|
|
||||||||
1 production by HGF in attenuation of murine diabetic nephropathy
Division of Molecular Regenerative Medicine, Department of Molecular Regenerative Medicine, Osaka University Graduate School of Medicine, Yamadaoka 2-2-B7, Japan
Submitted 27 May 2003 ; accepted in final form 16 September 2003
| ABSTRACT |
|---|
|
|
|---|
1 (TGF-
1) plays a key role in this process, especially in eliciting hypertrophy and matrix overaccumulation. Thus it is important to find a ligand system to antagonize the TGF-
1-mediated pathogenesis under high-glucose conditions. Herein, we provide evidence that hepatocyte growth factor (HGF) targets mesangial cells, suppresses TGF-
1 production, and minimizes glomerular sclerotic changes, using streptozotocin-induced diabetic mice. In our murine model, glomerular sclerogenesis (such as tuft area expansion and collagen deposition) progressed between 6 and 10 wk after the induction of hyperglycemia, during a natural course of diabetic disease. Glomerular HGF expression levels in the diabetic kidney transiently increased but then declined below a basal level, with manifestation of glomerular sclerogenesis. When anti-HGF IgG was injected into mice for 2 wk (i.e., from weeks 4 to 6 after onset of hyperglycemia), these glomerular changes were significantly aggravated. When recombinant HGF was injected into the mice for 4 wk (i.e., between 6 and 10 wk following streptozotocin treatment), the progression of glomerular hypertrophy and sclerosis was almost completely inhibited, even though glucose levels remained unchanged (>500 mg/dl). Even more important, HGF repressed TGF-
1 production in glomerular mesangial cells even under hyperglycemic conditions both in vitro and in vivo. Consequently, not only albuminuria but also tubulointerstitial fibrogenesis were attenuated by HGF. Overall, HGF therapy inhibited the onset of renal dysfunction in the diabetic mice. On the basis of these findings, we wish to emphasize that HGF plays physiological and therapeutic roles in blocking renal fibrogenesis during a course of diabetic nephropathy.
chronic renal failure; glomerular sclerosis; hepatocyte growth factor; transforming growth factor-
Several lines of evidence revealed critical roles of transforming growth factor-
1 (TGF-
1) during the progression of glomerular lesions in diabetic nephropathy: 1) TGF-
1 expression is upregulated by glucose and enhances extracellular matrix (ECM) accumulation in mesangial cells (36, 48); 2) TGF-
1 expression levels are markedly increased in mesangial areas in animals or in patients after the onset of diabetic nephropathy (43); and 3) importantly, neutralization of TGF-
1 actions with a specific antibody suppresses glomerular hypertrophy as well as sclerosis in vivo (33, 47). Thus TGF-
1 is now considered to be a key molecule that aggravates diabetic nephropathy (13, 34). To prevent TGF-
1-mediated fibrogenesis under diabetic conditions, there may possibly be a self-protection mechanism in vivo, but such a defense system is not well understood.
Hepatocyte growth factor (HGF) was originally identified and cloned as a potent mitogen for mature hepatocytes (27, 28). HGF is a potent mitogen and morphogen for renal tubular epithelial cells (3, 21). Actually, HGF accelerates renal tubular repair after the onset of acute renal failure, with rapid recovery of tubular morphology and functions (14, 16). Of note, HGF has therapeutic effects on chronic renal failure linked with enhanced tubular regeneration, and tubulointerstitial fibrosis was inhibited (15, 2325, 44, 45) even when renal function was impaired. These studies focused on HGF's roles mainly related to tubular and tubulointerstitial lesions. We recently obtained evidence that HGF works on mesangial cells and then inhibits their proliferation in a rat model of acute glomerulonephritis (4). Nevertheless, it is still unclear whether HGF directly inhibits chronic mesangial injuries, an important cascade leading to renal dysfunction (29).
To elucidate a role of HGF during the onset of glomerular injuries, we focused on diabetic nephropathy, because glomerular sclerogenesis (including hypertrophy and matrix overdeposition) precedes the onset of tubulointerstitial fibrosis, and this time lag seems advantageous to determine whether HGF's roles regarding glomeruli are direct or indirect. In this study when we used streptozotocin (STZ)-injected mice as a model of diabetic nephropathy, we found that HGF prevents chronic glomerular lesions, which may determine predisposition to albuminuria, tubulointerstitial fibrosis, and renal dysfunction. We describe herein physiological and therapeutic effects of HGF to suppress TGF-
1-induced pathological states in hyperglycemia-linked nephropathy.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents. For HGF-neutralizing treatment, anti-HGF antibody was raised by immunizing rat HGF in normal rabbits. The anti-HGF IgG cross-reacts with mouse (but not human) HGF and accelerates renal fibrogenesis (24, 25). A variant type of recombinant human HGF (rh-HGF) was produced by Chinese hamster ovary cells, a cell line transfected with human HGF cDNA with a deletion of 5 amino acid residues in the first kringle domain (1416, 2325). The HGF protein was >98% pure.
Observations on the natural course of diabetic nephropathy. Twenty STZ-injected mice were housed under specific pathogen-free conditions and were fed a standard diet (MF, Oriental yeast, Tokyo, Japan). To analyze the natural course of renal phenotypes, mice were killed at 0, 2, 6, and 10 wk after the STZ treatment (each group includes 5 mice). At necropsy, they were anesthetized with pentobarbital sodium (50 mg/kg ip), and plasma and renal tissues were collected for biochemical or pathological analyses, as described below.
Anti-HGF antibody treatment. For the anti-HGF IgG treatment, another 12 STZ-injected mice were generated. Four weeks after the STZ injections, they were divided into two groups (based on clinical data as described below) and intraperitoneally injected with the rabbit anti-rat HGF IgG (250 µg/mouse; n = 6) or normal rabbit IgG (250 µg/mouse; n = 6) on alternate days over a period of 12 days. These mice were killed on day 14 after start of this treatment.
Administration of exogenous HGF. To evaluate the effect of rh-HGF on progression of diabetic nephropathy, 12 diabetic mice were prepared. These mice were found to be in an early stage of renal insufficiency when their blood urea nitrogen (BUN) levels reached near 40 mg/dl (e.g., 6 wk after the STZ treatments), and they were then divided into an HGF-injected group and a saline-injected group: in the rh-HGF-injected group (n = 6), mice were given 300 µg·kg-1·12 h-1 HGF sc daily for 28 days, whereas control mice (n = 6) received subcutaneous injections of an identical volume of saline.
Blood and tissue chemistry. Plasma glucose levels were determined using a kit (Glucose B test, Wako, Osaka, Japan). BUN levels were determined with the urease indophenol method, using a kit (Urea B test, Wako) (23). The plasma creatinine level was measured using a kit (Creatinine test, Wako) (23). In an experiment related to rh-HGF therapy, plasma was obtained from postorbital veins on weeks 6, 8.5, and 10 and subjected to the laboratory examinations. The urinary albumin levels were determined, using a kit (A/G B test, Wako) (23, 24). Renal tissue extracts were prepared, as described (2325). Renal HGF levels were determined in ELISA, using a kit (HGF EIA, Institute of Immunology, Tokyo, Japan). Renal TGF-
1 levels were determined, using an ELISA kit (Quantikine TGF-
1, R & D) (2325). Renal monocyte chemoattractant protein-1 (MCP-1) levels were determined using a sandwich ELISA system (Amersham-Pharmacia, Little Chalfont, UK).
Histopathology. The left kidneys were excised and fixed in cold 70% ethanol. The transversally trimmed kidney tissues were submitted to a routine process for paraffin embedding. The sections were cut into 4-µm slices, dewaxed, and then stained with hematoxylin and eosin. The remaining sections were subjected to immunohistochemistry: goat IgG against mouse type IV collagen (1:400; Chemicon, Temecula, CA) was used for the primary reactions to determine the extent of glomerular sclerosis. To visualize the primary antibody, an avidin-biotin coupling (ABC) immunoperoxidase technique was used together with a commercial kit (Vectstain Elite ABC, Vector Labs, Burlingame, CA) (2325). To detect the expression of growth factors, rabbit IgG against rat HGF (1:1,000) [prepared in our laboratory (24, 25)] and rabbit IgG against porcine and human TGF-
1,2,5 (pan-TGF-
) (1:100) were used for the primary reactions, followed by the ABC technique mentioned above. To support the fibrogenic events in diabetic kidneys, other parameters such as fibronectin, type I collagen,
-smooth muscle actin (
-SMA; a marker for myofibroblasts), and Mac-1 (a marker for macrophages) were detected immunohistologically as described (2325). To detect a chemokine involved in macrophage influx, anti-mouse MCP-1 hamster IgG (BD Biosiences, San Jose, CA) was used, followed by the ABC technique as mentioned.
Renal morphometry. Glomerular sclerosis (characterized by mesansial expansion) was graded according to the extent of mesangial involvement on a scale of 0 to 4: 0, normal; 0.5, small focal area of the tubular injury; 1, involvement of over 10% of the cortex; 2, involvement up to 25% of the cortex; 3, involvement up to 50 to 75% of the cortex; and 4, extensive damage involving more than 75% of the glomeruli (23). To evaluate the glomerular tuft hypertrophy, glomerular size was determined by measuring the glomerular area on the same glomeruli, by means of a video microscope (VM-30, Olympus, Tokyo, Japan). The glomerular scores of collagen (IV/I), TGF-
1,
-SMA, and fibronectins were determined as described (23). The overall means of these parameters were calculated based on individual values (n = 6), which were determined in at least 30 glomeruli per mouse. Finally, the degree of tubulointerstitial lesions was evaluated based on interstitial Mac-1,
-SMA, and type IV collagen scores (24, 25). These semiquantitative analyses were all made in a blinded fashion.
In vitro study. To evaluate the direct effect of HGF on TGF-
1 production, we prepared an in vitro model of diabetic nephropathy, based on reported data (36). We used human normal mesangial cells (HNMC; Sanko, Chiba, Japan) to induce fibrogenic phenotypes: the culture was passaged in dishes supplemented with 10% fetal bovine serum containing MCDB-131 (GIBCO, Grand Island, NY). These cells were adjusted at a density of 3 x 104 cells/cm2 in a 48-well plate at 37°C overnight and then the medium was replaced with fresh serum-free MCDB-131, where D-glucose was pulsed at concentrations of 5.5 mM (=100 mg/dl, i.e., normal) or 33 mM glucose (=600 mg/dl, i.e., diabetic). After the medium change, rh-HGF was added to the culture systems in various doses (030 ng/ml), and TGF-
1 levels in the supernatants were determined, as mentioned. To evaluate the fibrogenesis on mesangial cells, type IV collagen and
-SMA expressions were evaluated in an immunoblot analysis for lysates of cultured cells, as described (4). We extracted mRNA from HNMC using an acid guanidium thiocyanate-phenol chlorform method. To determine changes in TGF-
1 at transcription levels, mRNA was reversed to cDNA and subjected to amplification with primers specific to TGF-
1 cDNA (sense vs. antisense primer): CCGCAAGGACCTCGGCTGGAA vs. GATCATGTTGGACAGCTGCTC. As an internal control, GAPDH was used (GGATTTGGCCGTATTGG vs. GGATTTGGCCGTATTGG).
Statistical analyses. All data are expressed as means ± SD. An unpaired two-tailed t-test was used to compare the means, and a value of P < 0.05 was considered to have statistical significance. Linear regression analysis was employed to evaluate the significance of the relationship between variables, using statistical computer software (Start-View J 5.0, SAS Institute Tokyo, Japan) (24).
| RESULTS |
|---|
|
|
|---|
|
Involvement of a decrease in HGF-positive glomerular cells in tuft sclerotic injuries. Measurement of endogenous HGF in whole renal tissues included glomerular and peritubular HGF and did not accurately reflect glomerular HGF changes. Thus we counted the number of HGF-positive cells in glomeruli, as described (4). The HGF-positive glomerular cells transiently increased 2 wk after STZ injections, followed by significant losses of intrinsic HGF, especially noted at 10 wk following the induction of diabetes (0W: 4.46 ± 0.57 vs. 10W: 2.15 ± 0.31 cells per glomerulus, P < 0.01; Fig. 2A, left). The degree of glomerular HGF expression negatively correlated with the glomerular collagen IV score during the progression of diabetic nephropathy in our mouse model (Fig. 2A, middle). Furthermore, there was an inverse correlation between the HGF-positive glomerular cell number and tuft area sizes (Fig. 2A, right). To elucidate the significance of the decreased HGF, we injected anti-rodent HGF-neutralizing IgG into the diabetic mice from 4 wk after STZ injections for 2 wk: in the HGF-neutralized mice, glomerular sclerogenic findings (such as type IV collagen deposition and tuft size expansion) were evident compared with those in the normal IgG-treated group (Fig. 2B). The glomerular type IV collagen score was 1.8-fold higher in the HGF-neutralized mice than in placebo-treated mice (1.71 ± 0.20 vs. 0.96 ± 0.17, P < 0.01). Furthermore, the size of the glomerular area in the mice significantly increased after the anti-HGF IgG treatment. Thus we hypothesized that a change in glomerular HGF expression may affect the initial pathogenesis of diabetic nephropathy.
|
Effect of exogenous HGF administrations on diabetes-related conditions in mice. To gain support for our hypothesis, supplement therapy with rh-HGF was given to the diabetic mice during a 4-wk period (from weeks 6 to 10 after STZ injections), because: 1) intrinsic HGF rapidly declined within this time and 2) in the earlier phase (i.e., 2W), the mice showed hydration and did not stably manifest renal dysfunction. Throughout the administration periods, rh-HGF did not alter the natural course of blood glucose levels, noted in diabetic mice treated with saline (Fig. 3A). We next checked BUN and creatinine levels in mice to estimate renal functions: in salineinjected mice, BUN levels gradually increased, up to the end-point (i.e., 10W) of this study. Of note, HGF suppressed increases in BUN levels at 8.5 and 10 wk after the onset of diabetic conditions (Fig. 3B). Furthermore, HGF also inhibited the elevation of plasma creatinine levels at the time of death, with a significant difference (Fig. 3C), thus indicating that HGF functioned to inhibit progression of renal dysfunction, even though blood glucose levels were still higher.
|
Attenuations of glomerular changes in diabetic mice by HGF therapy. To explain the therapeutic effects by HGF on chronic renal failure, we first focused on glomerular lesions, an initial hallmark of diabetic nephropathy (5, 31). In saline-injected diabetic mice, some glomeruli became hypertrophic, with a hyalynosis-like lobular nodule (Fig. 4A, left). In contrast, glomerular hypertrophy decreased in HGF-treated diabetic mice, with almost normal capillary morphology (Fig. 4A, middle). In the HGF-treated animals, glomerular tuft size was reduced to the level seen in the pretreatment group (e.g., 6W; Fig. 4A, right). Ratios of left kidney weight to heart weight in diabetic mice are pretreatment (6W) = 1.98 ± 0.24, saline (10W) = 2.52 ± 0.57, and rh-HGF (10W) = 1.91 ± 0.21. A significant difference in kidney weight was seen between the saline- and HGF-injected animals (P < 0.01), thus demonstrating HGF's role in preventing renal hypertrophy. We next examined mesangial ECM deposition (another feature of diabetic glomerulopathy): in the saline group, sclerotic changes (i.e., overdeposition of type IV collagen) were evident in some glomeruli (Fig. 4B, left), occasionally with an increase in the size of glomerular tufts. Of note, HGF repressed collagen deposition in mesangial spaces during the 4 wk, with a significantly lowered score (Fig. 4B, right). HGF also suppressed glomerular deposition of type I collagen, fibronectin, and
-SMA (Fig. 4C), which are all involved in initiation of glomerular sclerogenesis.
|
Glomerular TGF-
expression and its modulation by HGF in diabetic mice. As TGF-
is critical to elicit glomerular sclerosis in diabetic renal diseases (13, 33, 34), we asked whether HGF would alter glomerular TGF-
expression under diabetic conditions. Immunohistochemical examinations demonstrated TGF-
-positive areas in sclerotic regions in the saline group, while this pathological event was attenuated after rh-HGF treatment (Fig. 5A). The glomerular TGF-
score was significantly lower in the rh-HGF group than in the saline group (2.69 ± 0.41 vs. 1.27 ± 0.33, P < 0.01). To gain support for the histological data, renal TGF-
1 levels were measured using an ELISA system (23): in diabetic mice, renal TGF-
1 levels increased 1.8-fold over the pretreated diabetic controls (6W; Fig. 5B). Consistent with the histochemical findings, HGF suppressed the increase in renal TGF-
1 concentrations in this animal model (P < 0.01).
|
Inhibitory effect of HGF on TGF-
1 production,
-SMA, and type IV collagen accumulation in cultured mesangial cells. Because mesangial cells are a major source of TGF-
1 in diabetic nephropathy (43, 48), we focused on a role for HGF in the TGF-
1-producing cells. Under a high-glucose condition (with 33 mM glucose), supernatant TGF-
1 levels increased to a 1.8-fold level over the physiological control (i.e., 5.5 mM glucose; Fig. 6A), being similar to documented data (36, 48). In this model, HGF dose dependently repressed sugar-induced increases in TGF-
1 levels, noted in the diabetic (33 mM glucose) but not nondiabetic (5.5 mM) cultures. Especially, there was a significant difference in TGF-
1 levels between 33 mM glucose alone vs. the high glucose plus rh-HGF (30 ng/ml; P < 0.01). Furthermore, high glucose (33 mM) increased the TGF-
1 mRNA expression levels, whereas HGF repressed the upregulation of TGF-
1 mRNA (Fig. 6B). We next investigated the effect of HGF on myofibroblast formation and ECM accumulation, based on
-SMA and type IV collagen expression, respectively. In the culture with high glucose, mesangial
-SMA and type IV collagen were detected as bands in the blot analysis (Fig. 6C). Supplementing the culture with HGF (30 ng/ml) led to suppressions of the
-SMA and collagen, evidence of the counteracting effects of HGF on TGF-
1-mediated sclerogenesis.
|
Prevention of albuminuria-related interstitial changes by HGF in diabetic kidneys. Glomerular injuries elicit urinary albumin excretion, while in turn albuminuria triggers peritubular inflammation and fibrogenesis, possibly via enhanced MCP-1 production (9, 35). In our model, urinary albumin levels gradually increased in the saline-injected group (Fig. 7A). By contrast, urinary albumin levels declined in HGF-treated mice, especially at 10 wk after STZ injections (P < 0.01). In the HGF-treated mice, renal MCP-1 levels were reduced to 62% of the control group, with a significant difference (P < 0.05; Fig. 7B). In the control group, MCP-1 was widely noted in the proximal tubules, whereas tubular MCP-1 expression was limited in the HGF-treated mice (Fig. 7C, left). Concomitantly with the reduced MCP-1, the number of interstitial macrophage (judged as Mac-1-positive cells) was reduced in diabetic kidneys treated with HGF (Fig. 7C). Furthermore, interstitial
-SMA and type IV collagen accumulations were also attenuated in mice given HGF supplements (Fig. 7C). Consistently, there were significant differences in interstitial Mac-1,
-SMA, and type IV collagen scores between saline- and HGF-treated groups (Fig. 7D).
|
| DISCUSSION |
|---|
|
|
|---|
1 production, and minimizes glomerular (and possibly peritubular) fibrosis, all contributing to prevention of renal dysfunction in diabetic nephropathy. This is the first report identifying a natural ligand to protect kidneys from pathological conditions related to diabetes.
Hyperglycemia and renal hypertrophy are key determinants of diabetic complications, including nephropathy in insulin-dependent (40) and -nondependent diabetes mellitus (41). It is of interest to note that glomerular HGF levels show an inverse correlation with the severity of tuft hypertrophy in the mouse model we used. Of note, anti-HGF IgG treatment led to a significant increase in the size of glomerular tufts. Inversely, supplements of rh-HGF almost completely not only arrested renal growth but also minimized glomerular tuft expansions, thereby revealing a role of mesangial HGF in inhibiting renal hypertrophy. A causal involvement of TGF-
1 in diabetic renal hypertrophy was demonstrated given that application of TGF-
antibodies attenuated the effect in experimental animals (33, 47). Therefore, we focused on renal TGF-
1 expression to explain anti-hypertophic effects of HGF. In our culture system, we found that high-glucose-stimulated TGF-
1 induction was abolished by HGF. This effect was reproduced in vivo: rh-HGF therapy for diabetic mice led to a reduction of the TGF-
-positive mesangial areas. Thus one possible explanation is that HGF may inhibit tuft hypertrophy via suppression of TGF-
1 production. Another possibility is that HGF may reduce glomerular hyperfiltration [linked with glomerular hypertrophy (7, 29)], because urinary volume in the HGF-treated mice was reduced to 70% over control levels (data not shown).
In addition to tuft hypertrophy, glomerular sclerosis is a risk factor for renal dysfunction in subjects with diabetic nephropathy (5, 31). Overexcessive ECM in mesangial spaces can cause vascular capillary collapse (5, 29), leading to albuminuria and interstitial injuries are accelerated. To produce ECM proteins, mesangial cells acquire myofibroblast-like phenotypes (including
-SMA fibers) (10) and TGF-
1 plays a central role in this process (6). After the onset of hyperglycemia, glomerular HGF levels are inversely proportional to the degree of mesangial sclerosis. Moreover, rh-HGF led to decreased TGF-
1 levels and attenuated sclerosis in the mice, suggesting that endogenous HGF is preventive for the progression of diabetic glomerulopathy in the advanced stage. Our in vitro results suggest that antisclerogenic effects (such as attenuated myofibroblastosis and reduced ECM deposition) by HGF are, at least in part, directed toward mesangial cells.
We discuss other mechanisms of HGF-mediated outcomes in diabetic glomerulopathy. A loss of glomerular endothelial cells or podocytes may be critical for glomerular sclerosis to be manifest (17, 37). HGF is protective to endothelial cells and podocytes (11, 26), even under diabetic states. Thus protection of glomerular resident cells by HGF may involve attenuated glomerular injuries. We reported that HGF arrests mesangial overproliferation (4), an initial event that provokes sclerosis. HGF represses upregulation of connective tissue growth factor (15), a key cytokine needed for fibrosis to develop (32). Given that HGF induces ECM-degradating enzymes (such as matrix metalloproteinase-1/-9) (20, 30), HGF-induced matrix metalloproteinases likely contribute to attenuated fibrosis. HGF can decrease blood pressure in vivo (46), and this may be linked with suppressions of tuft hypertrophy by HGF. Such multifunctional activities by HGF would lead to attenuated glomerular injuries.
Clinical studies imply that tubulointerstitial lesions show the best correlation with renal failure in diabetic nephropathy (5, 12). Urinary albumin provokes MCP-1 upregulation, and then peritubular inflammation and fibrosis may develop (9, 35). Notably, HGF was shown to repress albuminuria in our model. Renal MCP-1 levels were reduced by HGF, such being the opposite of findings in vitro (42). Concomitantly, tubulointerstitial fibrogenic events (such as macrophage infiltration, myofibroblastosis, and ECM overdeposition) were suppressed in HGF-injected diabetic mice. Thus sequential mechanisms for attenuated renal dysfunction include 1) HGF protects from glomerular injuries in diabetic stress; 2) albumin excretion and in turn tubular MCP-1 expression are controlled; and 3) overall, onset of peritubular inflammation and fibrogenesis is avoided. On the other hand, we also consider direct effects of HGF toward tubular lesions, as reported (2325).
Recently, Laping et al. (18) reported that a strain of mice (db/db) developed diabetic kidney disease under an HGF supplement protocol. This finding conflicts with our observations. In their study, however, very low doses of HGF (160 ng·kg-1·day-1 = "1/3,000" of ours, sc) were used. Because the half-time of HGF in the circulation is within 10 min, at least several hundred micrograms of HGF are needed to produce and sustain physiological HGF levels (our unpublished data), especially in cases of systemic (subcutaneous or intramuscular) administrations. Of note, giving physiological doses of HGF (i.e., 600 µg·kg-1·day-1 sc) to db/db mice led to a trend of improvement of renal functions (Kajihara M and Kuroda A, unpublished data). Although the way in which the very low dose of HGF has different effects awaits results from additional studies, the use of HGF at physiological doses seems to be safe and effective.
Finally, it is important to discuss a cause-and-result relationship between reciprocal expressions of HGF and TGF-
1 in the diabetic kidney. HGF represses TGF-
1 production, as shown herein and reported elsewhere (38, 39), and vice versa (22, 26). Thus a potential mechanism for regulating the balance involves 1) in an early stage of diabetic disease, HGF expression is enhanced to block TGF-
1 production after which a shift to renal sclerosis is prevented; and 2) in turn, excessive TGF-
1 in a later phase leads to successful fibrogenesis via inhibiting HGF production. Previous evidence implies that HGF is a tubulotrophic factor (21), and HGF is now recognized as glomerulotrophic. The above taken together, we hypothesize that there may be reciprocal mechanisms of TGF-
1 and HGF to regulate progression of glomerular as well as tubulointerstitial fibrosis in chronic renal organ diseases and that supplement of HGF is considered as a molecular pathogenesis-based strategy to limit renal fibrosis (Fig. 8). Alternatively, novel specific approaches with enhancing or sustaining endogenous HGF production can be developed to limit TGF-
1 overexpression and chronic renal failure.
|
| ACKNOWLEDGMENTS |
|---|
GRANTS
This study was supported by grants from the Ministry of Education, Science, Technology, Sports and Culture of Japan (14207005 and 12215082 to T. Nakamura and 14570187 to S. Mizuno) and by the Mochida Memorial Foundation for Medical and Pharmaceutical Research (to S. Mizuno).
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
in tissue fibrosis. N Engl J Med 331: 1286-1292, 1994.
: a crucial component of the pathogenesis of diabetic nephropathy. Trans Am Clin Climatol Assoc 112: 27-32, 2001.[Medline]
1, through attenuation of connective tissue growth factor induction, and prevents renal fibrogenesis in 5/6-nephrectomized mice. FASEB J 17: 268-270, 2003.
1 and glucocorticoids. J Biol Chem 267: 24917-24920, 1992.
1 in renal fibrosis in mice. Kidney Int 57: 937-948, 2000.[Web of Science][Medline]
by anti-TGF-
antibody attenuates kidney hypertrophy and the enhanced extracellular matrix gene expression in STZ-induced diabetic mice. Diabetes 45: 522-530, 1996.[Abstract]
is elevated in human and experimental diabetic nephropathy. Proc Natl Acad Sci USA 90: 1814-1818, 1993.
antibody in db/db diabetic mice. Proc Natl Acad Sci USA 97: 8015-8020, 2000.
. J Clin Invest 93: 536-542, 1994.[Web of Science][Medline]This article has been cited by other articles:
![]() |
S. Kroening, S. Solomovitch, M. Sachs, B. Wullich, and M. Goppelt-Struebe Regulation of connective tissue growth factor (CTGF) by hepatocyte growth factor in human tubular epithelial cells Nephrol. Dial. Transplant., March 1, 2009; 24(3): 755 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gozdzikiewicz, J. Borawski, and M. Mysliwiec Pleiotropic Effects of Heparin and Heparinoids in Peritoneal Dialysis Clinical and Applied Thrombosis/Hemostasis, February 1, 2009; 15(1): 92 - 97. [Abstract] [PDF] |
||||
![]() |
R. Tan, X. Zhang, J. Yang, Y. Li, and Y. Liu Molecular Basis for the Cell Type Specific Induction of SnoN Expression by Hepatocyte Growth Factor J. Am. Soc. Nephrol., August 1, 2007; 18(8): 2340 - 2349. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gong, A. Rifai, and L. D. Dworkin Anti-Inflammatory Effect of Hepatocyte Growth Factor in Chronic Kidney Disease: Targeting the Inflamed Vascular Endothelium J. Am. Soc. Nephrol., September 1, 2006; 17(9): 2464 - 2473. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Rampino, M. Gregorini, G. Camussi, P. G. Conaldi, G. Soccio, M. Maggio, A. Bottelli, and A. Dal Canton Hepatocyte growth factor and its receptor Met are induced in crescentic glomerulonephritis Nephrol. Dial. Transplant., June 1, 2005; 20(6): 1066 - 1074. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shigemura, Y. Sawa, S. Mizuno, M. Ono, M. Ohta, T. Nakamura, Y. Kaneda, and H. Matsuda Amelioration of Pulmonary Emphysema by In Vivo Gene Transfection With Hepatocyte Growth Factor in Rats Circulation, March 22, 2005; 111(11): 1407 - 1414. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Biswas, A. Roy, R. Gong, A. Yango, E. Tolbert, J. Centracchio, and L. D. Dworkin Hepatocyte growth factor induces an endothelin-mediated decline in glomerular filtration rate Am J Physiol Renal Physiol, January 1, 2005; 288(1): F8 - F15. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yang, C. Dai, and Y. Liu A Novel Mechanism by which Hepatocyte Growth Factor Blocks Tubular Epithelial to Mesenchymal Transition J. Am. Soc. Nephrol., January 1, 2005; 16(1): 68 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gong, A. Rifai, E. M. Tolbert, P. Biswas, J. N. Centracchio, and L. D. Dworkin Hepatocyte Growth Factor Ameliorates Renal Interstitial Inflammation in Rat Remnant Kidney by Modulating Tubular Expression of Macrophage Chemoattractant Protein-1 and RANTES J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2868 - 2881. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dai, J. Yang, S. Bastacky, J. Xia, Y. Li, and Y. Liu Intravenous Administration of Hepatocyte Growth Factor Gene Ameliorates Diabetic Nephropathy in Mice J. Am. Soc. Nephrol., October 1, 2004; 15(10): 2637 - 2647. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu Hepatocyte growth factor in kidney fibrosis: therapeutic potential and mechanisms of action Am J Physiol Renal Physiol, July 1, 2004; 287(1): F7 - F16. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dai and Y. Liu Hepatocyte Growth Factor Antagonizes the Profibrotic Action of TGF-{beta}1 in Mesangial Cells by Stabilizing Smad Transcriptional Corepressor TGIF J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1402 - 1412. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |