AJP - Renal Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 286: F134-F143, 2004. First published September 30, 2003; doi:10.1152/ajprenal.00199.2003
0363-6127/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/1/F134    most recent
00199.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mizuno, S.
Right arrow Articles by Nakamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mizuno, S.
Right arrow Articles by Nakamura, T.

Suppressions of chronic glomerular injuries and TGF-{beta}1 production by HGF in attenuation of murine diabetic nephropathy

Shinya Mizuno and Toshikazu Nakamura

Division of Molecular Regenerative Medicine, Department of Molecular Regenerative Medicine, Osaka University Graduate School of Medicine, Yamadaoka 2-2-B7, Japan

Submitted 27 May 2003 ; accepted in final form 16 September 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Diabetic nephropathy is now the leading cause of end-stage renal diseases, and glomerular sclerotic injury is an initial event that provokes renal dysfunction during processes of diabetes-linked kidney disease. Growing evidence shows that transforming growth factor-{beta}1 (TGF-{beta}1) plays a key role in this process, especially in eliciting hypertrophy and matrix overaccumulation. Thus it is important to find a ligand system to antagonize the TGF-{beta}1-mediated pathogenesis under high-glucose conditions. Herein, we provide evidence that hepatocyte growth factor (HGF) targets mesangial cells, suppresses TGF-{beta}1 production, and minimizes glomerular sclerotic changes, using streptozotocin-induced diabetic mice. In our murine model, glomerular sclerogenesis (such as tuft area expansion and collagen deposition) progressed between 6 and 10 wk after the induction of hyperglycemia, during a natural course of diabetic disease. Glomerular HGF expression levels in the diabetic kidney transiently increased but then declined below a basal level, with manifestation of glomerular sclerogenesis. When anti-HGF IgG was injected into mice for 2 wk (i.e., from weeks 4 to 6 after onset of hyperglycemia), these glomerular changes were significantly aggravated. When recombinant HGF was injected into the mice for 4 wk (i.e., between 6 and 10 wk following streptozotocin treatment), the progression of glomerular hypertrophy and sclerosis was almost completely inhibited, even though glucose levels remained unchanged (>500 mg/dl). Even more important, HGF repressed TGF-{beta}1 production in glomerular mesangial cells even under hyperglycemic conditions both in vitro and in vivo. Consequently, not only albuminuria but also tubulointerstitial fibrogenesis were attenuated by HGF. Overall, HGF therapy inhibited the onset of renal dysfunction in the diabetic mice. On the basis of these findings, we wish to emphasize that HGF plays physiological and therapeutic roles in blocking renal fibrogenesis during a course of diabetic nephropathy.

chronic renal failure; glomerular sclerosis; hepatocyte growth factor; transforming growth factor-{beta}


IN CHRONIC RENAL diseases, renal fibrosis (such as glomerulosclerosis and interstitial fibrosis) occurs to replace the loss of parenchymal nephrons (29), but this pathological condition eventually leads to intractable renal dysfunction and hemodialysis becomes necessary. Among chronic renal disorders, diabetic nephropathy is now worldwide one of the most common etiologies of hemodialysis (1, 19); for example, the annual cost is $900 billion in Japan, and diabetics reaching dialysis have a twofold excess mortality risk. Given that diabetic nephropathy is a major contributor to dialysis-related financial and medical problems, it is important to elucidate a mechanism(s) as to how diabetic nephropathy progresses (or is delayed) under high-glucose conditions. The initial attention of nephrologists was directed to glomerular components, as mesangial injuries are considered to be the first step in the manifestation of diabetic nephropathy (5, 31).

Several lines of evidence revealed critical roles of transforming growth factor-{beta}1 (TGF-{beta}1) during the progression of glomerular lesions in diabetic nephropathy: 1) TGF-{beta}1 expression is upregulated by glucose and enhances extracellular matrix (ECM) accumulation in mesangial cells (36, 48); 2) TGF-{beta}1 expression levels are markedly increased in mesangial areas in animals or in patients after the onset of diabetic nephropathy (43); and 3) importantly, neutralization of TGF-{beta}1 actions with a specific antibody suppresses glomerular hypertrophy as well as sclerosis in vivo (33, 47). Thus TGF-{beta}1 is now considered to be a key molecule that aggravates diabetic nephropathy (13, 34). To prevent TGF-{beta}1-mediated fibrogenesis under diabetic conditions, there may possibly be a self-protection mechanism in vivo, but such a defense system is not well understood.

Hepatocyte growth factor (HGF) was originally identified and cloned as a potent mitogen for mature hepatocytes (27, 28). HGF is a potent mitogen and morphogen for renal tubular epithelial cells (3, 21). Actually, HGF accelerates renal tubular repair after the onset of acute renal failure, with rapid recovery of tubular morphology and functions (14, 16). Of note, HGF has therapeutic effects on chronic renal failure linked with enhanced tubular regeneration, and tubulointerstitial fibrosis was inhibited (15, 2325, 44, 45) even when renal function was impaired. These studies focused on HGF's roles mainly related to tubular and tubulointerstitial lesions. We recently obtained evidence that HGF works on mesangial cells and then inhibits their proliferation in a rat model of acute glomerulonephritis (4). Nevertheless, it is still unclear whether HGF directly inhibits chronic mesangial injuries, an important cascade leading to renal dysfunction (29).

To elucidate a role of HGF during the onset of glomerular injuries, we focused on diabetic nephropathy, because glomerular sclerogenesis (including hypertrophy and matrix overdeposition) precedes the onset of tubulointerstitial fibrosis, and this time lag seems advantageous to determine whether HGF's roles regarding glomeruli are direct or indirect. In this study when we used streptozotocin (STZ)-injected mice as a model of diabetic nephropathy, we found that HGF prevents chronic glomerular lesions, which may determine predisposition to albuminuria, tubulointerstitial fibrosis, and renal dysfunction. We describe herein physiological and therapeutic effects of HGF to suppress TGF-{beta}1-induced pathological states in hyperglycemia-linked nephropathy.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals. Eight-week-old female C57B/6Cr Slc mice (18–20 g; SLC, Hamamatsu, Japan) were used. We attempted to induce hyperglycemia in these mice, based on a reported method (8): after fasting these mice for 24 h, we injected STZ (Nacalai, Kyoto, Japan) in a dose of 120 mg/kg ip for the initial 2 days and in a dose of 80 mg/kg ip for the subsequent 2 days. About 70% of the mice manifested severe hyperglycemia (plasma glucose level >500 mg/dl) within 1 wk after the last injection of STZ, and 20% of the animals died of severe dehydration. The remaining mice had mild hyperglycemia and were removed from the present experiments.

Reagents. For HGF-neutralizing treatment, anti-HGF antibody was raised by immunizing rat HGF in normal rabbits. The anti-HGF IgG cross-reacts with mouse (but not human) HGF and accelerates renal fibrogenesis (24, 25). A variant type of recombinant human HGF (rh-HGF) was produced by Chinese hamster ovary cells, a cell line transfected with human HGF cDNA with a deletion of 5 amino acid residues in the first kringle domain (1416, 2325). The HGF protein was >98% pure.

Observations on the natural course of diabetic nephropathy. Twenty STZ-injected mice were housed under specific pathogen-free conditions and were fed a standard diet (MF, Oriental yeast, Tokyo, Japan). To analyze the natural course of renal phenotypes, mice were killed at 0, 2, 6, and 10 wk after the STZ treatment (each group includes 5 mice). At necropsy, they were anesthetized with pentobarbital sodium (50 mg/kg ip), and plasma and renal tissues were collected for biochemical or pathological analyses, as described below.

Anti-HGF antibody treatment. For the anti-HGF IgG treatment, another 12 STZ-injected mice were generated. Four weeks after the STZ injections, they were divided into two groups (based on clinical data as described below) and intraperitoneally injected with the rabbit anti-rat HGF IgG (250 µg/mouse; n = 6) or normal rabbit IgG (250 µg/mouse; n = 6) on alternate days over a period of 12 days. These mice were killed on day 14 after start of this treatment.

Administration of exogenous HGF. To evaluate the effect of rh-HGF on progression of diabetic nephropathy, 12 diabetic mice were prepared. These mice were found to be in an early stage of renal insufficiency when their blood urea nitrogen (BUN) levels reached near 40 mg/dl (e.g., 6 wk after the STZ treatments), and they were then divided into an HGF-injected group and a saline-injected group: in the rh-HGF-injected group (n = 6), mice were given 300 µg·kg-1·12 h-1 HGF sc daily for 28 days, whereas control mice (n = 6) received subcutaneous injections of an identical volume of saline.

Blood and tissue chemistry. Plasma glucose levels were determined using a kit (Glucose B test, Wako, Osaka, Japan). BUN levels were determined with the urease indophenol method, using a kit (Urea B test, Wako) (23). The plasma creatinine level was measured using a kit (Creatinine test, Wako) (23). In an experiment related to rh-HGF therapy, plasma was obtained from postorbital veins on weeks 6, 8.5, and 10 and subjected to the laboratory examinations. The urinary albumin levels were determined, using a kit (A/G B test, Wako) (23, 24). Renal tissue extracts were prepared, as described (2325). Renal HGF levels were determined in ELISA, using a kit (HGF EIA, Institute of Immunology, Tokyo, Japan). Renal TGF-{beta}1 levels were determined, using an ELISA kit (Quantikine TGF-{beta}1, R & D) (2325). Renal monocyte chemoattractant protein-1 (MCP-1) levels were determined using a sandwich ELISA system (Amersham-Pharmacia, Little Chalfont, UK).

Histopathology. The left kidneys were excised and fixed in cold 70% ethanol. The transversally trimmed kidney tissues were submitted to a routine process for paraffin embedding. The sections were cut into 4-µm slices, dewaxed, and then stained with hematoxylin and eosin. The remaining sections were subjected to immunohistochemistry: goat IgG against mouse type IV collagen (1:400; Chemicon, Temecula, CA) was used for the primary reactions to determine the extent of glomerular sclerosis. To visualize the primary antibody, an avidin-biotin coupling (ABC) immunoperoxidase technique was used together with a commercial kit (Vectstain Elite ABC, Vector Labs, Burlingame, CA) (2325). To detect the expression of growth factors, rabbit IgG against rat HGF (1:1,000) [prepared in our laboratory (24, 25)] and rabbit IgG against porcine and human TGF-{beta}1,2,5 (pan-TGF-{beta}) (1:100) were used for the primary reactions, followed by the ABC technique mentioned above. To support the fibrogenic events in diabetic kidneys, other parameters such as fibronectin, type I collagen, {alpha}-smooth muscle actin ({alpha}-SMA; a marker for myofibroblasts), and Mac-1 (a marker for macrophages) were detected immunohistologically as described (2325). To detect a chemokine involved in macrophage influx, anti-mouse MCP-1 hamster IgG (BD Biosiences, San Jose, CA) was used, followed by the ABC technique as mentioned.

Renal morphometry. Glomerular sclerosis (characterized by mesansial expansion) was graded according to the extent of mesangial involvement on a scale of 0 to 4: 0, normal; 0.5, small focal area of the tubular injury; 1, involvement of over 10% of the cortex; 2, involvement up to 25% of the cortex; 3, involvement up to 50 to 75% of the cortex; and 4, extensive damage involving more than 75% of the glomeruli (23). To evaluate the glomerular tuft hypertrophy, glomerular size was determined by measuring the glomerular area on the same glomeruli, by means of a video microscope (VM-30, Olympus, Tokyo, Japan). The glomerular scores of collagen (IV/I), TGF-{beta}1, {alpha}-SMA, and fibronectins were determined as described (23). The overall means of these parameters were calculated based on individual values (n = 6), which were determined in at least 30 glomeruli per mouse. Finally, the degree of tubulointerstitial lesions was evaluated based on interstitial Mac-1, {alpha}-SMA, and type IV collagen scores (24, 25). These semiquantitative analyses were all made in a blinded fashion.

In vitro study. To evaluate the direct effect of HGF on TGF-{beta}1 production, we prepared an in vitro model of diabetic nephropathy, based on reported data (36). We used human normal mesangial cells (HNMC; Sanko, Chiba, Japan) to induce fibrogenic phenotypes: the culture was passaged in dishes supplemented with 10% fetal bovine serum containing MCDB-131 (GIBCO, Grand Island, NY). These cells were adjusted at a density of 3 x 104 cells/cm2 in a 48-well plate at 37°C overnight and then the medium was replaced with fresh serum-free MCDB-131, where D-glucose was pulsed at concentrations of 5.5 mM (=100 mg/dl, i.e., normal) or 33 mM glucose (=600 mg/dl, i.e., diabetic). After the medium change, rh-HGF was added to the culture systems in various doses (0–30 ng/ml), and TGF-{beta}1 levels in the supernatants were determined, as mentioned. To evaluate the fibrogenesis on mesangial cells, type IV collagen and {alpha}-SMA expressions were evaluated in an immunoblot analysis for lysates of cultured cells, as described (4). We extracted mRNA from HNMC using an acid guanidium thiocyanate-phenol chlorform method. To determine changes in TGF-{beta}1 at transcription levels, mRNA was reversed to cDNA and subjected to amplification with primers specific to TGF-{beta}1 cDNA (sense vs. antisense primer): CCGCAAGGACCTCGGCTGGAA vs. GATCATGTTGGACAGCTGCTC. As an internal control, GAPDH was used (GGATTTGGCCGTATTGG vs. GGATTTGGCCGTATTGG).

Statistical analyses. All data are expressed as means ± SD. An unpaired two-tailed t-test was used to compare the means, and a value of P < 0.05 was considered to have statistical significance. Linear regression analysis was employed to evaluate the significance of the relationship between variables, using statistical computer software (Start-View J 5.0, SAS Institute Tokyo, Japan) (24).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Changes in renal HGF levels during progression of diabetic nephropathy in mice. To determine the role of HGF during the pathogenesis of diabetic nephropathy, we first prepared an animal model in which renal dysfunction progresses under high-glucose conditions. In STZ-injected mice, blood glucose levels rapidly increased within 7 days after serial administrations of STZ to a threefold level over the control (Fig. 1A, left), concomitantly with persistent polyuria and glycouria. In the diabetic mice, BUN levels increased between 6 and 10 wk after the onset of hyperglycemia in association with persistent hyperglycemia (glucose levels >500 mg/dl; Fig. 1A, middle). Similarly, the mice showed significant increases in plasma creatinine levels during the experimental periods (0W: 0.36 ± 0.05 mg/dl; 6W: 0.52 ± 0.08 mg/dl; and 10W: 0.93 ± 0.12 mg/dl). Renal morphometry revealed that the glomerular sclerosis score increased, in association with elevated parameters of renal functions (Fig. 1A, right). In this model, renal HGF levels increased for up to 2 wk after the STZ injection to a twofold level over the pretreatment control (Fig. 1B, line graph). However, HGF levels reverted to near the basal level at 6 wk after the onset of hyperglycemia with reciprocal increases in BUN levels. In renal histochemistry, immunoreactive signals for HGF were evident in mesangial regions of the glomeruli in the mice especially at 2 wk after the initiation of diabetes. The glomerular HGF expression became faint following 6 wk (6W) of the STZ treatments (Fig. 1B). In this time point (i.e., 6W), interstitial lesions were very mild but became evident at 10 wk after the STZ challenge, with the increase in peritubular HGF expression (not shown).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1. Time course of changes in renal phenotypes in mice after the onset of experimental diabetes. A: changes in plasma glucose, blood urea nitrogen (BUN) levels, and glomerular sclerosis scores in diabetic mice which had been given serial injections of streptozotocin (STZ), as described in MATERIALS AND METHODS. Data are means ± SD (n = 5). B: alterations of hepatocyte growth factor (HGF) levels and localization in nondiabetic and diabetic mouse kidneys. Left: renal HGF levels in the mice, as measured using an ELISA system. Data are means ± SD (n = 5). Statistical analysis: *P < 0.05 compared with basal level [0 wk (0W)] and #P < 0.05 and ##P < 0.01 compared with an HGF level (2W). Right: immunoperoxidase stainings for intrinsic HGF in prediabetic and diabetic kidneys (x160). HGF-positive cells were noted in mesangial (and peritubular) spaces in the diabetic kidneys, especially 2 wk after STZ injections (arrowheads).

 

Involvement of a decrease in HGF-positive glomerular cells in tuft sclerotic injuries. Measurement of endogenous HGF in whole renal tissues included glomerular and peritubular HGF and did not accurately reflect glomerular HGF changes. Thus we counted the number of HGF-positive cells in glomeruli, as described (4). The HGF-positive glomerular cells transiently increased 2 wk after STZ injections, followed by significant losses of intrinsic HGF, especially noted at 10 wk following the induction of diabetes (0W: 4.46 ± 0.57 vs. 10W: 2.15 ± 0.31 cells per glomerulus, P < 0.01; Fig. 2A, left). The degree of glomerular HGF expression negatively correlated with the glomerular collagen IV score during the progression of diabetic nephropathy in our mouse model (Fig. 2A, middle). Furthermore, there was an inverse correlation between the HGF-positive glomerular cell number and tuft area sizes (Fig. 2A, right). To elucidate the significance of the decreased HGF, we injected anti-rodent HGF-neutralizing IgG into the diabetic mice from 4 wk after STZ injections for 2 wk: in the HGF-neutralized mice, glomerular sclerogenic findings (such as type IV collagen deposition and tuft size expansion) were evident compared with those in the normal IgG-treated group (Fig. 2B). The glomerular type IV collagen score was 1.8-fold higher in the HGF-neutralized mice than in placebo-treated mice (1.71 ± 0.20 vs. 0.96 ± 0.17, P < 0.01). Furthermore, the size of the glomerular area in the mice significantly increased after the anti-HGF IgG treatment. Thus we hypothesized that a change in glomerular HGF expression may affect the initial pathogenesis of diabetic nephropathy.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2. Contribution of glomerular HGF to suppress tuft hypertrophy and matrix deposition in diabetic mice. A, left: changes in glomerular HGF-positive cells in a natural course of diabetic nephropathy in STZ-injected mice. Data are means ± SD (n = 5). Statistical analysis: *P < 0.05 and **P < 0.01 compared with an initial HGF level (0W). A, middle and right: during the natural course of diabetes (0–10W), numbers of the HGF-positive glomerular cells were plotted to correlate with glomerular collagen score or tuft sizes (n = 20). B: acceleration of glomerular hypertrophy and collagen deposition in diabetic mice after anti-HGF IgG treatments. The anti-HGF IgG (250 µg·head-1·48 h-1 ip) was injected into mice from 4 wk after STZ injections for 2 wk. Left: microphotographs represent gomerular tuft findings, noted in normal IgG (used as placebo) or anti-HGF IgG groups (type IV collagen staining, x330). Right: degree of sclerogenic changes was quantified through microscopic morphometry for glomerular collagen (IV) score and tuft size (means ± SD, n = 6). Statistical analysis = * P < 0.05 and ** P < 0.01 compared with a normal IgG group.

 

Effect of exogenous HGF administrations on diabetes-related conditions in mice. To gain support for our hypothesis, supplement therapy with rh-HGF was given to the diabetic mice during a 4-wk period (from weeks 6 to 10 after STZ injections), because: 1) intrinsic HGF rapidly declined within this time and 2) in the earlier phase (i.e., 2W), the mice showed hydration and did not stably manifest renal dysfunction. Throughout the administration periods, rh-HGF did not alter the natural course of blood glucose levels, noted in diabetic mice treated with saline (Fig. 3A). We next checked BUN and creatinine levels in mice to estimate renal functions: in salineinjected mice, BUN levels gradually increased, up to the end-point (i.e., 10W) of this study. Of note, HGF suppressed increases in BUN levels at 8.5 and 10 wk after the onset of diabetic conditions (Fig. 3B). Furthermore, HGF also inhibited the elevation of plasma creatinine levels at the time of death, with a significant difference (Fig. 3C), thus indicating that HGF functioned to inhibit progression of renal dysfunction, even though blood glucose levels were still higher.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. Alterations of hyperglycemia and renal dysfunctions in mice after HGF supplement therapy. After 6 wk of STZ injections, mice were treated twice daily with saline or recombinant human (rh)-HGF (600 µg·kg-1·day-1 sc) for a 4-wk period. During the administration periods, plasma was collected from postorbital veins of diabetic mice, and glucose (A), BUN (B), and creatinine (C) levels were determined in saline-injected mice and rh-HGF-treated mice, respectively. Data are means ± SD (n = 6). Statistical analysis: n.s., not significant; *P < 0.05 and **P < 0.01 compared with the same time point of the saline group.

 

Attenuations of glomerular changes in diabetic mice by HGF therapy. To explain the therapeutic effects by HGF on chronic renal failure, we first focused on glomerular lesions, an initial hallmark of diabetic nephropathy (5, 31). In saline-injected diabetic mice, some glomeruli became hypertrophic, with a hyalynosis-like lobular nodule (Fig. 4A, left). In contrast, glomerular hypertrophy decreased in HGF-treated diabetic mice, with almost normal capillary morphology (Fig. 4A, middle). In the HGF-treated animals, glomerular tuft size was reduced to the level seen in the pretreatment group (e.g., 6W; Fig. 4A, right). Ratios of left kidney weight to heart weight in diabetic mice are pretreatment (6W) = 1.98 ± 0.24, saline (10W) = 2.52 ± 0.57, and rh-HGF (10W) = 1.91 ± 0.21. A significant difference in kidney weight was seen between the saline- and HGF-injected animals (P < 0.01), thus demonstrating HGF's role in preventing renal hypertrophy. We next examined mesangial ECM deposition (another feature of diabetic glomerulopathy): in the saline group, sclerotic changes (i.e., overdeposition of type IV collagen) were evident in some glomeruli (Fig. 4B, left), occasionally with an increase in the size of glomerular tufts. Of note, HGF repressed collagen deposition in mesangial spaces during the 4 wk, with a significantly lowered score (Fig. 4B, right). HGF also suppressed glomerular deposition of type I collagen, fibronectin, and {alpha}-SMA (Fig. 4C), which are all involved in initiation of glomerular sclerogenesis.



View larger version (104K):
[in this window]
[in a new window]
 
Fig. 4. Prevention of glomerular hypertrophy and sclerosis in diabetic mice by rh-HGF supplement therapy. The diabetic mice were killed 4 wk after the initiation of saline or rh-HGF administration. Renal tissues were removed and submitted to histological examinations, as stated in MATERIALS AND METHODS. A: inhibitory effect of rh-HGF injections on glomerular hypertrophy, as determined by size of tuft areas. A, left: representative microphotographs of glomerular findings, noted in saline- and HGF-treated groups (hematoxylin and eosin staining, x120). A nodule with hyalinosis was noted in an expanded tuft (arrowhead). A, right: comparisons of glomerular area sizes among pretreated (6W), saline-treated vs. rh-HGF-treated diabetic groups (10W). B: suppression of type IV collagen depositions in glomeruli after the HGF treatments. B, left: immunohistochemical findings for mesangial sclerosis in saline and HGF groups (type IV collagen staining, x220). B, right: degree of the collagen deposition was quantified by determining type IV collagen scores. C: comparisons of fibrogenic events between saline and HGF groups, based on glomerular type I collagen, fibronectin (FN), and {alpha}-smooth muscle actin (SMA) scores. Data are means ± SD (n = 6). Statistical analysis: *P < 0.05 and **P < 0.01 compared with the pretreatment group (6W) and ##P < 0.01 compared with the saline group (10W).

 

Glomerular TGF-{beta} expression and its modulation by HGF in diabetic mice. As TGF-{beta} is critical to elicit glomerular sclerosis in diabetic renal diseases (13, 33, 34), we asked whether HGF would alter glomerular TGF-{beta} expression under diabetic conditions. Immunohistochemical examinations demonstrated TGF-{beta}-positive areas in sclerotic regions in the saline group, while this pathological event was attenuated after rh-HGF treatment (Fig. 5A). The glomerular TGF-{beta} score was significantly lower in the rh-HGF group than in the saline group (2.69 ± 0.41 vs. 1.27 ± 0.33, P < 0.01). To gain support for the histological data, renal TGF-{beta}1 levels were measured using an ELISA system (23): in diabetic mice, renal TGF-{beta}1 levels increased 1.8-fold over the pretreated diabetic controls (6W; Fig. 5B). Consistent with the histochemical findings, HGF suppressed the increase in renal TGF-{beta}1 concentrations in this animal model (P < 0.01).



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 5. Suppressive effect of rh-HGF administrations on glomerular transforming growth factor (TGF)-{beta} expression in diabetic mice. A: typical findings of TGF-{beta}-immunoreactive stainings in glomeruli of saline- and HGF-treated diabetic mice (x580). TGF-{beta}-positive areas were extensive in the control mice but were reduced in HGF-treated mice. B: renal TGF-{beta}1 levels in the pretreatment group (6W) or those in saline- or HGF-treated groups (10W). TGF-{beta}1 protein levels were measured in renal tissue extractions, using an ELISA system. Data are means ± SD (n = 6). Statistical analysis: **P < 0.01 compared with the pretreatment group (6W) and ##P < 0.01 compared with the saline group (10W).

 

Inhibitory effect of HGF on TGF-{beta}1 production, {alpha}-SMA, and type IV collagen accumulation in cultured mesangial cells. Because mesangial cells are a major source of TGF-{beta}1 in diabetic nephropathy (43, 48), we focused on a role for HGF in the TGF-{beta}1-producing cells. Under a high-glucose condition (with 33 mM glucose), supernatant TGF-{beta}1 levels increased to a 1.8-fold level over the physiological control (i.e., 5.5 mM glucose; Fig. 6A), being similar to documented data (36, 48). In this model, HGF dose dependently repressed sugar-induced increases in TGF-{beta}1 levels, noted in the diabetic (33 mM glucose) but not nondiabetic (5.5 mM) cultures. Especially, there was a significant difference in TGF-{beta}1 levels between 33 mM glucose alone vs. the high glucose plus rh-HGF (30 ng/ml; P < 0.01). Furthermore, high glucose (33 mM) increased the TGF-{beta}1 mRNA expression levels, whereas HGF repressed the upregulation of TGF-{beta}1 mRNA (Fig. 6B). We next investigated the effect of HGF on myofibroblast formation and ECM accumulation, based on {alpha}-SMA and type IV collagen expression, respectively. In the culture with high glucose, mesangial {alpha}-SMA and type IV collagen were detected as bands in the blot analysis (Fig. 6C). Supplementing the culture with HGF (30 ng/ml) led to suppressions of the {alpha}-SMA and collagen, evidence of the counteracting effects of HGF on TGF-{beta}1-mediated sclerogenesis.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 6. HGF-mediated attenuation of high glucose-induced TGF-{beta}1 production, myofibroblast conversion, and extracellular matrix (ECM) deposits in cultured mesangial cells. A: effect of rh-HGF concentrations on TGF-{beta}1 levels in the culture medium of human mesangial cells. The mesangial cells were incubated for 96 h under a physiological glucose (Glc) level (5.5 mM, corresponding to 100 mg/dl) or a diabetic level (33 mM, corresponding to 600 mg/dl). Supernatant TGF-{beta}1 protein levels were determined using an ELISA kit (see MATERIALS AND METHODS). Statistical analysis: **P < 0.01 compared with a 5.5 mM group and #P < 0.05 and ##P < 0.01 compared with the TGF-{beta}1 level (at 33 mM glucose without HGF). B: RT-PCR analysis showing inhibitory effect of rh-HGF (30 ng/ml) on TGF-{beta}1 mRNA expression under physiological and diabetic conditions. GAPDH was used as an internal control. C: Western blotting for {alpha}-SMA and type IV collagen expression in the mesangial cell lysates. {beta}-Actin was used as a control. In cases of adding rh-HGF (30 ng/ml) to 33 mM glucose-exposed mesangial cells, expression of both {alpha}-SMA (a marker for myofibroblasts) and type IV collagen was attenuated compared with cases of 33 mM glucose alone.

 

Prevention of albuminuria-related interstitial changes by HGF in diabetic kidneys. Glomerular injuries elicit urinary albumin excretion, while in turn albuminuria triggers peritubular inflammation and fibrogenesis, possibly via enhanced MCP-1 production (9, 35). In our model, urinary albumin levels gradually increased in the saline-injected group (Fig. 7A). By contrast, urinary albumin levels declined in HGF-treated mice, especially at 10 wk after STZ injections (P < 0.01). In the HGF-treated mice, renal MCP-1 levels were reduced to 62% of the control group, with a significant difference (P < 0.05; Fig. 7B). In the control group, MCP-1 was widely noted in the proximal tubules, whereas tubular MCP-1 expression was limited in the HGF-treated mice (Fig. 7C, left). Concomitantly with the reduced MCP-1, the number of interstitial macrophage (judged as Mac-1-positive cells) was reduced in diabetic kidneys treated with HGF (Fig. 7C). Furthermore, interstitial {alpha}-SMA and type IV collagen accumulations were also attenuated in mice given HGF supplements (Fig. 7C). Consistently, there were significant differences in interstitial Mac-1, {alpha}-SMA, and type IV collagen scores between saline- and HGF-treated groups (Fig. 7D).



View larger version (79K):
[in this window]
[in a new window]
 
Fig. 7. Inhibitory effects of HGF supplement on albuminuria, tubulointerstitial inflammation, and fibrogenic events in diabetic mice. A: suppression of urinary albumin excretion by rh-HGF supplement therapy. Data are means ± SD (n = 6). Statistical analysis: *P < 0.05 and **P < 0.01 compared with the same time point of the saline group. B: decrease in monocyte chemoattractant protein-1 (MCP-1) levels by HGF-treatment. Renal extractions were subjected to an ELISA system to measure murine MCP-1 (see MATERIALS AND METHODS). C: immunohistochemistry for MCP-1, Mac-1, {alpha}-SMA, and col (IV). The renal tissues were fixed in 70% ethanol and subjected to a procedure for immunoperoxidase techniques (see MATERIALS AND METHODS). These inflammatory and fibrogenic events in tubulointerstitium became milder in the HGF-treated diabetic mice. D: morphometry for semiquantification of the tubular and peritubular findings. To estimate macrophage infiltration, myofibroblastosis and ECM deposition, interstitial Mac-1, {alpha}-SMA, and col (IV) staining scores were determined, respectively (means ± SD, n = 6). Statistical analysis: *P < 0.05 and **P < 0.01 compared with the saline control group.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Diabetes is now the leading cause of end-stage renal disease in many developed countries and diabetic nephropathy has emerged as a silent epidemic worldwide (1, 19). This is the typical case in the United States, where diabetic nephropathy accounts for 42% of all new cases of end-stage renal disease as of 1997 (1). The physical and monetary costs for both patients and society are enormous, and these backgrounds stimulated basic research to elucidate a mechanism(s) related to progression of diabetic nephropathy regulated at a molecular level(s) (13, 34). Using cultures and animal models of diabetes, we provided evidence that HGF directly targets mesangial cells, suppresses TGF-{beta}1 production, and minimizes glomerular (and possibly peritubular) fibrosis, all contributing to prevention of renal dysfunction in diabetic nephropathy. This is the first report identifying a natural ligand to protect kidneys from pathological conditions related to diabetes.

Hyperglycemia and renal hypertrophy are key determinants of diabetic complications, including nephropathy in insulin-dependent (40) and -nondependent diabetes mellitus (41). It is of interest to note that glomerular HGF levels show an inverse correlation with the severity of tuft hypertrophy in the mouse model we used. Of note, anti-HGF IgG treatment led to a significant increase in the size of glomerular tufts. Inversely, supplements of rh-HGF almost completely not only arrested renal growth but also minimized glomerular tuft expansions, thereby revealing a role of mesangial HGF in inhibiting renal hypertrophy. A causal involvement of TGF-{beta}1 in diabetic renal hypertrophy was demonstrated given that application of TGF-{beta} antibodies attenuated the effect in experimental animals (33, 47). Therefore, we focused on renal TGF-{beta}1 expression to explain anti-hypertophic effects of HGF. In our culture system, we found that high-glucose-stimulated TGF-{beta}1 induction was abolished by HGF. This effect was reproduced in vivo: rh-HGF therapy for diabetic mice led to a reduction of the TGF-{beta}-positive mesangial areas. Thus one possible explanation is that HGF may inhibit tuft hypertrophy via suppression of TGF-{beta}1 production. Another possibility is that HGF may reduce glomerular hyperfiltration [linked with glomerular hypertrophy (7, 29)], because urinary volume in the HGF-treated mice was reduced to 70% over control levels (data not shown).

In addition to tuft hypertrophy, glomerular sclerosis is a risk factor for renal dysfunction in subjects with diabetic nephropathy (5, 31). Overexcessive ECM in mesangial spaces can cause vascular capillary collapse (5, 29), leading to albuminuria and interstitial injuries are accelerated. To produce ECM proteins, mesangial cells acquire myofibroblast-like phenotypes (including {alpha}-SMA fibers) (10) and TGF-{beta}1 plays a central role in this process (6). After the onset of hyperglycemia, glomerular HGF levels are inversely proportional to the degree of mesangial sclerosis. Moreover, rh-HGF led to decreased TGF-{beta}1 levels and attenuated sclerosis in the mice, suggesting that endogenous HGF is preventive for the progression of diabetic glomerulopathy in the advanced stage. Our in vitro results suggest that antisclerogenic effects (such as attenuated myofibroblastosis and reduced ECM deposition) by HGF are, at least in part, directed toward mesangial cells.

We discuss other mechanisms of HGF-mediated outcomes in diabetic glomerulopathy. A loss of glomerular endothelial cells or podocytes may be critical for glomerular sclerosis to be manifest (17, 37). HGF is protective to endothelial cells and podocytes (11, 26), even under diabetic states. Thus protection of glomerular resident cells by HGF may involve attenuated glomerular injuries. We reported that HGF arrests mesangial overproliferation (4), an initial event that provokes sclerosis. HGF represses upregulation of connective tissue growth factor (15), a key cytokine needed for fibrosis to develop (32). Given that HGF induces ECM-degradating enzymes (such as matrix metalloproteinase-1/-9) (20, 30), HGF-induced matrix metalloproteinases likely contribute to attenuated fibrosis. HGF can decrease blood pressure in vivo (46), and this may be linked with suppressions of tuft hypertrophy by HGF. Such multifunctional activities by HGF would lead to attenuated glomerular injuries.

Clinical studies imply that tubulointerstitial lesions show the best correlation with renal failure in diabetic nephropathy (5, 12). Urinary albumin provokes MCP-1 upregulation, and then peritubular inflammation and fibrosis may develop (9, 35). Notably, HGF was shown to repress albuminuria in our model. Renal MCP-1 levels were reduced by HGF, such being the opposite of findings in vitro (42). Concomitantly, tubulointerstitial fibrogenic events (such as macrophage infiltration, myofibroblastosis, and ECM overdeposition) were suppressed in HGF-injected diabetic mice. Thus sequential mechanisms for attenuated renal dysfunction include 1) HGF protects from glomerular injuries in diabetic stress; 2) albumin excretion and in turn tubular MCP-1 expression are controlled; and 3) overall, onset of peritubular inflammation and fibrogenesis is avoided. On the other hand, we also consider direct effects of HGF toward tubular lesions, as reported (2325).

Recently, Laping et al. (18) reported that a strain of mice (db/db) developed diabetic kidney disease under an HGF supplement protocol. This finding conflicts with our observations. In their study, however, very low doses of HGF (160 ng·kg-1·day-1 = "1/3,000" of ours, sc) were used. Because the half-time of HGF in the circulation is within 10 min, at least several hundred micrograms of HGF are needed to produce and sustain physiological HGF levels (our unpublished data), especially in cases of systemic (subcutaneous or intramuscular) administrations. Of note, giving physiological doses of HGF (i.e., 600 µg·kg-1·day-1 sc) to db/db mice led to a trend of improvement of renal functions (Kajihara M and Kuroda A, unpublished data). Although the way in which the very low dose of HGF has different effects awaits results from additional studies, the use of HGF at physiological doses seems to be safe and effective.

Finally, it is important to discuss a cause-and-result relationship between reciprocal expressions of HGF and TGF-{beta}1 in the diabetic kidney. HGF represses TGF-{beta}1 production, as shown herein and reported elsewhere (38, 39), and vice versa (22, 26). Thus a potential mechanism for regulating the balance involves 1) in an early stage of diabetic disease, HGF expression is enhanced to block TGF-{beta}1 production after which a shift to renal sclerosis is prevented; and 2) in turn, excessive TGF-{beta}1 in a later phase leads to successful fibrogenesis via inhibiting HGF production. Previous evidence implies that HGF is a tubulotrophic factor (21), and HGF is now recognized as glomerulotrophic. The above taken together, we hypothesize that there may be reciprocal mechanisms of TGF-{beta}1 and HGF to regulate progression of glomerular as well as tubulointerstitial fibrosis in chronic renal organ diseases and that supplement of HGF is considered as a molecular pathogenesis-based strategy to limit renal fibrosis (Fig. 8). Alternatively, novel specific approaches with enhancing or sustaining endogenous HGF production can be developed to limit TGF-{beta}1 overexpression and chronic renal failure.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 8. Hypothetical model for molecular pathogenesis and therapy of renal fibrosis by HGF. Reciprocal balance between HGF and TGF-{beta}1 is involved in determining the fates of chronic renal diseases. In an early stage of chronic renal disorders, HGF production is enhanced to suppress TGF-{beta}1 production. In the HGF-dominant balance, renotropic, protective, and antifibrotic events occur as a compensatory response. By contrast, TGF-{beta}1 production is, in turn, upregulated in an advanced stage to prohibit HGF production. Under the TGF-{beta}1-dominant condition, a loss of parenchymal regeneration leads to accelerated renal fibrosis and dysfunction. To reverse the fibrosis-progressed balance, supplement therapy with HGF (or its gene) could be considered as a strategy for attenuating fibrosis, a common pathway leading to end-stage chronic renal failures [including diabetic nephropathy, nephrotic syndrome (23, 24), obstructive nephropathy (25, 44, 45), and chronic allograft nephropathy (2)].

 


    ACKNOWLEDGMENTS
 
We are grateful to M. Ohara (Fukuoka) for critical readings of the manuscript and for pertinent comments.

GRANTS

This study was supported by grants from the Ministry of Education, Science, Technology, Sports and Culture of Japan (14207005 and 12215082 to T. Nakamura and 14570187 to S. Mizuno) and by the Mochida Memorial Foundation for Medical and Pharmaceutical Research (to S. Mizuno).


    FOOTNOTES
 

Address for reprint requests and other correspondence: T. Nakamura, Division of Molecular Regenerative Medicine, Dept. of Molecular Regenerative Medicine, Osaka Univ. Graduate School of Medicine, Yamadaoka 2-2-B7, Suita 565-0871, Japan (E-mail: nakamura{at}onbich.med.osaka-u.ac.jp).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Akmal M. Hemodialysis in diabetic patients. Am J Kidney Dis 38: S195-S199, 2001.[Web of Science][Medline]
  2. Azuma H, Takahara S, Matsumoto K, Ichimaru N, Wang JD, Moriyama T, Wega A, Otsuki Y, Kitamura M, Okuyama A, Katsuoka Y, Chandraker A, Sayegh MH, and Nakamura T. Hepatocyte growth factor prevents development of chronic allograft nephropathy in an experimental rat transplant model. J Am Soc Nephrol 12: 1280-1292, 2001.[Abstract/Free Full Text]
  3. Balkovetz DF and Lipschutz JH. Hepatocyte growth factor and the kidney: it is not just for the liver. Int Rev Cytol 186: 225-260, 1999.[Web of Science][Medline]
  4. Bessho K, Mizuno S, Matsumoto K, and Nakamura T. Counteractive effects of HGF on PDGF-mediated mesangial cell proliferation in a rat model of glomerulonephritis. Am J Physiol Renal Physiol 284: F1171-F1180, 2003.[Abstract/Free Full Text]
  5. Bohle A, Wehrmann M, Bogenschutz O, Batz C, Muller CA, and Muller GA. The pathogenesis of chronic renal failure in diabetic nephropathy. Investigation of 488 cases of diabetic glomerulosclerosis. Pathol Res Pract 187: 251-259, 1991.[Web of Science][Medline]
  6. Border WA and Noble NA. Transforming growth factor {beta} in tissue fibrosis. N Engl J Med 331: 1286-1292, 1994.[Free Full Text]
  7. Brenner BM, Meyer TW, and Hostetter TH. Dietary protein intake and the progressive nature of kidney disease: the role of hemodynamically mediated glomerular injury in the pathogenesis of progressive glomerular sclerosis in aging, renal ablation, and intrinsic renal disease. N Engl J Med 307: 652-659, 1982.[Web of Science][Medline]
  8. Chen N, Chen WY, Bellush L, Yang CW, Striker LJ, Striker JE, and Kopchick JJ. Effects of STZ treatment in growth hormone (GH) and GH antagonist transgenic mice. Endocrinology 136: 660-667, 1995.[Abstract]
  9. Eddy AA and Giachelli CM. Renal expression of genes that promote interstitial inflammation and fibrosis in rats with protein-overload proteinuria. Kidney Int 47: 1546-1557, 1995.[Web of Science][Medline]
  10. Essawy M, Soylemezoglu O, Muchaneta-Kubara EC, Shortland J, Brown CB, and Nahas AM. Myofibroblasts and the progression of diabetic nephropathy. Nephrol Dial Transplant 12: 43-50, 1997.[Abstract/Free Full Text]
  11. Fornoni A, Li H, Foschi A, Striker GE, and Striker LJ. Hepatocyte growth factor, but not insulin-like growth factor I, protects podocytes against cyclosporin-A-induced apoptosis. Am J Pathol 158: 275-280, 2001.[Abstract/Free Full Text]
  12. Gilbert RE and Cooper ME. The tubulointerstitium in progressive diabetic kidney disease: more than an aftermath of glomerular injury? Kidney Int 56: 1627-1637, 1999.[CrossRef][Web of Science][Medline]
  13. Goldfar S and Ziyadeh FN. TGF-{beta}: a crucial component of the pathogenesis of diabetic nephropathy. Trans Am Clin Climatol Assoc 112: 27-32, 2001.[Medline]
  14. Igawa T, Matsumot K, Kanda S, Saito Y, and Nakamura T. Hepatocyte growth factor may function as a renotropic factor for regeneration in rats with acute renal injury. Am J Physiol Renal Fluid Electrolyte Physiol 265: F61-F69, 1993.[Abstract/Free Full Text]
  15. Inoue T, Okada H, Kobayashi T, Watanabe Y, Kanno Y, Kopp JB, Nishida T, Takigawa M, Ueno M, Nakamura T, and Suzuki H. Hepatocyte growth factor counteracts transforming growth factor-{beta}1, through attenuation of connective tissue growth factor induction, and prevents renal fibrogenesis in 5/6-nephrectomized mice. FASEB J 17: 268-270, 2003.[Abstract/Free Full Text]
  16. Kawaida K, Matsumoto K, Shimazu H, and Nakamura T. Hepatocyte growth factor prevents acute renal failure and accelerates renal regeneration in mice. Proc Natl Acad Sci USA 91: 4357-4361, 1994.[Abstract/Free Full Text]
  17. Kriz W and Lemley KV. The role of the podocyte in glomerulosclerosis. Curr Opin Nephrol Hypertens 8: 489-497, 1999.[CrossRef][Web of Science][Medline]
  18. Laping NJ, Olson BA, Ho T, Ziyadeh FN, and Albrightson CR. Hepatocyte growth factor: a regulator of extracellular matrix genes in mouse mesangial cells. Biochem Pharmacol 59: 847-853, 2000.[CrossRef][Web of Science][Medline]
  19. Lazarus JM, Denker BM, and Owen WF. Hemodialysis. In: The Kidney (5th ed.), edited by Brenner BM. Philadelphia: W. B. Saunders, 1996, p. 2424-2506.
  20. Liu Y, Raju K, Tolbert E, and Dworkin LD. Endogenous hepatocyte growth factor ameliorates chronic renal injury by activating matrix degradation pathways. Kidney Int 58: 2028-2043, 2000.[CrossRef][Web of Science][Medline]
  21. Matsumoto K and Nakamura T. Hepatocyte growth factor: renotropic role and potential therapeutics for renal diseases. Kidney Int 59: 2023-2038, 2001.[Web of Science][Medline]
  22. Matsumoto K, Tajima H, Okazaki H, and Nakamura T. Negative regulation of hepatocyte growth factor gene expression in human lung fibroblasts and leukemic cells by transforming growth factor-{beta}1 and glucocorticoids. J Biol Chem 267: 24917-24920, 1992.[Abstract/Free Full Text]
  23. Mizuno S, Kurosawa T, Matumoto K, Mizuno-Horikawa Y, Okamoto M, and Nakamura T. Hepatocyte growth factor prevents renal fibrosis and dysfunction in a mouse model of chronic renal disease. J Clin Invest 101: 1827-1834, 1998.[Web of Science][Medline]
  24. Mizuno S, Matsumoto K, Kurosawa T, Mizuno-Horikawa Y, and Nakamura T. Reciprocal balance of hepatocyte growth factor and transforming growth factor-{beta}1 in renal fibrosis in mice. Kidney Int 57: 937-948, 2000.[Web of Science][Medline]
  25. Mizuno S, Matsumoto K, and Nakamura T. Hepatocyte growth factor suppresses tubulo-interstitial fibrosis in a mouse model of obstructive nephropathy. Kidney Int 59: 1304-1314, 2001.[CrossRef][Web of Science][Medline]
  26. Morishita R, Nakamura S, Nakamura Y, Aoki M, Moriguchi A, Kida I, Yo Y, Matsumoto K, Nakamura T, Higaki J, and Ogihara T. Potential role of an endothelium specific growth factor, hepatocyte growth factor, on endothelial damage in diabetes. Diabetes 46: 138-142, 1997.[Abstract]
  27. Nakamura T, Nawa K, and Ichihara A. Partial purification and characterization of hepatocyte growth factor from serum of hepatectomized rats. Biochem Biophys Res Commun 122: 1450-1459, 1984.[CrossRef][Web of Science][Medline]
  28. Nakamura T, Nishizawa T, Hagiya M, Seki T, Shimonishi M, Sugimura A, Tashiro K, and Shimizu S. Molecular cloning and expression of human hepatocyte growth factor. Nature 342: 440-443, 1989.[CrossRef][Medline]
  29. Ong AC and Fine LG. Loss of glomerular function and tubulointerstitial fibrosis: cause or effect? Kidney Int 45: 345-351, 1994.[Web of Science][Medline]
  30. Ozaki I, Zhao G, Mizuta T, Ogawa Y, Hara T, Kajihara S, Hisatomi A, Sakai T, and Yamamoto K. HGF induces collagenase (matrix metalloproteinase-1) via the transcription factor Ets-1 in human hepatic stellate cell line. J Hepatol 36: 169-178, 2000.
  31. Parving HH. Initiation and progression of diabetic nephropathy. N Engl J Med 335: 1682-1683, 1996.[Free Full Text]
  32. Riser BL, Denichilo M, Cortes P, Baker C, Grondin JM, Yee J, and Narins RG. Regulation of connective tissue growth factor activity in cultured rat mesangial cells and its expression in experimental diabetic glomerulosclerosis. J Am Soc Nephrol 11: 25-38, 2000.[Abstract/Free Full Text]
  33. Sharma K, Jin Y, Guo J, and Ziyadeh FN. Neutralization of TGF-{beta} by anti-TGF-{beta} antibody attenuates kidney hypertrophy and the enhanced extracellular matrix gene expression in STZ-induced diabetic mice. Diabetes 45: 522-530, 1996.[Abstract]
  34. Sharma K and Ziyadeh FN. Hyperglycemia and diabetic kidney disease. The case for transforming growth factor-beta as a key mediator. Diabetes 44: 1139-1146, 1995.[Abstract]
  35. Shimizu H, Maruyama S, Yuzawa Y, Kato T, Miki Y, Suzuki S, Sata W, Morita Y, Maruyama H, Egashira K, and Matsuo S. Anti-monocyte chemoattractant protein-1 gene therapy attenuates renal injuries induced by protein-overload proteinuria. J Am Soc Nephrol 14: 1496-1505, 2003.[Abstract/Free Full Text]
  36. Singh R, Alavi N, Singh AK, and Leehey DJ. Role of angiotensin II in glucose-induced inhibition of mesangial matrix degradation. Diabetes 48: 2066-2073, 1999.[Abstract]
  37. Takahashi T, Huynh-Do U, and Daniel TO. Renal microvascular assembly and repair: power and promise of molecular definition. Kidney Int 53: 826-835, 1998.[CrossRef][Web of Science][Medline]
  38. Taniyama Y, Morishita R, Nakagami H, Moriguchi A, Sakonjo H, Shokei-Kim H, Matsumoto K, Nakamura T, Higaki J, and Ogihara T. Potential contribution of a novel antifibrotic factor, hepatocyte growth factor, to prevention of myocardial fibrosis by angiotensin II blockade in cardiomyopathic hamsters. Circulation 102: 246-252, 2000.[Abstract/Free Full Text]
  39. Taylor GA, Jeffers M, Webb CP, Koo HM, Anve M, Sekiguchi K, and Vande-Woude GF. Decreased fibronectin expression in Met/HGF-mediated tumorigenesis. Oncogene 17: 1179-1183, 1998.[CrossRef][Web of Science][Medline]
  40. The Diabetes Control and Complications Trial Research Group. The effect of intensive treatment of diabetes on the developmental and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med 329: 977-986, 1993.[Abstract/Free Full Text]
  41. UK Prospective Diabetes Study (UKPDS) Group. Intensive bloodglucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes. Lancet 352: 837-853, 1998.[CrossRef][Web of Science][Medline]
  42. Wang SN, Lapage J, and Hirschberg R. Role of glomerular ultrafiltration of growth factors in progressive interstitial fibrosis in diabetic nephropathy. Kidney Int 57: 1002-1014, 2000.[CrossRef][Web of Science][Medline]
  43. Yamamoto T, Nakamura T, Noble NA, Ruoslahti E, and Border WA. Expression of transforming growth factor {beta} is elevated in human and experimental diabetic nephropathy. Proc Natl Acad Sci USA 90: 1814-1818, 1993.[Abstract/Free Full Text]
  44. Yang J, Dai C, and Liu Y. Systemic administration of naked plasmid encoding hepatocyte growth factor ameliorates chronic renal fibrosis in mice. Gene Ther 8: 1470-1479, 2001.[CrossRef][Web of Science][Medline]
  45. Yang J and Liu Y. Delayed administration of hepatocyte growth factor reduces renal fibrosis in obstructive nephropathy. Am J Physiol Renal Physiol 284: F349-F357, 2003.[Abstract/Free Full Text]
  46. Yang R, Bunting S, Ko A, Schwall R, and Jin H. Hemodynamic effects of scatter factor in concious rats. J Cardiovasc Pharmacol 30: 294-301, 1997.[CrossRef][Web of Science][Medline]
  47. Ziyadeh FN, Hoffman BB, Han CC, Iglesias-Cruz MC, Hong SW, Isono M, Chen S, McGowan TA, and Sharma K. Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal antitransforming growth factor-{beta} antibody in db/db diabetic mice. Proc Natl Acad Sci USA 97: 8015-8020, 2000.[Abstract/Free Full Text]
  48. Ziyadeh FN, Sharma K, Ericksen M, and Wolf G. Stimulation of collagen gene expression and protein synthesis in murine mesangial cells by high glucose is mediated by autocrine activation of transforming growth factor-{beta}. J Clin Invest 93: 536-542, 1994.[Web of Science][Medline]



This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
C.-L. Lin, J.-Y. Wang, J.-Y. Ko, Y.-T. Huang, Y.-H. Kuo, and F.-S. Wang
Dickkopf-1 Promotes Hyperglycemia-Induced Accumulation of Mesangial Matrix and Renal Dysfunction
J. Am. Soc. Nephrol., January 1, 2010; 21(1): 124 - 135.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
S. Kroening, S. Solomovitch, M. Sachs, B. Wullich, and M. Goppelt-Struebe
Regulation of connective tissue growth factor (CTGF) by hepatocyte growth factor in human tubular epithelial cells
Nephrol. Dial. Transplant., March 1, 2009; 24(3): 755 - 762.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
J. Gozdzikiewicz, J. Borawski, and M. Mysliwiec
Pleiotropic Effects of Heparin and Heparinoids in Peritoneal Dialysis
Clinical and Applied Thrombosis/Hemostasis, February 1, 2009; 15(1): 92 - 97.
[Abstract] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. Tan, X. Zhang, J. Yang, Y. Li, and Y. Liu
Molecular Basis for the Cell Type Specific Induction of SnoN Expression by Hepatocyte Growth Factor
J. Am. Soc. Nephrol., August 1, 2007; 18(8): 2340 - 2349.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. Gong, A. Rifai, and L. D. Dworkin
Anti-Inflammatory Effect of Hepatocyte Growth Factor in Chronic Kidney Disease: Targeting the Inflamed Vascular Endothelium
J. Am. Soc. Nephrol., September 1, 2006; 17(9): 2464 - 2473.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
T. Rampino, M. Gregorini, G. Camussi, P. G. Conaldi, G. Soccio, M. Maggio, A. Bottelli, and A. Dal Canton
Hepatocyte growth factor and its receptor Met are induced in crescentic glomerulonephritis
Nephrol. Dial. Transplant., June 1, 2005; 20(6): 1066 - 1074.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Shigemura, Y. Sawa, S. Mizuno, M. Ono, M. Ohta, T. Nakamura, Y. Kaneda, and H. Matsuda
Amelioration of Pulmonary Emphysema by In Vivo Gene Transfection With Hepatocyte Growth Factor in Rats
Circulation, March 22, 2005; 111(11): 1407 - 1414.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. Biswas, A. Roy, R. Gong, A. Yango, E. Tolbert, J. Centracchio, and L. D. Dworkin
Hepatocyte growth factor induces an endothelin-mediated decline in glomerular filtration rate
Am J Physiol Renal Physiol, January 1, 2005; 288(1): F8 - F15.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. Yang, C. Dai, and Y. Liu
A Novel Mechanism by which Hepatocyte Growth Factor Blocks Tubular Epithelial to Mesenchymal Transition
J. Am. Soc. Nephrol., January 1, 2005; 16(1): 68 - 78.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. Gong, A. Rifai, E. M. Tolbert, P. Biswas, J. N. Centracchio, and L. D. Dworkin
Hepatocyte Growth Factor Ameliorates Renal Interstitial Inflammation in Rat Remnant Kidney by Modulating Tubular Expression of Macrophage Chemoattractant Protein-1 and RANTES
J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2868 - 2881.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. Dai, J. Yang, S. Bastacky, J. Xia, Y. Li, and Y. Liu
Intravenous Administration of Hepatocyte Growth Factor Gene Ameliorates Diabetic Nephropathy in Mice
J. Am. Soc. Nephrol., October 1, 2004; 15(10): 2637 - 2647.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Liu
Hepatocyte growth factor in kidney fibrosis: therapeutic potential and mechanisms of action
Am J Physiol Renal Physiol, July 1, 2004; 287(1): F7 - F16.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. Dai and Y. Liu
Hepatocyte Growth Factor Antagonizes the Profibrotic Action of TGF-{beta}1 in Mesangial Cells by Stabilizing Smad Transcriptional Corepressor TGIF
J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1402 - 1412.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/1/F134    most recent
00199.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (37)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mizuno, S.
Right arrow Articles by Nakamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mizuno, S.
Right arrow Articles by Nakamura, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.