|
|
||||||||
5Laboratory of Cardiological Sciences, Gerontology Research Center, Division of 1Renal Medicine, Johns Hopkins Bayview Medical Center, and 4Division of Pulmonary and Critical Care Medicine, Johns Hopkins University, Baltimore, Maryland 21224; and 2Center for Nephrology and 3Department of Physiology/Autonomic Neuroscience Institute, Royal Free and University College Medical School, University College London, London, W1T 3AA United Kingdom
Submitted 1 May 2003 ; accepted in final form 28 July 2003
| ABSTRACT |
|---|
|
|
|---|
autosomal dominant polycystic kidney disease; purinergic P2 receptors; chloride channels; kidney collecting tubules; patch-clamp techniques
ATP-stimulated Cl secretion may play a role in the accumulation of fluid required for cyst expansion. Stimulation of P2Y2/4 purinergic receptors by extracellular ATP is a potent stimulus for Cl secretion in many epithelial systems, including renal tubule cell epithelia (4, 6, 9), and is mediated by phospholipase C, increased intracellular Ca2+ ion concentration ([Ca2+]i; see Ref. 39), and activation of Ca2+-responsive Cl channels (possibly the Cl, Ca2+ channel; see Refs. 6 and 14). All the components for purinergic signal transduction have been identified within the ADPKD cyst, including: 1) expression of P2Y2 and other purinergic receptors in cyst epithelial cells, 2) ATP release from cyst epithelial cells, and 3) accumulation of ATP in the cyst lumen at micromolar levels (32). Cyst epithelial cells are responsive to extracellular ATP, which activates transepithelial Cl secretion through an increased [Ca2+]i (32).
In a previous study, it was shown that expression of the cytoplasmic COOH-terminal 193 amino acids of polycystin-1 (the sIgPKD193 fusion protein) resulted in upregulation of ATP-stimulated transepithelial Cl secretion (19). In the present study, we show that the effect of the fusion protein on transepithelial Cl secretion is mediated by an increase in the amplitude and duration of ATP-stimulated Cl conductance and that the prolongation of Cl conductance is because of an effect of the sIgPKD193 fusion protein to upregulate agonist-stimulated Ca2+ entry. Our observations are the first to demonstrate that polycystin-1 pathways modulate ATP-stimulated Cl conductance through effects on Ca2+ entry and provide a plausible link between the genetic lesion and the relentless cyst expansion responsible for loss of renal function in ADKPD.
| MATERIALS AND METHODS |
|---|
|
|
|---|
For the purpose of this investigation, we used three dexamethasone (Dex)-inducible sIgPKD193-expressing cell lines referred to as clones 2, 18, and 20. Three control lines were created, known as sIg (expressing the membrane expression cassette alone) and p8 and p9 (both derived from vector-alone transfections). These cell lines have been described previously (19, 36). Expression of the sIgPKD193 fusion protein was evident by Western blot analysis in these cell lines, whereas endogenous full-length polycystin-1 expression was only detectable by prolonged exposure of Northern blot or by RT-PCR. This indicated that the sIgPKD193 fusion protein was probably present in excess over endogenous full-length polycystin-1.
Cell culture. Stably transfected M1 cells were used from passages 220 and were handled as already described (36). In brief, cells were grown on Matrigel-coated glass coverslips and maintained in a 5% CO2 atmosphere at 37°C in DMEM-F-12 media (GIBCO) supplemented with 5% FCS (GIBCO). Where stated in the text, 1 µM Dex was added to the medium to induce fusion protein expression. Cells were seeded at 25,000 cells in 0.5-ml wells; the medium was changed to an FCS-devoid medium after 24 h of growth. Cells were used for electrophysiological and Ca2+-measurement studies between 2 and 4 days after seeding. In preparation for each experiment, a complete panel of all six lines was seeded in each plate, thereby excluding systematic bias in the growth intervals. Ca2+-imaging and patch-clamping studies were performed on identical-appearing single cells within clusters of
25 cells. The cell morphology and degree of confluency were therefore no different between cell lines in patch-clamp or Ca2+-imaging experiments. The cell capacitance measurements showed no difference between patched cells in the electrophysiological studies, indicating that there was no consistent variation in cell size between cell lines. We did not attempt to measure cilia length in these preparations but have noted the presence of apical cilia of similar appearance in all cell lines in separate studies of monolayers grown under identical circumstances.
General experimental design. Cells grown on glass coverslips were superfused (5 or 2 ml/min for patch-clamp or fluorescence studies, respectively) by a continuous-flow system that allowed quick addition and washout. Agonists were added for 10 s in patch-clamp studies and for 20 s in single-cell fluorescence studies and then washed for a period of 10 min in experiments requiring repeated stimulation. The majority of experiments were performed at room temperature, but one experiment was performed at 3436°C using a heated stage to confirm that the effect of fusion protein expression on the ATP-stimulated Ca2+ response was evident at physiological temperature.
Patch-clamp technique. The perforated-patch whole cell configuration of the patch-clamp technique was used. To establish the perforated patch, 10 µM
-escin was added to the pipette solution (12). An Axopatch 200B patch-clamp amplifier (Axon Instruments) and computer complete with pCLAMP 8.0 software (Axon Instruments) were used to acquire and analyze whole cell currents (I) or membrane voltage. Cells were viewed through the x40 objective of a Nikon inverted microscope. Patch pipettes were pulled from Kwik-Fil glass capillaries (World Precision Instruments) and had a resistance ranging between 3.5 and 4.0 M
. The reference electrode was an Ag/AgCl pellet. Current signals were filtered at 5 kHz and displayed on an oscilloscope (20 MHz digital storage, type 1425; Gould). Agonist-activated membrane currents at a holding potential (Vh) of 60 mV were recorded at room temperature (2123°C).
mRNA extraction. mRNA extraction and RT-PCR methods are as described previously (3). Briefly, M1 cell monolayers were resuspended in 1 ml TRIzol reagent (GIBCO-BRL) and passed through a pipette several times to ensure a homogeneous suspension. RNA was extracted using TRIzol/chloroform extraction and isopropyl alcohol precipitation according to the manufacturer's protocol. The final pellet was air-dried and resuspended in RNase-free distilled water. RNA concentration and purity were determined by spectrophotometry.
RT-PCR. Specific primers were selected from the sequence of the mouse P2Y2, P2Y4, and P2Y6 receptor cDNA by using Oligo Primer analysis software (Medprobe, Oslo, Norway). RT-PCR methods were as described previously (3). Briefly, 1 µg total RNA was reverse transcribed for 50 min at 42°C with 0.5 µl oligo(dT)1218 using a first-strand cDNA synthesis kit for RT-PCR (Superscript II RNase H RT; GIBCO-BRL). Negative controls were carried out in the absence of RT. The resulting cDNA template or negative control (10%) was used for PCR amplification with PCR Core System I (Promega, Southampton, UK) following the manufacturer's instructions. For all experiments, denaturation at 95°C for 3 min was followed by 30 cycles of 95°C for 30 s, annealing for 1 min and 72°C for 1 min, and then a final extension step of 72°C for 5 min. PCR products were resolved on a 2% (wt/vol) agarose gel containing 10 µg/ml ethidium bromide and visualized under ultraviolet illumination. Images were captured using a Fluor-S Multi-Imager (Bio-Rad). The primer sequences used were as listed as follows: P2Y2, CTTCAAGTACGTGCTGTTGC (forward) and AGGTGTCATGGCAAGTGATC (reverse); P2Y4, GCTATTCACATCACTAGGTC (forward) and GCAGTAGAGGTTCCAGTAGA (reverse); P2Y6, GGCTTGTTATTGTCGCA (forward) and GCCTCTGTAAGAGATCGT (reverse).
The annealing temperatures and product size for each reaction were as follows: P2Y2, 58°C and 470 bp; P2Y4, 58°C and 331 bp; P2Y6, 56°C and 329 bp.
Measurement of [Ca2+]i. A spectrofluorometric method with fluo 3-AM (dissolved in DMSO with 20% pluronic acid) as the Ca2+ indicator was used for measurement of [Ca2+]i in single cells. Cells were loaded with 10 µM fluo 3-AM in DMEM-F-12 medium for 30 min at room temperature (2123°C). Cells were then washed thoroughly with medium to remove extracellular fluo 3-AM and rested for 3045 min to allow for complete deesterification of cytosolic dye. Fluo 3-AM was excited at 488 nm with a xenon light source, and fluorescence was measured at 535 nm, recorded, and stored in a computer for data processing and analysis using pCLAMP 8.0 software. Photo bleaching and light-induced damage to cells were minimized by taking short measurements (of 120-ms duration) one time per second over a 200-s period. Studies were performed at room and physiological temperatures. On analysis, fluorescence data for each experiment were normalized to the individual basal fluorescence value to bring all the response curves to the same pretreatment starting point. Equivalent loading of cells was confirmed by incubation with the Ca2+ ionophore A-23187 (10 µM) and measurement of fluorescent signal in response to perfusion with a solution containing 10 mM Ca2+ (maximal) and subsequent quenching in 1 M manganese chloride (background). There were no consistent differences between cell lines with respect to the basal fluorescence values or efficiency of loading with fluo-3 AM. Fluorescent signal intensity was attenuated when cells were studied at 3436°C, where a down-sloping baseline indicated progressive loss of cytoplasmic dye as the probable explanation. Because of this, single-cell studies were not possible at physiological temperature, and, consequently, groups of
25 cells were imaged in the studies at the warmer temperature to increase the signal-to-noise ratio.
Measurement of Ca2+ influx. To measure Ca2+ influx after a Ca2+ release stimulus, cells were loaded with fluo 3-AM as described above and stimulated with 10 µM ATP for 30 s in a zero Ca2+ buffer to prevent refilling of the endoplasmic reticulum (ER) from capacitative Ca2+ entry. Three minutes following exposure to ATP, cells were switched to a buffer containing 2 mM Ca2+ (Ca2+ add-back). In each experiment, a field of
50 cells was imaged continuously. The absolute increase in fluorescent signal on Ca2+ add-back was taken as an indicator of the degree of activation of Ca2+ entry pathways. Because exposure to zero Ca2+ buffer might itself promote Ca2+ entry (7), baseline studies of the effect of transition from zero to normal external Ca2+ were performed. Ca2+ add-back responses are expressed as the peak fluorescent signal minus the value immediately preceding Ca2+ add-back.
Solutions. The standard bath solution was (in mM) 140 NaCl, 5 KCl, 1.8 MgCl2, 1.8 CaCl2, and 10 HEPES (adjusted to pH 7.45 with NaOH). For the evaluation of fluo-3 AM loading efficiency, the Ca2+ concentration of this buffer was increased to 10 mM. For the zero Ca2+ buffer, Ca2+ was replaced with 0.1 mM EGTA. In patch-clamp experiments, microelectrode pipettes were filled with (in mM) 140 KCl, 1.8 MgCl2, and 10 HEPES (adjusted to pH 7.4 with KOH and filter sterilized).
-Escin (10 µM) was added to the final pipette solution. All chemicals and reagents were purchased from Sigma, except for fluo 3-AM, which was obtained from Molecular Probes. Antagonists were preincubated for 10 min before the addition of ATP (
EC70 concentration, 3 µM ATP). The reversibility of receptor blockade was tested after a 10-min antagonist-washout period.
Data analysis. For concentration-response curves, data were normalized to the maximum current (Imax) evoked by ATP (10 µM). The agonist concentration that evoked 50% of the maximum response (EC50) was taken from Hill plots of the transform, log(I/Imax I). Concentration-response curves were fitted by nonlinear regression analysis using commercial software (Prism version 2.0; Graph-Pad). Decay times were calculated as the time for the ATP-induced current or cell Ca2+ response to fall from 80 to 20% of the peak value. Multiple comparisons between the six cell lines were made by one-way ANOVA, with significance accepted at P < 0.05 by unpaired two-tailed t-test with the Dunnett multiplicity adjustment, using
Instat II
software. Comparison between the two groups of cell lines (control vs. sIgPKD193) was made by unpaired t-test. Data are given as mean values ± SE for n experiments.
| RESULTS |
|---|
|
|
|---|
|
The ATP concentration-response relationships for clones sIg and 18 were identical in the presence and absence of Dex (Fig. 2A), indicating that there was no effect of Dex or fusion protein expression on receptor sensitivity to agonist activation. A range of nucleotide agonists was tested for activity in the control cell line (sIg, plus Dex) and the sIgPKD193 clone (18, plus Dex) to test whether expression of the sIgPKD193 fusion protein resulted in a change in receptor subtype expression (Fig. 2B). The agonists used were ATP, UTP, 2-methylthio-ATP (2-meSATP), and 2'3'-O-(4-benzoyl-benzoyl)-ATP (BzATP). The potency order for both sIg and 18 (by comparison of EC50 values) was ATP = UTP > 2-meSATP > BzATP. In both cases, 2-meSATP and BzATP were partial agonists. The same results were found in the absence of Dex treatment (data not shown). This pharmacological profile was consistent with the presence of P2Y2, P2Y4, and/or P2Y6 receptors (all responsive to uridine compounds). RT-PCR analysis performed on parental M1 cells confirmed expression of mRNA for each of these purinergic receptor subtypes (Fig. 2C).
|
The current response to ATP was characterized with respect to the reversal potential and antagonist profile, as shown in Fig. 3, A and B. Current-voltage analysis was performed, in conditions symmetric with respect to Cl, Mg2+, and HEPES, on ATP-evoked currents (10 µM, EC100 value) in Dex-treated cell lines sIg and 18. These studies yielded near-zero reversal potentials. Treatment with the P2 antagonist pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid (PPADS; 100 µM) blocked ATP-evoked currents equally in sIg and 18, as did the Cl-channel blocker DIDS (100 µM). The current-voltage analysis and response to DIDS indicated that the current was carried by Cl.
|
As demonstrated by others, the effect of ATP on Cl conductance is mediated by increased cell Ca2+ (6, 9, 31). ATP-stimulated cell Ca2+ responses are biphasic, with an initial peak resulting from Ca2+ release from the ER, followed by a more prolonged phase resulting from Ca2+ entry from outside the cell (5). The latter component, described as
store-operated
Ca2+ entry, is thought to be triggered by ER Ca2+ store depletion and serves as the means of replenishing these Ca2+ stores (30). The prolongation of the decay phase of the ATP-stimulated current induced by expression of the sIgPKD193 fusion protein therefore suggested that the truncated polycystin-1 fusion protein might have upregulated store-operated Ca2+ entry. Consistent with this possibility, removal of bath Ca2+ by EGTA (0.1 mM) had no effect on control clone sIg but shortened the decay phase of the ATP response to a control configuration in sIgPKD193-expressing clone 18 (Fig. 3C). This effect was partially reversed after a 10-min washout of EGTA, revealing a biphasic decay of Cl current in clone 18. Measurements of [Ca2+]i were therefore made to explore the possibility that altered cell Ca2+ responses could have explained the effect of the sIgPKD193 fusion protein on ATP-stimulated Cl conductance.
Fluorescence Ca2+ measurements. Changes in [Ca2+]i were measured in single cells after treatment with 1100 µM ATP in the presence and absence of Dex. ATP (10 µM) yielded the maximal fluorescence increase across all cell lines. Mean single-cell basal and maximum ATP-stimulated fluorescence values were the same for the two groups of cell lines (basal: controls = sIgPKD193 = 0.0012, maximal ATP stimulated: controls = sIgPKD193 = 0.002, all expressed as nonnormalized arbitrary units). Activation times were calculated from 20 to 80% of the rise time of the curve as follows: 27.4 ± 5.5s(n = 5), 21.9 ± 2.5s(n = 4), and 25.9 ± 2.0 s (n = 5), for sIg, p8, and p9 and 23.7 ± 1.5 s (n = 6), 22.6 ± 1.2 s (n = 11), and 26.7 ± 1.7 s (n = 7) for clones 2, 18, and 20 (+Dex), respectively. Activation times were not significantly different between cells expressing the sIgPKD193 fusion protein and control cells. Dex-induced expression of the sIgPKD193 fusion protein caused an increase in the 8020% decay time of the [Ca2+]i response in sIgPKD193 cell lines (as shown for clone 18 in Fig. 4A) that resembled the effect seen with Cl current in the patch-clamp experiments. Dex had no such effect in control cells (as shown for clone sIg in Fig. 4A). There were no differences in decay time between cell lines in the absence of Dex treatment. The effect of fusion protein expression on decay time was consistently seen in comparisons between all sIgPKD193 and control cell lines, as summarized in Fig. 4B. Single cell [Ca2+]i responses to ATP had a longer duration than the single cell current responses. This could be explained in a number of ways, since Cl channel inactivation is regulated by non-Ca2+-dependent mechanisms. For example, Ca2+-activated Cl channels exhibit voltage-dependent Ca2+ sensitivity (24) and are inactivated after ATP stimulation by parallel induction of tetrakiphosphate synthesis (8). Removal of bath Ca2+ (0 Ca2+, 0.1 mM EGTA, Fig. 5) had no detectable effect on the [Ca2+]i response of control clone sIg but decreased the [Ca2+]i decay time in clone 18, transforming it to a control-type response. The effect of EGTA on the [Ca2+]i response to ATP was reversible within 30 min (data not shown). Hence, the prolongation of decay of ATP-induced current and [Ca2+]i was dependent on fusion protein expression and the presence of Ca2+ in the extracellular medium. The absence of an effect of Ca2+ withdrawal on the ATP-induced [Ca2+]i response of the control cell lines suggested that the contribution made by store-operated Ca2+ entry to the [Ca2+]i curve was small and not resolvable in these cells by the fluorescent Ca2+ protocols employed in these studies. ATP-evoked (10 µM) changes in [Ca2+]i were also modulated by the addition of PPADS (100 µM), where the fluorescence ratio increase was reversibly inhibited by 53.4 ± 9.6% (n = 3) in sIg (+Dex) and 61.1 ± 12.4% (n = 3) in clone 18 (+Dex); these values were not significantly different in the absence of Dex. DIDS (100 µM) had no effect on [Ca2+]i levels in any of the clones, irrespective of Dex treatment (n = 3 for each experimental group, data not shown).
|
|
To dissociate Ca2+ release from Ca2+ entry, [Ca2+]i was measured on return of Ca2+ to the bath 3 min after stimulation with ATP in zero Ca2+ buffer. The increase in fluorescence signal indicated Ca2+ influx, which was activated by transition from 0 to 2 mM Ca2+ alone in baseline (non-ATP-treated) experiments (Fig. 6A). Interestingly, prior stimulation of Dex-treated cells with ATP did not increase the Ca2+ influx response above basal in control cells but evoked a significant supra-basal increase in Ca2+ influx in cells expressing the sIgPKD193 fusion protein (Fig. 6, B and D, P = 0.0052). Control cell line responses were the same in Dex plus vs. Dex minus experiments, whereas the effect of ATP on the Ca2+ entry response in the sIgPKD193 cell lines was reduced (although not completely to control cell line levels) in the absence of Dex (Fig. 6, B, C, and D, P = 0.048). Peak ATP responses in the absence of Ca2+ were not significantly different in these experiments.
|
| DISCUSSION |
|---|
|
|
|---|
Expression of the sIgPKD193 fusion protein did not alter the agonist pharmacological profile of the response, indicating that the effect on ATP-stimulated Cl conductance did not appear to be mediated through an alteration in the expression pattern of purinergic receptor subtypes. Expression of the fusion protein did not appear to have wider nonspecific effects on these cells, since the resting membrane potential, basal currents, and whole cell capacitance were similar in the two groups of cell lines.
Expression of the sIgPKD193 fusion protein increased the peak of the ATP response but also significantly slowed the recovery to baseline current after washout. As other investigators have shown (5), the effect of extracellular ATP on cell Ca2+ is biphasic, with an early peak attributable to Ca2+ release from the ER and a more sustained phase that is probably triggered by a subsequent period of Ca2+ entry from the extracellular solution, termed the store-operated phase (30). ATP-induced changes in cell Ca2+ are responsible for the effect of ATP on Cl channel activation (6, 9, 31). We show in the present paper that the sIgPKD193 fusion protein-induced prolongation of ATP-induced Cl current was probably the consequence of upregulation of store-operated Ca2+ entry. The evidence for this was fourfold. 1) Removal of bath Ca2+ before stimulation with ATP resulted in acceleration of the decay in current, transforming the ATP response of the sIgPKD193-expressing cell lines to a control pattern. This manipulation did not affect the ATP response of the control cell lines. 2) The [Ca2+]i response to ATP was prolonged in the sIgPKD193-expressing cell lines. 3) As was seen with the ATP-stimulated Cl current, withdrawal of bath Ca2+ returned the [Ca2+]i response to a control pattern. 4) The Ca2+ add-back studies demonstrated that expression of the sIgPKD193 fusion protein introduced, or activated, an ATP-dependent Ca2+ entry pathway that was not detectable in the control cell lines. This Ca2+ entry pathway persisted to a lesser extent in the sIgPKD193 cells in the absence of Dex but was significantly increased by Dex treatment only in the sIgPKD193 cell lines. The persistence of the effect in the absence of Dex could be explained by background leak of fusion protein expression in noninduced cells (19) and was of insufficient magnitude to appreciably affect the current or cell Ca2+ responses recorded in the absence of Dex in the single cell experiments.
Unexpectedly, although the peak amplitude of the whole cell current response was increased in cells expressing the sIgPKD193 fusion protein, we could detect no corresponding difference in the peak amplitude of the single-cell Ca2+ responses. Thus there was no evidence, in our experimental model, for an effect of the sIgPKD193 fusion protein to increase ER Ca2+ release. If ER release was not affected by the sIgPKD193 fusion protein, then the fusion protein might have upregulated the ATP-induced peak current through increased cell responsiveness to the initial phase of Ca2+ release from the ER, but we have not addressed this issue in the current studies.
Aguiari et al. (1) also found that expression of the truncated COOH-terminus of polycystin-1 in human embryonic kidney (HEK-293) cells increased the cell Ca2+ response to ATP. However, in contrast to our findings, these authors concluded that the truncated fusion protein was increasing cell Ca2+ responses via an effect on ER Ca2+ release. This conclusion was based on parallel experiments in stably transfected HeLa cells treated with histamine, but the effect of the fusion protein on peak histamine-stimulated [Ca2+]i, whether in the presence or absence of bath Ca2+, seemed marginal in the data presented by these authors. In fact, their figures showed that the truncated polycystin-1 fusion protein introduced a plateau to the ATP-induced Ca2+ response in HEK cells and suggested that the fusion protein increased store-operated Ca2+ entry induced by histamine in HeLa cells. We have directly demonstrated that the truncated polycys-tin-1 fusion protein augmented Ca2+ entry after treatment with ATP in a well-characterized collecting duct-derived cell line. Furthermore, we have established that this may represent a mechanism of disease, for the first time linking disturbance of polycystin pathways to the prolongation of an ATP-stimulated Cl current. Aguiari et al. found that expression of the truncated polycystin-1 fusion protein increased the peak amplitude of Ca2+ responses, whereas we found no such effect. Our single-cell studies were performed at room temperature, and those of Aguiari et al. were performed at 37°C; therefore, to exclude the possibility that the truncated polycystin-1 fusion protein might only increase the amplitude of Ca2+ responses at the warmer temperature, we repeated a series of ATP-induced Ca2+ responses at physiological temperatures. As seen in the original experiments, the cell Ca2+ responses remained prolonged in cells expressing the PKD193 fusion protein studied at 3436°C (the time taken for the decline from 80 to 20% of the peak response was 29 ± 1.8 s in control vs. 38 ± 3.2 s in PKD193-expressing cells, P = 0.037, n = 11 and n = 16 respectively), and peak Ca2+ responses were not increased in cells expressing the PKD193 fusion protein studied at the physiological temperature (fluorescence ratio: control 0.722 ± 0.109, PKD193-expressing cells 0.561 ± 0.117, n = 11 and 16, respectively). We have no definitive explanation for the differences in peak responses between the two studies, but it is possible that the truncated polycystin fusion protein exhibits cell type-specific effects. Alternatively, this difference might have arisen from compartmentalization, since the bioluminescent protein aequorin (the Ca2+ indicator used by Aguiari et al.) might not share the same cell distribution as the Ca2+ indicator dye fluo 3. In any case, the peak Ca2+ response is, at best, an indirect indicator of ER Ca2+ release and might be influenced by other Ca2+ fluxes arising from within or outside the cell.
In another recent study, Nauli et al. (27) described the cell Ca2+ response to thrombin in distal renal tubule cells derived from a transgenic mouse with a targeted deletion of exon 34 of the PKD1 gene (25). Interestingly, loss of polycystin-1 function in these cells resulted in an increased cell Ca2+ response to thrombin, which was evident at the peak but also in the prolonged phase of the response, persisting for some 16 min after stimulation. Although these authors concluded that polycystin-1 was regulating Ca2+ release from the ER, their data actually showed that removal of bath Ca2+ brought the prolonged phase responses of control and transgenic cells together and caused a much greater reduction in the peak response of the transgenic cells compared with the controls. Loss of functional polycystin-1 therefore appeared to result in a greater dependency on external Ca2+, a finding very similar to our observations of the effect of the sIgPKD193 fusion protein. Therefore, the effects of the sIgPKD193 fusion protein described in the present study seem to indicate that the sIgPKD193 fusion protein acted as a dominant negative in the M1 cortical collecting duct cells, promoting increased store-operated Ca2+ entry through inhibition of the function of native polycystin-1.
The pathophysiological significance of our findings may be assessed in the context of what is known of disease mechanisms in ADPKD. In ADPKD, the epithelial cells lining the cysts are derived from proximal and distal tubules, both of which usually function to reabsorb fluid from the tubule lumen. Clearly, for cyst expansion, fluid must be secreted in the cyst lumen at a rate that exceeds the rate of fluid reabsorption. In all secretory epithelia, fluid secretion is stimulated by increased intracellular cAMP or elevated cell Ca2+, acting on cystic fibrosis transmembrane conductance regulator (CFTR) or Ca2+-activated Cl channels, respectively (16). Even in typically reabsorptive renal tubular epithelia grown in tissue culture, fluid secretion can be activated by these stimuli, and there is some evidence that such pathways also exist in vivo (15). However, the role of agonist-stimulated Cl secretion in ADPKD is uncertain, and studies of cyst epithelia have not revealed any upregulation of CFTR-mediated secretion compared with a variety of noncystic renal tubular epithelial cell lines (35). Our data suggest that polycystin pathways may be involved in the regulation of fluid secretion in response to purinergic stimulation. This is a biologically plausible hypothesis, since all the components for purinergic pathway activation are present in the cyst environment (32). Furthermore, there is increasing evidence that polycystin pathways are involved in the regulation of intracellular Ca2+ homeostasis, perhaps modulating the activity of transient receptor potential-type channels that are thought to mediate store-operated Ca2+ entry in eukaryotic cells (37, 40).
How does the activity of the sIgPKD193 fusion protein relate to the function of full-length polycystin-1? Many other investigators have studied the activity of the truncated cytoplasmic COOH-terminus of polycystin-1. In such studies, some of the effects of the truncated fusion protein suggested that it might act like polycystin-1: induction of in-gel tubulogenesis, binding and activation of G
1 (28, 29). Others have shown effects suggesting interruption of the actions of polycystin-1: stabilization of
-catenin (22), transformation of the cAMP growth phenotype from normal to polycystic (17, 36, 41), and augmentation of ATP-stimulated Cl secretion (19). In other studies, the relationship to polycystin-1 pathways cannot be inferred easily, for example, activation of the transcription factor activator protein-1 (2), stabilization of RGS7 (21), and induction of an oocyte cation conductance of uncertain origin (38). Perhaps the manifestations of expression of the isolated COOH-terminus of polycystin-1 depend on the activity of endogenous pathways and the cell system examined. In our studies, expression of the sIgPKD193 fusion protein promoted a secretory phenotype, as would be predicted in cystic epithelia. Thus, in our experimental system, it appears that the fusion protein might have interrupted the function of the native full-length polycystin-1 protein. This conclusion is strengthened by the data of Nauli et al. (27), which appears to support a role for polycystin-1 in downregulating agonist-stimulated Ca2+ entry.
Our observations are the first to directly indicate that polycystin-1 pathways regulate agonist-stimulated Ca2+ entry and provide, for the first time, a link between polycystin-1 and fluid secretion. Therefore, we propose that loss of functional polycystin-1 in ADPKD results in upregulation of store-operated Ca2+ entry after a Ca2+ release stimulus and that the subsequent activation of transepithelial Cl secretion may play an important role in cyst development and expansion.
| DISCLOSURES |
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked
advertisement
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Xu, S. Rossetti, L. Jiang, P. C. Harris, U. Brown-Glaberman, A. Wandinger-Ness, R. Bacallao, and S. L. Alper Human ADPKD primary cyst epithelial cells with a novel, single codon deletion in the PKD1 gene exhibit defective ciliary polycystin localization and loss of flow-induced Ca2+ signaling Am J Physiol Renal Physiol, March 1, 2007; 292(3): F930 - F945. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Turner, B. F. King, K. S. Srai, and R. J. Unwin Antagonism of endogenous putative P2Y receptors reduces the growth of MDCK-derived cysts cultured in vitro Am J Physiol Renal Physiol, January 1, 2007; 292(1): F15 - F25. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Hooper, A. Boletta, G. G. Germino, Q. Hu, R. C. Ziegelstein, and M. Sutters Expression of polycystin-1 enhances endoplasmic reticulum calcium uptake and decreases capacitative calcium entry in ATP-stimulated MDCK cells Am J Physiol Renal Physiol, September 1, 2005; 289(3): F521 - F530. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |