 4°C. Oocytes were then washed once in ice-cold glycerol buffer and incubated with 2 ml cross-linker buffer (0.25 M sucrose, 1 mM orthovanadate in PBS2+) containing the cleavable cross-linker 3,3'-dithio-bis(sulfosuccinimidyl propionate) (DTSSP; Pierce, Rockford, IL). This was added from a freshly made 100x stock solution in DMSO to a final concentration at 1 mM. Cross-linking was allowed for 2 h at 4°C. Then, the oocytes were washed once in PBS2+, and a buffer containing 100 mM glycine in PBS2+ was added to stop the reaction. After a final wash in PBS2+, the oocytes were lysed by vortexing for 20 s in 20 µl/oocyte of a nondenaturing homogenization buffer (120 mM NaCl, 50 mM Tris·HCl, pH 8, and 0.5% Nonidet P-40) supplemented with protease inhibitors (Complete-Mini; Roche Diagnostics, Mannheim, Germany) and incubated briefly on ice. The lysates were then centrifuged at 16,000 g for 10 min and 4°C, and the supernatants were stored at 80°C. Incorporated radioactivity was determined by scintillation counting of trichloroacetic acid precipitates from aliquots.
Immunoprecipitation was performed with polyclonal anti-HA antibody
(Clontech) bound to protein G plus/protein A-agarose (Calbiochem); 10 µl of
0.1 µg/µl anti-HA were coupled to 30 µl protein G/A-agarose
slurry/group of oocytes by slow rotation for 2 h at 4°C. Equal amounts (2
x 106 cpm/µl) of precleared lysates were mixed with the
coupled beads and shaken slowly overnight at 4°C. The beads were washed
four times in buffer containing 100 mM NaCl, 20 mM Tris·HCl, pH 8.0, 1
mM EDTA, 0.5% Nonidet P-40, and 500 mM LiCl and four times in the same buffer
without LiCl. The beads were resuspended in an SDS-PAGE loading buffer and
heated at 65°C for 15 min. When necessary,
-mercaptoethanol (5%
final) was added to the samples. After electrophoresis in 15%
SDS-polyacrilamide, the gels were fixed in 3% glycerol, 10% acetic acid, and
20% methanol for 30 min, then treated with Amplify (Amersham) for 15 min,
dried, and exposed to Eastman Kodak Biomax films for 4 days at
80°C.
RT-PCR. The cloning of an 1,808-bp fragment of rat PDZK1, thereby encoding the full open reading frame, was done by two-step RT-PCR using the Superscript Preamplification System and Platinum Taq DNA Polymerase High Fidelity (both from Invitrogen). The following primers were designed from the GenBank sequence: sense 5'-GTTCCAAGACTAGTAGTGTTCA-3' and antisense 5'-CAGCTAAGCTGAGCATAAAT-3'. The product was cloned into PCR-Script (Stratagene), and the capped cRNA was tailed using a Poly(A) Tailing kit (Ambion).
Statistics and fits. The data are shown as means ± SE. The statistical significance was determined by one-way ANOVA and the Tukey multiple-comparison test, whereby P < 0.05 was considered significant. For the transport kinetic studies in oocytes, Michaelis-Menten and generalized Hill equations (6, 28) were used to calculate the Km, Vmax, and n coefficients by iterative, nonlinear regression. The fits were accepted when two consecutive iterations changed the sum of squares by <0.01%. As an indication of the goodness of the fits, the coefficient correlation (r) and degrees of freedom are shown (degrees of freedom represent the number of data points minus the number of fitted parameters). Given that the total uptake measured in RNA-injected oocytes also includes the endogenous or water-injected uptake, an effort was made to calculate the difference, or the net expressed transport. This was done, despite the low expression level, by subtracting the mean values of water-injected oocytes for every substrate concentration from the corresponding mean value of the RNA-injected oocytes. GraphPad Prism 3.0cx software for Macintosh was used for statistical and kinetic analysis. All experiments were repeated between three and five times with similar results, including saturation and Na-activation kinetics; nevertheless, the low level of transport expression prevented an accurate kinetic analysis, as shown by the asymptotic SE of the fits.
| RESULTS |
|---|
|
|
|---|
150% Na-coupled
D-mannose transport above the endogenous, water-injected level of
the cell when assayed at 0.1 mM D-mannose for 1 h
(Fig. 1A).
Dose-response and expression-time course experiments revealed that the maximal
transport rate was already obtained using 0.5 ng cRNA/oocyte after 1 day of
expression time and that the uptake was linear for at least 4 h (see
Fig. 10A; other data
not shown). Despite the low level of expression that prevented an accurate
kinetic characterization, we found that MAP17 induces high-affinity Na-coupled
D-mannose transport (Fig.
1B), with a Hill coefficient >2 for Na activation
(Fig. 1C), which is in
agreement with our previous results
(5). The fit analysis is
summarized in Table 1, whereby
we conclude that the effect of MAP17 most likely consists of an increase in
the capacity of the endogenous uphill transport system of the oocyte.
|
|
|
The specificity of the induced transport was assayed in two ways. First,
the uptake of 0.05 mM D-mannose was completely inhibited only by
D-mannose, D-glucose, and phloridzin
(Fig. 2A). However, no
significant effects were observed with sugars such as L-mannose,
D-fructose, phloretin, the
-mannosidase inhibitor
1-deoxymannojirimycin (DMM), and the amino acids and ions indicated in
Fig. 2A. Second,
according to the inhibition results, a direct measure of the uptake of several
radioactive sugars showed that 0.5 mM D-[14C]glucose and
-methyl-D-[14C]glucopyranoside were transported
similarly to D-mannose by MAP17-expressing oocytes
(Fig. 2B). However,
0.5 mM D-[14C]galactose,
3-O-methyl-D-[14C]glucopyranose, and
D-[14C]fructose were excluded. Therefore, a kinetic
characterization of expressed glucose transport was also performed
(Table 1), thereby obtaining a
reduced affinity for glucose compared with mannose
(Fig. 2C) and a
similar stoichiometry (Fig.
2D). As with mannose, the effect of MAP17 was mainly on
the Vmax of glucose transport. Nevertheless, these results
should be considered as an approximation due to the low level of transport
expression and therefore the general error of the fits
(Table 1).
|
Sequencing and secondary structure. Two-direction sequencing revealed an 816-bp cDNA that encodes an open reading frame of 114 amino acid proteins and 12,243 Da (Fig. 3). This was confirmed by SDS-PAGE of in vivo (Fig. 4A) and in vitro (Fig. 4B) translated cRNA. In addition, a thiol-dependent dimerization seems to occur according to the 24-kDa signal observed under nonreducing conditions (Fig. 4B, lanes 13, and see Fig. 10B). A comparison of the nucleotide and amino acid sequences via BLAST found 82% identity with the human MAP17/DD96 (16, 17; GenBank accession NM_005764 [GenBank] ), an orphan protein selectively up-regulated in human carcinomas. A wide variety of weak identities was also found with several ATP-synthases, ATPases, Na-solute symporters, and transferases. The rat MAP17 cDNA was communicated to GenBank with accession no. AF402772 [GenBank] .
|
|
Hydropathy analysis (20) confirmed that rat MAP17 is an integral membrane protein with several possible models. These include one membrane-spanning domain (SAPS and PredictProtein-PHD servers) that, in addition, could contain an NH2-terminal signal peptide (SOSUIsignal, TMHMM, and SignalP), or two membrane-spanning domains without signal sequence (DAS, SosuiTM, and TMpred), a prediction problem that is common in membrane proteins with hydrophobic NH2 ends. In vitro translation using rabbit reticulocyte lysates in the presence of canine microsomes (Fig. 4B, lanes 2 and 5) showed no evidence of a signal sequence, as no change in mobility was observed compared with the absence of microsomes (lanes 1 and 4). The number of transmembrane domains was also directly determined by tagging MAP17 with HA in positions 5, 23, and 66 (see positions in Fig. 3). Given that all three mutants were fully functional in oocytes, they were transiently expressed in OK cells, and the proteins were immunodetected using an anti-HA primary and FITC-conjugated secondary antibodies, with or without saponin (Fig. 4C). Only HA23-expressing cells were immunodecorated without permeabilization of the membrane, therefore suggesting that this part of the protein is located extracellularly and that MAP17 contains two transmembrane domains, with both NH2 and COOH termini inside the cell. In addition, MAP17 is nonglycosylated (NetOGlyc 2.0 and the lack of an effect by endoglycosidase H, Fig. 4B, lanes 3 and 6) and contains several potential phosphorylation sites in serines, threonine, and tyrosine (Fig. 3). Additional searches found an anion-exchangers family 1 alignment at residues 56103 (ProfileScan) and a phosphomannomutase/phosphoglucomutase block at 7382 (Fig. 3). The PDZ-binding site at the COOH terminus (amino acids 111114) for interaction with the globular protein PDZK1/diphor1 (9, 18) is also shown underlined in Fig. 3.
Tissue and cell distribution of MAP17. Northern blot analysis showed that, as expected, MAP17 mRNA is very abundant in the rat kidney cortex, but also in the testis, and less so in the urinary bladder (Fig. 5A). We did not find expression in the duodenum, jejunum, ileum, colon, liver, spleen, lung, heart, brain cortex, brain stem, cerebellum, skeletal muscle, or adipose tissue. We also assayed several renal cell line RNAs, obtaining hybridization signals in Madin-Darby canine kidney (dog), LLC-PK1 (pig), and MCT (mouse) cells; OK cells do not seem to express MAP17.
|
Further localization studies were performed by in situ hybridization. In the kidney, the expression was similar to the human MAP17, that is, restricted to the proximal tubules, but from both superficial and deep nephrons (Fig. 5B). In the testis, MAP17 cRNA was expressed in seminiferous tubules (Fig. 5C), and Nomarski microscopy revealed a precise location in the spermatids (Fig. 5D).
A more detailed (subcellular) analysis of the epithelial expression of MAP17 was made by confocal laser immunofluorescence in OK cells permanently transfected with HA23-tagged MAP17. Figure 6 shows that, in the absence of saponin (A in figure; no permeabilization), MAP17 is located at the apical-most end of the cell membrane. Permeabilization with saponin, however, evidenced an additional immunodecoration in the cytoplasm, reminiscent of Golgi network staining, and a subtle staining of the nuclear membrane (Fig. 6B). Double staining of the cells with the Golgi marker BODIPY-TR showed that MAP17 colocalizes with a specific subset of the Golgi apparatus (Fig. 7, AF). Finally, this specific staining was also dispersed after treatment with the Golgi toxin brefeldin A (Fig. 7G).
|
|
Structure-function relationship. Pretreatment of MAP17-expressing
oocytes for 10 min with 1 mM of thiophilic pCMB inhibited the net
Na-D-mannose cotransport by 60%
(Fig. 8A). This was
not reversed on washout but rather by using
-mercaptoethanol, a result
expected from the covalent modification of cysteins
(Fig. 8A). Treatment
with thiol-oxidating methylthiosulfonates MTSEA or MTSET showed no effect at
either 1 or 5 mM and for 5, 10, or 30 min, most likely because the reagents
were not accessible to the cysteins (Fig.
8A). Next, we mutated the two cysteins, Cys20
(extracellular) and Cys55 (intracellular), of HA23-tagged MAP17
(Fig. 8B) to check
whether they were involved in the pCMB effect. We found that only
Cys55 and the double mutant Cys-less exhibited reduced mannose
transport, similar to the pCMB effect. Moreover, Western blot analysis showed
that these mutants also could not form homodimers
(Fig. 8C). This
therefore suggests a relationship between the quaternary conformation of MAP17
and transport induction, given that the abundance (measured by densitometry)
of the homodimer conformation signal in these experiments was only
20%
that of the monomer band, but it was responsible for 60% of the induced
transport.
|
Hybrid depletion of MAP17. To determine the role of MAP17 in mannose transport expressed in X. laevis oocytes by total kidney cortex mRNA, we performed hybrid depletion with three sense and three antisense 20-mer oligonucleotides. The small mRNA-induced Na-D-mannose cotransport in oocytes was abolished by the three antisense oligos (all located inside the open reading frame, at either the 5'- and 3'-ends or the center), with no effect provoked by the sense oligos (Fig. 9). Therefore, MAP17 is responsible for mannose transport expressed by rat kidney cortex mRNA in oocytes.
|
Evidence for the involvement of additional proteins. The small size of MAP17 and the low expression level of sugar transport induced in oocytes make it unlikely that this protein by itself represents a hexose transport system. Indirect evidence for the participation of additional proteins in the oocyte expression system arose from dose-response experiments of HA23-tagged MAP17 expression. Figure 10A shows that transport saturation appeared after 0.01 ng of MAP17 cRNA/oocyte. This could be explained, for example, by a saturation of the translation and/or by processing of the protein. However, a quantification of the synthesized protein by Western blotting and densitometric analysis showed that the protein plateau started after 0.1 ng/oocyte, in either the 12- or 24-kDa band (Fig. 10, B and C). As MAP17 does not have extracellular free amino groups, biotinylation of MAP17 to exclusively determine the protein inserted into the plasma membrane could not be performed. One possible interpretation of these results is that the expression of mannose transport in oocytes by MAP17 is restricted by the need for one or more endogenous proteins to be present in a limited amount, and therefore the increasing amounts of MAP17 would saturate the activity.
We then assayed a direct approach to find possible collaboration between
MAP17 and the characterized accumulative glucose transporters. The fact that
MAP17, in addition to mannose, induces Na-D-glucose and
Na-
-methyl-D-glucopyranoside cotransport
(Fig. 2, B and
C) and that it is inhibited by phloridzin
(Fig. 2A) indicates
that a member of the SGLT family could be interacting or being modified by
MAP17. As the SGLT-1 substrates D-galactose and
3-O-methyl-D-[14C]glucopyranose were not
transported (Fig. 2B),
SGLT-1 should be excluded
(38). Despite this, we
directly tested all three SGLT members characterized to date, namely, rat
SGLT-1 and SGLT-2 and pig SGLT-3, expecting that if one of them were
interacting with MAP17 in the kidney to transport D-mannose, then
coexpression of both in the oocyte would further increase the uptake shown by
MAP17 alone. The corresponding cRNAs were injected separately or coinjected
with either MAP17 by itself or in combination with MAP17 plus PDZK1 cRNAs
(Fig. 11A). The
globular, PDZ-containing protein PDZK1 was assayed, given that it was the
first protein reported to interact with MAP17. As a result, all SGLT cRNAs
induced Na-D-glucose cotransport at the expected intensities
(38). However, none of them
was able to induce significant net Na-D-mannose cotransport, either
alone or in different combinations with MAP17 and/or PDZK1. Subsequently, we
similary coinjected MAP17 and total rat kidney cortex mRNA into X.
laevis oocytes. As Fig.
11B shows, again poly(A)+ RNA and MAP17
induced a similar level of Na-mannose cotransport, and the coinjection of both
elicited a slight but significant stimulation above the mRNA injection
level.
|
Finally, several coimmunoprecipitations were performed in oocytes expressing either HA23-MAP17 alone or in combination with rat kidney cortex mRNA. In the absence of the cross-linker DTSSP (see MATERIALS AND METHODS), only the 12- and 24-kDa bands were precipitated (Fig. 12, arrows). However, with DTSSP additional proteins of 15, 19, and 28 kDa (arrowheads) were pulled. Of these, the 15- and 19-kDa bands represent oocyte proteins, because they were already precipitated by MAP17 injection alone. The 28-kDa band seems to represent a renal protein because it appeared exclusively in the MAP17/mRNA oocyte extracts. All other proteins were also precipitated in the water-injected oocytes.
|
| DISCUSSION |
|---|
|
|
|---|
-methyl-D-glucopyranoside, and phloridzin
(5,
10,
22,
39;
Fig. 2A). The main
difference in the mammalian system arises from the specificity of the
transport, given that most of the previous studies indicate that, even if
D-glucose inhibits D-mannose transport, both sugars do
not share the same route. This conclusion was deduced not only from the type
of inhibition (22,
30) but also from the fact
that D-mannose was not able to successfully inhibit
D-glucose transport
(22,
39). However, we have shown
that MAP17 also induces Na-coupled D-glucose transport in X.
laevis oocytes (Fig. 2,
BD), a result that could still be in
agreement with our data if, as we postulate, MAP17 is interacting/activating
an SGLT-related transporter other than SGLT-1, -2, or -3. In this event,
D-mannose would not completely inhibit the transport of
D-glucose, because additional SGLT members that do not collaborate
with MAP17 are present along the nephron
(38). In any case, it would
not be surprising if the putative SGLT-like protein of the X. laevis
oocyte had some functional differences with respect to its mammalian kidney
counterpart in accordance with their evolutionary distance. MAP17 was previously cloned in a search for mRNAs upregulated in renal carcinomas, but it also turned out to be overexpressed in most colon, lung, and breast carcinomas (16, 17). Now, we have also shown a physiological expression in the testis, more precisely in the spermatids (Fig. 5). Initial hydropathic analysis suggested the existence of a signal peptide and a transmembrane domain, because the software tools for molecular analysis cannot differentiate between signaling peptides and transmembrane domains when the amino acid sequence starts with a hydrophobic NH2 terminus. However, we have now shown by mutation analysis that the predicted signal peptide is actually a first transmembrane domain, and therefore that MAP17 spans twice the brush border of the tubular cells (Fig. 4C). In addition, we have also shown that MAP17 seems to form homodimers of 24 kDa (e.g., Fig. 4B), most likely through a disulfide bond between intracellular Cys55 residues (Fig. 8C). The presence of Cys55 also seems to be necessary for the complete expression of mannose transport by MAP17 (Fig. 8B), which indicates that either the homodimer conformation is implicated in the transport or, alternatively, Cys55 participates directly in the activation.
To understand the function of MAP17, human PDZK1 was initially identified as a globular protein containing four PDZ domains, the protein of which interacted with the COOH terminus of MAP17 (19). PDZK1 also interacts with the organic anion transporter cMOAT (18) and the CFTR chloride channel (7), whereas the rat (diphor1) (9) and mouse (NaPi-Cap1) (13) counterparts do so with the Na-phosphate cotransporter (NaPi-2). More recently, a direct interaction between MAP17 and NaPi-IIa has also been reported (26). Therefore, the challenge now is to identify the renal protein that interacts with MAP17 and transports D-mannose. In addition to the structural simplicity of MAP17, experimental evidence for the collaboration of MAP17 with another protein to produce the transport expression arises from dose-response experiments, given that the induction of mannose transport with increasing amounts of MAP17 cRNA does not parallel the expression of MAP17 protein in the oocyte (Fig. 10). A similar lack of correlation was reported, for example, for the amino acid transporter 4F2hc (4, 36), which encodes the heavy chain of a heteromultimeric complex. In this case, the low expression in oocytes was due to the use and depletion of the endogenous light chain of the oocyte (8). The function of PDZK1 could consist of either simply maintaining MAP17 in the plasma membrane or acting as an intermediary that joins MAP17 and a third protein with the characteristics of SGLT. Interestingly, the SGLT members known to date do not contain PDZ-binding domains, a characteristic that agrees with the lack of increase in the induction of mannose transport by MAP17 when MAP17/PDZK1 is coexpressed with SGLT-1, -2, and -3 (Fig. 11A). Independently of the sugar transporter implicated, the interactions with MAP17 seem to be very weak, as deduced from the lack of high bands coimmunoprecipitated with MAP17 (Fig. 12). The same result has been observed with the Na-phosphate cotransporter NaPi-IIa (26), a protein that interacts with MAP17 through its NH2 terminus, as shown in yeast two-hybrid assays: the interaction is so weak that pull-down experiments did not corroborate the interaction.
The interaction of MAP17 with the NaPi-IIa cotransporters is, at first, puzzling. The physiological meaning of this interaction is not yet known, but it adds additional appeal to the cell biology of this little protein, because its functions must not be restricted to sugar handling. For example, MAP17 could modulate the activity or organization of membrane transporters by direct interaction as the RS1 modifier (35), or through competition for PDZ-binding places to alter the stoichiometry of the transporters-PDZ proteins. In this way, MAP17 could force other PDZK1-associated proteins to reorganize in a PDZK1-independent way. The structural simplicity of MAP17 supports this simple regulatory role: first, MAP17 is integrated into the membrane with 2 spanning domains, followed by a single cytosolic region consisting of the last 48 amino acids. Second, we have inserted the 9 amino acid-HA tags in 3 different positions (MAP17 is only 114 amino acids long), and, surprisingly, all the resultant constructs are still able to induce the same mannose and glucose transport as the native protein. It is therefore evident that the structural requirements of MAP17 to induce its effects are not as sophisticated as they seem to be for the real transporters, even in a homodimer conformation. On the other hand, the binding of membrane proteins to different PDZ proteins seems to be a new mechanism of regulation, given that it is the CFTR chloride channel that binds either to PDZK1, which remains in the plasma membrane, or to CFTR-associated ligand, which continues to accumulate in the Golgi (7). Because MAP17 is expressed in both the plasma membrane and the Golgi, its expression could also be regulated in a similar way.
In summary, to our knowledge we are the first group to report a functional role of MAP17 in the cell, i.e., the induction of uphill transport of mannose and glucose in oocytes, most likely through the interaction or modulation of at least one other protein. We have also clarified its molecular structure and its location in the cell and tissues. Identification of all proteins interacting with MAP17 will help to understand the complete function of MAP17 in the kidney.
| DISCLOSURES |
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
-mannosidosis. Am J Hum
Genet 64:
7788, 1999.[ISI][Medline]
-type and
-type calcitonin gene-related peptide during postnatal rat brain
development. Neuroscience 80:
951970, 1997.[ISI][Medline]
This article has been cited by other articles:
![]() |
M. V. Guijarro, W. Link, A. Rosado, J. F.M. Leal, and A. Carnero MAP17 inhibits Myc-induced apoptosis through PI3K/AKT pathway activation Carcinogenesis, December 1, 2007; 28(12): 2443 - 2450. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Guijarro, J. F.M. Leal, C. Blanco-Aparicio, S. Alonso, J. Fominaya, M. Lleonart, J. Castellvi, S. Ramon y Cajal, and A. Carnero MAP17 enhances the malignant behavior of tumor cells through ROS increase Carcinogenesis, October 1, 2007; 28(10): 2096 - 2104. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Guijarro, J. F.M. Leal, J. Fominaya, C. Blanco-Aparicio, S. Alonso, M. Lleonart, J. Castellvi, L. Ruiz, S. Ramon y Cajal, and A. Carnero MAP17 overexpression is a common characteristic of carcinomas Carcinogenesis, August 1, 2007; 28(8): 1646 - 1652. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Lanaspa, H. |