AJP - Renal Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 286: F349-F355, 2004. First published October 28, 2003; doi:10.1152/ajprenal.00411.2002
0363-6127/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/2/F349    most recent
00411.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klar, J.
Right arrow Articles by Kurtz, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klar, J.
Right arrow Articles by Kurtz, A.

Aldosterone enhances renin gene expression in juxtaglomerular cells

Jürgen Klar, Helga Vitzthum, and Armin Kurtz

Institut für Physiologie, Universität Regensburg, D-93040 Regensburg, Germany

Submitted 20 November 2002 ; accepted in final form 21 October 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The secretion and synthesis of renin as the key regulator of the renin-angiotensin-aldosterone system are directly controlled by ANG II in the sense of a negative feedback. Because we found that renal afferent arterioles including the juxtaglomerular portion express the mineralocorticoid receptor, we aimed to characterize a possible direct effect of aldosterone on renin synthesis and renin secretion at the level of renal juxtaglomerular cells. Aldosterone (100 nM) clearly enhanced renin mRNA levels in primary cultures of mouse juxtaglomerular cells prestimulated with isoproterenol (100 nM) but had no effect on the exocytosis of stored renin. Similarly, in the mouse juxtaglomerular cell line As4.1, aldosterone time and concentration dependently increased renin mRNA abundance and prorenin secretion up to 2.5-fold. Moreover, aldosterone potentiated cAMP-induced renin gene expression in As4.1 cells. The effect of aldosterone was inhibited by spironolactone and was mimicked by corticosteroid hormones but not by sex steroids. Aldosterone had no influence on basal renin promoter activity but increased the renin mRNA half-life about threefold. In summary, these data suggest that aldosterone exerts a direct positive effect on renin gene expression at the cellular level probably by stabilizing renin mRNA.

renin-angiotensin-aldosterone system; mineralocorticoid receptor; As 4.1 cells


THE RENIN-ANGIOTENSIN-ALDOSTERONE (RAAS) cascade is basically involved in the regulation of sodium homeostasis and blood pressure (6). In its activity, the RAAS is mainly triggered by the activity of the protease renin, which is predominantly produced and secreted from renal juxtaglomerular (JG) cells (6). Within JG cells, (pro) renin synthesis is essentially determined by the steady-state levels of renin mRNA (11). The secretion and synthesis of renin in JG cells are, in turn, controlled by the RAAS in the sense of a negative feedback loop. Thus activation of the RAAS increases blood pressure and an increase of renal perfusion pressure, in turn, inhibits renin secretion and synthesis (6, 11). Stimulation of ANG II and aldosterone formation increases sodium reabsorption and in consequence increases body sodium content (6). Increased sodium content, in turn, inhibits renin gene expression (6, 11). Likely, there also exists a short-loop feedback mediated by ANG II, which inhibits renin gene expression directly at the level of renal JG cells via angiotensin AT1 receptors (6, 23). Whether the second effector hormone of the RAAS, namely, aldosterone, exerts a direct effect on renin gene expression is not known (6). We were therefore interested to find out whether renal JG cells express receptors for aldosterone and if so to determine the effect of their activation on renin gene expression. Because we found mineralocorticoid receptor gene expression in microdissected afferent arterioles from mouse kidneys, we characterized the effect of aldosterone on renin gene expression in the mouse JG As4.1 cell line (20), which also expresses mineralocorticoid receptors.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
As4.1. cell culture. The renin-expressing As4.1 cell line was obtained from the American Type Culture Collection (ATCC No. CRL2193). Cells were cultured at 37°C in 10% CO2 atmosphere in DMEM medium (Biochrom) supplemented with 5% FCS, L-glutamine, Na-pyruvate, 100 U/ml penicillin, and 100 µg/ml streptomycin (20). After reaching confluence, cells were diluted and seeded in 96-well culture plates (for radioimmunoassay), 24-well plates (for transfection), or 25-cm2 culture flasks (for RNA harvest). At the beginning of the experiments, cells were 90% confluent.

Isolation and culture of primary mouse JG cells. The preparation of the primary mouse JG cells was done according to Kurtz Della Bruna et al. (10). Isolated JG cells of two mice (C57BL) were seeded in 36 wells of a 96-well plate for renin-RIA or in 24 wells of a 24-well plate for RNA isolation. Cells were cultured at 37°C in 5% CO2 atmosphere in DMEM medium (Biochrom) supplemented with 5% FCS, L-glutamine, Na-pyruvate, 100 U/ml penicillin, and 100 µg/ml streptomycin. Twenty-four hours after isolation, the cells were washed once with medium and then used for experiments.

Isolation of mouse glomerulus with afferent arteriole. The isolation was done according to the protocol of Ref. 22. For one reverse transcriptase reaction of 20-µl volume, RNA from 11 glomeruli with afferent arterioles was isolated.

RNA isolation and ribonuclease protection assay. Total RNA was extracted according to the acid-guanidinium-phenol-chloroform protocol of Chomczynski and Sacchi (3).

A 194-bp mouse renin PCR fragment was positional cloned through BamHI/EcoRI adapter primers in the polylinker site of vector pSP73 (Promega) for in vitro transcription. Mouse {beta}-actin was cloned by the same procedure, which amplified a 273-bp fragment.

Renin mRNA and {beta}-actin mRNA levels were measured by ribonuclease protection assay. In brief, after linearization and purification, the plasmids yielded radiolabeled antisense cRNA transcripts by incubation with SP6 polymerase (Promega) and [{alpha}-33P]UTP (Amersham) according to the Promega riboprobe in vitro transcription protocol. Then, 5 x 105 cpm of the cRNA probes was solution-hybridized with As4.1 cell total RNA at 60°C overnight and then digested with RNase A/T1 (RT/30 min; Roche) and proteinase K (37°C, 30 min; Roche) treated. For hybridization, 10 µg total RNA for renin and 2 µg of total RNA for {beta}-actin were measured. Protected fragments were separated on 8% polyacrylamide gels, and incorporated radioactivity was quantified in a PhosphorImager (Packard).

RT-PCR. Reverse transcription was primed with 0.5 µg of oligo (dT)12-18 (Invitrogen) with 20 U of RNasin (Promega) and 3 µg of total RNA from As4.1 cells at 65°C for 5 min. The samples were then incubated with 100 U of recombinant Moloney murine leukemia virus RT (Promega) in 20 µl of buffer containing 500 µM dNTP and manufacturer's RT buffer for 1 h at 37°C. The RT-PCR experiments were performed using a DNA Thermal Cycler (Perkin Elmar Cetus) in a reaction volume of 20 µl. Two microliters of the cDNA were mixed with 1 pmol of each oligonucleotide primer, 1 U of Taq DNA polymerase (Roche), 25 mM dNTPs, and 2 µl of the manufacturer's PCR buffer containing MgCl2. The PCR was run for 32 cycles with a denaturing phase of 30 s at 94°C, annealing phase of 30 s at 60°C, and extension phase of 1 min at 72°C. The last cycle was followed by an additional incubation period of 10 min at 72°C. The following oligonucleotides were used: mineralocorticoid receptor, 5'GTCCATTGAGCAGCATGA'3 and 5'TGGAAACGGAGCACCTTG'3 (146 bp); and 11-{beta}-hydroxysteroid dehydrogenase 2, 5'GCTCTCGACTGGCTGTGC'3 and 5'CACGGCTGATGTCCTCTG'3 (316 bp).

Real-time PCR analysis. Real-time PCR was performed in a Light Cycler (Roche). All PCR experiments were done using the Light Cycler DNA Master SYBR Green I kit provided by Roche Molecular Biochemicals (Mannheim, Germany). Each reaction (20 µl) contained 2 µl cDNA, 3.0 mM MgCl2, 1 pmol of each primer, and 2 µl of Fast Starter Mix (containing buffer, dNTPs, SYBR Green, and hotstart Taq polymerase). The amplification program consisted of 1 cycle at 95°C for 10 min, followed by 40 cycles with a denaturing phase at 95°C for 15 s, an annealing phase of 5 s at 60°C, and an elongation phase at 72°C for 15 s. A melting curve analysis was done after amplification to verify the accuracy of the amplicon. For verification of the correct amplification, PCR products were analyzed on an ethidium bromide-stained 2% agarose gel.

Plasmid constructs. The mouse renin-promoter-luciferase constructs were generated by amplifying the 5'-flanking sequence of the mouse Ren-1C gene from a commercially available mouse genomic DNA (BALB/c, Clontech) using the expanded long-template PCR system (Roche). With the use of a primer combination 5'GCGTGCATGTGGTGTACATAG'3 (sense)/5'GAGACTGAAGGTGCAAGG'3 (antisense), a 4.2-kb fragment (-4,071 to +98), or primer combination 5'TAGTAGACACCAGGAGATGAC'3 (sense)/5'GAGACTGAAGGTGCAAGG'3 (antisense), a 2.8-kb fragment (-2,870 to +98) of the mouse Ren-1C promoter (accession number L78789 [GenBank] ) was generated and inserted in the polylinker site of vector pGL3 Enhancer (Promega), creating pGL3E-4.2 or pGL3E-2.8 kb.

DNA transfection. As4.1 cells were grown in DMEM medium containing 5% FCS. Cells were plated 24 h before transfection in 24-well culture plates with a density of 5 x 104 cells per well. Transfection was performed via liposome-mediated transfection using Fugene transfection reagent (Roche). For each transfection, 1 µg of test DNA was transfected by using 6 µl of Fugene. To correct luciferase activity for variation in transfection efficiency, As4.1 cells were cotransfected with 100 ng of a plasmid containing a thymidine kinase promoter driving renilla luciferase (pRL-TK Renilla, Promega). The medium was replaced 12 h after transfection, and the cells were incubated for 30 h with the test agents.

Dual-luciferase assay. Transfected cells were washed twice with PBS and lysed by adding 100 µl of 1x passive lysis buffer solution (dual-luciferase assay; Promega) at room temperature for 20 min. Cell lysates were spun at 10,000 g to remove cellular debris and stored at -20°C until assayed for luciferase activity.

Luciferase and Renilla luciferase activity were measured by mixing 20 µl of cell extract with 100 µl of luciferase assay buffer and the subsequent addition of 100 µl stop and glow solution, respectively. Light production was measured for 20 s for luciferase and Renilla luciferase activity in a Lumat LB 9507 luminometer (Berthold). The relative luciferase activity was calculated as luciferase (RLU)/Renilla luciferase (RLU).

Renin concentration. Experiments on renin expression from As4.1 cells were performed in 96-well plates with a cell density of 2 x 104 cells per well throughout 24 h of incubation. At the end of the experiments, supernatants were collected and centrifuged at 10,000 g at room temperature to remove cellular debris. The supernatants were stored at -20°C until assayed for renin concentration. Cells were lysed by addition of 100 µl PBS, which contained 0.1% Triton X-100 to each culture well followed by vigorous shaking for 30 min. Lysates were spun at 10,000 g, and the supernatants were stored at -20°C until further processing. To determine the amount of total renin activity, prorenin was activated (converted to active renin) with trypsin treatment (0.3 mg/ml for cell lysates or 1 mg/ml for supernatant for 1 h at room temperature). After inhibition of trypsin with PMSF, renin concentration was determined by the ability of the samples to generate ANG I from the plasma of bilaterally nephrectomized rats. ANG I was measured by RIA (Sorin Biomedica, Düsseldorf, Germany).

Isolated, perfused kidney. The isolated, perfused rat kidney was prepared as previously described (19). In brief, the perfusion of the kidney of male Sprague-Dawley rats (280-330 g body wt) was performed in a recycling system. The animals were anesthetized with 100 mg/kg of 5-ethyl-5-(1-methylbutyl)-2-thiobarbituric acid (TRAP-ANAL; Byk Gulden, Konstanz, Germany). After the abdominal cavity was opened, the right kidney was exposed and placed in a thermo-regulated metal chamber. After intravenous heparin injection (2 U/g), the aorta was clamped distal to the right renal artery so that the perfusion of the right kidney was not disturbed during the following insertion of the perfusion cannula in the aorta distal to the clamp. After ligation of the large vessels branching off the abdominal aorta, a double-barreled perfusion cannula was inserted into the abdominal aorta and placed close to the aortic clamp distal to the origin of the right renal artery. After ligation of the aorta proximal to the right renal artery, the aortic clamp was quickly removed and perfusion was started in situ with an initial flow rate of 8 ml/min. The right kidney was excised and perfusion at constant pressure (100 mmHg) was established. To this end, the renal artery pressure was monitored through the inner part of the perfusion cannula (Statham Transducer P-10 EZ) and the pressure signal was used for feedback control of a peristaltic pump. The perfusion circuit was closed by draining the venous effluent via a metal cannula back into a reservoir (200-220 ml). A potentiometric recorder continuously monitored renal flow rate and perfusion pressure. Stock solutions of the drugs to be tested were dissolved in freshly prepared perfusate and infused into the arterial limb of the perfusion circuit directly before the kidneys at 3% of the rate of perfusate flow.

For determination of perfusate, renin activity aliquots (~0.1 ml) were drawn in intervals of 5 min from the arterial limb of the circulation and the renal venous effluent, respectively. Renin secretion rates were calculated as the product of the arteriovenous differences of renin activity and the perfusate flow rate (ml/min).

cAMP concentration. The cAMP levels of As4.1 cells were determined with cAMP-ELISA (Assay Designs). Twenty-thousand cells were seeded in 100 µl cell culture medium in each well of a 96-well plate and grown overnight. Then the cells were stimulated for 24 h and harvested in 100 µl 0.1 M HCl. The sample was directly assayed in the cAMP-ELISA.

Statistics. Data are expressed as means ± SE. To test homogeneity of variance, data were analyzed by Levene's test. Multiple comparisons of several groups were done by ANOVA followed by a Bonferroni reduction. Single comparisons were performed using Student's unpaired t-test. P < 0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mineralocorticoid receptor mRNA in microdissected afferent arterioles and primary cultures of JG cells. To determine whether the mineralocorticoid receptor gene is expressed in the JG region at all, glomeruli with short afferent arterioles from mouse kidneys were microdissected and mineralocorticoid receptor mRNA was assayed by RT-PCR. As shown in Fig. 1, glomeruli with renal afferent arterioles as well as short-term primary cultures of mouse JG cells significantly expressed the mineralocorticoid receptor gene. For a specific action of aldosterone on the mineralocorticoid receptor, the expression of the hydroxysteroid 11-{beta}-dehydrogenase 2 is essential, which inactivates glucocorticoids, allowing aldosterone to access to the receptor. As shown in Fig. 1, the hydroxysteroid 11-{beta}-dehydrogenase 2 gene is coexpressed with the mineralocorticoid receptor in the glomeruli with afferent arterioles and in primary cultures of mouse JG cells.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 1. Ethidium bromide-stained agarose gels showing PCR for mineralocorticoid receptor (A) and for 11-{beta}-hydroxysteroid dehydrogenase 2 (B) in mouse glomeruli (glom.) with afferent arterioles, juxtaglomerular (JG) cells, and As4.1 cells.

 

Effects of aldosterone on primary cultures of mouse JG cells. In primary cultures of mouse (C57/Bl6) JG cells, basal renin mRNA abundance was low and unaltered after incubation with 100 nM aldosterone for 24 h. The {beta}-adrenergic agonist isoproterenol (100 nM) increased renin mRNA and this increase was clearly enhanced in the presence of aldosterone (Fig. 2A). Aldosterone did not change the secretion of active renin, reflecting exocytosis of stored renin, neither in the absence nor in the presence of isoproterenol, which itself clearly stimulated renin secretion (Fig. 2B).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2. Effects on renin gene transcription and renin secretion by aldosterone and isoproterenol in isolated native JG cells. A: native isolated JG cells were incubated for 24 h with 100 nM aldosterone and 100 nM isoproterenol and with the combination of both. Renin mRNA was quantified in a real-time PCR and normalized to the {beta}-actin mRNA. B: total renin secretion from native isolated JG cells incubated with 100 nM isoproterenol, 100 nM aldosterone, or both in combination for 30 h. Values are means ± SE of 6 independent measurements. *P < 0.05.

 

Effects of aldosterone on the mouse JG cell line As4.1. To characterize the regulation of renin gene expression at the cellular level by aldosterone, we used the mouse JG cell line As4.1, because we found significant expressions of mineralocorticoid receptor gene and the 11-{beta}-hydroxysteroid dehydrogenase 2 gene also in these cells (Fig. 1).

To determine the effect of aldosterone on renin gene expression, As4.1 cells were incubated with aldosterone (100 nM) for different times up to 24 h. Figure 3 shows that after a lag time of ~8 h basal renin mRNA levels increased in the presence of aldosterone, reaching levels that were 2.5-fold over control after 24 h. This effect of aldosterone on renin mRNA was concentration dependent, the half-maximal effect occurring between 10 and 100 nM (Fig. 4). Moreover, the effect of aldosterone (100 nM) on renin mRNA was blunted by spironolactone (10 µM), which is considered as a specific blocker of aldosterone receptors (Fig. 5). To test for the steroid specificity of the effect on renin gene expression, we also examined the effects of other steroid hormones such as cortisone, corticosterone, hydrocortisone, estradiol, and testosterone on renin mRNA. As shown in Fig. 6A, cortisone (100 nM), corticosterone (100 nM), and hydrocortisone (100 nM) steroid hormones mimicked the effect of aldosterone, whereas estradiol (100 nM) and testosterone (100 nM) had no effect on renin mRNA. The combination of aldosterone (100 nM) and cortiocosterone (100 nM) and also the combination of aldosterone (100 nM) and hydrocortisone (100 nM) had no additional effect on renin mRNA expression as aldosterone (100 nM), corticosterone (100 nM), and hydrocortisone (100 nM) alone (Fig. 6B).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Renin mRNA levels in As4.1 cells incubated with 100 nM aldosterone or without (controls) for 2, 4, 8, 16, and 24 h. Data are given as the ratio of renin mRNA to {beta}-actin mRNA hybridization signals obtained from the same sample of total RNA. Values are means ± SE of 5 independent measurements. *P < 0.05 of the stimulated probe to the control at the same time point. cpm, Counts per minute.

 


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4. Effect of different concentrations (1 nM-1 µM) of aldosterone on renin mRNA. The As4.1 cells were incubated for 24 h with aldosterone in increasing amounts or without (control). Data are given as the ratio of renin mRNA to {beta}-actin mRNA hybridization signals obtained from the same sample of total RNA. Values are means ± SE of 6 independent measurements. Top: typical autoradiography. *P < 0.05 vs. control.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. Effect 100 nM aldosterone and the combination of 100 nM aldosterone with 10 µM spironolactone on renin mRNA after 24-h incubation. Data are given as the ratio of renin mRNA to {beta}-actin mRNA hybridization signals obtained from the same sample of total RNA. Values are means ± SE of 6 independent measurements. *P < 0.05.

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 6. A: effect of 100 nM aldosterone, 100 nM testosterone, 100 nM estradiol, 100 nM cortisone, 100 nM corticosterone, and 100 nM hydrocortisone on renin mRNA after 24-h incubation. B: effect of 100 nM aldosterone, 100 nM corticosterone, and 100 nM hydrocortisone and the combination of 100 nM aldosterone + 100 nM corticosterone and 100 nM aldosterone + 100 nM hydrocortisone on renin mRNA after 24-h incubation. Data are given as the ratio of renin mRNA to {beta}-actin mRNA hybridization signals obtained from the same sample of total RNA. Values are means ± SE of 5 independent measurements. *P < 0.05 vs. control.

 

Mechanism of action of aldosterone on renin gene expression. An increase in renin mRNA levels by aldosterone may result from increased stability of renin mRNA or increased transcription of the renin gene. A possible effect of aldosterone on renin gene transcription was assessed by transient transfection of As.4.1 cells with renin promoter-luciferase gene constructs. However, aldosterone did not change the activity of either a 4.2-kb or of a 2.8-kb renin promoter fragment (Fig. 7). To assess a possible effect of aldosterone on renin mRNA stability, we determined the decline rate of renin mRNA after general inhibition of transcription by actinomycin D (actD; 5 µM). Cells were incubated with or without aldosterone for 24 h before addition of actD, and renin mRNA abundance was semiquantitated 2, 4, 8, and 12 h after addition of the transcription inhibitor. As shown in Fig. 8, renin mRNA declined more slowly after addition of actD in the presence than in the absence of aldosterone. The calculated half-life period of the renin mRNA was ~10 h in the absence and ~38 h in the presence of aldosterone.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7. Effects of 100 nM aldosterone (aldo) on renin promoter activity. As4.1 cells were transfected with a 4.2- and 2.8-kb fragment of the mouse Ren1C promoter, and luciferase activity was measured after 30-h aldosterone treatment. Luciferase activity is given as ratio of luciferase (luc) activity to Renilla (ren) activity. Values are means ± SE of 4 independent measurements.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 8. Effects of 100 nM aldosterone on renin mRNA stability in As4.1 cells. As4.1 cells were incubated with 5 µM actinomycin D (act D) for 2, 4, 8, and 12 h in the presence and absence of 100 nM aldosterone and the decline rate of the renin mRNA was determined. Values are means ± SE of 6 independent measurements. The best-fit straight line is shown.

 

Interaction between aldosterone and the cAMP pathway. Because the cAMP signaling pathway is the yet best-known stimulatory pathway in the control of renin gene expression, we further investigated a possible involvement of cAMP in the action of aldosterone. For this purpose, the effects of aldosterone were also examined in As4.1 cells in the presence of forskolin, a strong direct activator of adenylate cyclase, in combination with the potent nonselective cAMP-phosphodiesterase inhibitor IBMX. The combination of forskolin with IBMX clearly stimulated prorenin secretion (as a measure for renin preprorenin synthesis), renin mRNA levels, and renin promoter activity (Fig. 9). Aldosterone further enhanced the increase in prorenin secretion and renin mRNA abundance but did not enhance renin promoter activity (Fig. 9). Aldosterone had no influence on the cAMP level in As4.1 cells, whereas forskolin/IBMX increased the cAMP level ~500 times (Fig. 9).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 9. Effects on renin gene transcription, renin secretion, renin promoter activity, and the cAMP level by aldosterone in combination with forskolin (for)/IBMX. A: renin mRNA levels in As4.1 cells incubated with 5 µM forskolin/100 µM IBMX, 100 nM aldosterone, or both in combination for 24 h. Data are given as the ratio of renin mRNA to {beta}-actin mRNA hybridization signals obtained from the same sample of total RNA. B: total renin secretion from As4.1 cells incubated with 5 µM forskolin/100 µM IBMX, 100 nM aldosterone, or both in combination for 30 h. C: As4.1 cells were transfected with a 4.2-kb fragment of the mouse Ren1C promoter, and luciferase activity was measured after 30-h incubation with 5 µM forskolin/100 µM IBMX, 100 nM aldosterone, or the combination of both. D: cAMP levels in As4.1 cells incubated with 5 µM forskolin/100 µM IBMX, 100 nM aldosterone, or both in combination for 24 h. Values are means ± SE of 6 independent measurements. *P < 0.05.

 

Effect of aldosterone on renin secretion from isolated, perfused kidneys. In view of the clear effects of aldosterone on renin gene expression and the lack of long-term effect on the exocytosis of renin in cultured JG cells, we wondered whether aldosterone might act on renin secretion through rapid nongenomic effects. For these experiments, we used the model of the isolated, perfused rat kidney, which is a suitable model to study rapid regulatory events in the control of renin secretion. As shown in Fig. 10, however, aldosterone neither changed basal renin secretion nor influenced the stimulation of renin secretion by the {beta}-adrenoreceptor agonist isoproterenol.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 10. Effects of aldosterone (100 pM, 10 nM, and 1 µM) on the renin secretion rate in the isolated, perfused rat kidney. The kidney was perfused with aldosterone alone (A) or in combination with 10 nM isoproterenol (B).

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Our study aimed to characterize the direct effects of aldosterone on renin gene expression and renin secretion in renal JG cells. The data obtained suggest that aldosterone in fact exerts a direct effect by increasing steady-state renin mRNA levels without affecting the exocytotic events underlying the secretion of active renin from JG cells. Because JG cells apparently express mineralocorticoid receptors and the 11-{beta}-hydroxysteroid dehydrogenase 2, and because the effect of aldosterone on renin mRNA was blunted by spironolactone and was selectively mimicked by other mineralocorticoid steroids, we assume that the effect of aldosterone was mediated through the mineralocorticoid receptor. The delayed onset of the effect argues in favor of a genomic effect. This special time course fits well with other aldosterone-induced long-term effects mediated by the mineralocorticoid receptor, like the effect on Na+/H+ exchange in vascular smooth muscle cells (4).

Our data suggest that the increase in renin mRNA induced by aldosterone is due to a stabilization of renin mRNA rather than to a stimulation of renin gene transcription. Thus aldosterone failed to stimulate 4.2- and 2.8-kb fragments of the renin gene promoter. For comparison, activation of the cAMP pathway increased both renin mRNA levels and renin promoter activity, which is in good accordance with previous results (9, 10). Aldosterone, moreover, further enhanced the increase in renin mRNA levels induced by cAMP, without further affecting renin promoter activity. From our data, we cannot definitively exclude that further upstream regulatory elements in the renin promoter could mediate a transcriptional effect of aldosterone. Because now, however, no regulatory elements of the mouse Ren1C promoter upstream of 4.2 kb have yet been described (1).

On the other hand, we observed a clear attenuation of the decay of renin mRNA in the presence of aldosterone. The prolongation of the estimated renin mRNA half-life time by a factor of three fits well with the approximately threefold increase steady-state renin mRNA levels by aldosterone. It is already well known that steroid hormone can lead to a stabilization of specific mRNAs (17). Most evidence in this context has been obtained for sex steroids (7, 12). However, accumulating evidence also indicates that glucocorticoids and mineralocorticoids can cause stabilization of mRNAs (17). Thus glucocorticoid hormones have been reported to enhance, for example, the stability of growth hormone mRNA (15) and to decrease the mRNA stability of the corticotropin-releasing hormone (14). Aldosterone has been shown to upregulate cyclooxygenase-1 in neuroblastoma cell lines by stabilizing the mRNA (18). The molecular pathways along which aldosterone stabilizes mRNAs are yet unknown and should be unravelled in future experiments.

Interestingly, stabilization of renin mRNA has previously been considered also as a mechanism by which the cAMP-signaling pathway stimulates renin gene expression (2, 12, 21), which is the most prominent stimulator of renin gene expression (11). From our data, we would exclude that the action of aldosterone on renin gene expression essentially involves the cAMP pathway, because aldosterone was effective even under conditions in which the cAMP pathway was presumably maximally activated, such as by the combination of direct adenylate cyclase stimulation by forskolin with general inhibition of cAMP degradation by IBMX (9). Also the cAMP level in As4.1 cells was neither increased by aldosterone above the cAMP level of the control nor by aldosterone in combination with forskolin/IBMX above the cAMP level induced by forskolin/IBMX alone. Although it cannot be excluded that renin gene expression is regulated at the level of gene transcription by regulatory elements upstream of the 4.2-kb renin promoter fragment, it appears likely to assume that aldosterone induces the transcription of a factor or enzyme that stabilizes renin mRNA.

These in vitro findings raise the question about their physiological relevance. The data obtained with As4.1 cells suggest that the increase in renin mRNA induced by aldosterone is also translated into renin protein. Because aldosterone was also active in primary cultures of mouse JG cells, which express the mineralocorticoid receptor, we speculate that aldosterone also acts on renin gene expression in JG cells in situ. Aldosterone has been found to work in cell cultures compared with physiological conditions often only in higher concentrations (5). Therefore, we may assume that the aldosterone effect found on renin gene expression also works in JG cells in situ at physiological concentrations of aldosterone. The data obtained with the isolated, perfused kidney confirmed the data obtained with primary cultures of JG cells with regard to renin secretion. Unfortunately, the isolated, perfused kidney model is not a suitable model in which to study the regulation of renin gene expression, because of the limited life span of the isolated, perfused kidney in front of the slow regulation of renin mRNA levels (19). Similarly, interference with systemic aldosterone activity in vivo makes it difficult to unravel a direct effect of aldosterone on renin gene expression, because mineralocorticoids also indirectly and potently influence the renin system via changes of the body sodium content, extracellular volume, and blood pressure (6). A clearer answer should be expected in the future from a constitutive genetic deletion of the mineralocorticoid receptor in renal JG cells in vivo.

Nonetheless, we may already speculate about the physiological meaning of a stabilization of renin mRNA by aldosterone in vivo. As illustrated in Fig. 11, renin gene expression is inhibited by the RAAS via several negative feedback loops. These involve a direct negative effect of ANG II on renin gene transcription as well as indirect negative effects of sodium content, extracellular volume, and blood pressure on renin gene expression. A stabilization of renin mRNA by a direct effect of aldosterone on JG cells may contribute to buffer the sum of the inhibitory events as outlined above. In any case, the effect of aldosterone on renin gene expression would be secondary to the action of regulators of renin gene transcription and thereby ameliorate the effects of inhibitors and enhance the effects of stimulators as already observed in this study.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 11. Diagram showing the action of aldosterone on renin gene expression.

 


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was financially supported by a grant from the Deutsche Forschungsgemeinschaft (Ku859/2-4).


    ACKNOWLEDGMENTS
 
We thank M. Hamann and K.-H. Götz for excellent technical assistance with the isolated, perfused kidney.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. Klar, Institut für Physiologie, Universität Regensburg, D-93040 Regensburg, Germany (E-mail: juergen.klar{at}vkl.uni-regensburg.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bader M and Ganten D. Regulation of renin: new evidence from cultured cells and genetically modified mice. J Mol Med 78: 130-139, 2000.[CrossRef][Web of Science][Medline]
  2. Chen M, Schnermann J, Smart AM, Brosius FC, Killen PD, and Briggs JP. Cyclic AMP selectively increases renin mRNA stability in cultured juxtaglomerular granular cells. J Biol Chem 268: 24138-24144, 1993.[Abstract/Free Full Text]
  3. Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987.[Web of Science][Medline]
  4. Ebata S, Muto S, Okada K, Nemoto J, Amemiya M, Saito T, and Asano Y. Aldosterone acitvates Na+/H+ exchange in vascular smooth muscle cells by nongenomic and genomic mechanisms. Kidney Int 56: 1400-1412, 1999.[CrossRef][Web of Science][Medline]
  5. Gumz MJ, Popp MP, Wingo CS, and Cain BD. Early transcriptional effects of aldosterone in a mouse inner medullary collection duct cell line. Am J Physiol Renal Physiol 285: F664-F673, 2003.[Abstract/Free Full Text]
  6. Hackenthal E, Paul M, Ganten D, and Taugner R. Morphology, physiology, and molecular biology of renin secretion. Physiol Rev 70: 1067-1116, 1990.[Free Full Text]
  7. Hart LL and Davie JR. The estrogen receptor: more than the average transcription factor. Biochem Cell Biol 80: 335-341, 2002.[CrossRef][Web of Science][Medline]
  8. Jones CA, Petrovic N, Novak EK, Swank RT, Sigmund CD, and Gross KW. Biosynthesis of renin in mouse kidney tumor As4.1 cells. Eur J Biochem 243: 181-190, 1997.[Web of Science][Medline]
  9. Klar J, Sandner P, Müller MWH, and Kurtz A. CAMP increases renin gene transcription in juxtaglomerular cells. Pflügers Arch 444: 335-344, 2002.[CrossRef][Web of Science][Medline]
  10. Kurtz A and della Bruna RD. Determinants of renin secretion and renin synthesis in isolated mouse juxtaglomerular cells. Kidney Int Suppl 32: S13-S15, 1991.[Medline]
  11. Kurtz A and Wagner C. Cellular control of renin secretion. J Exp Biol 202: 219-255, 1999.[Abstract]
  12. Lan L, Vinci JM, Melendez JA, Jeffrey JJ, and Wilcox BD. Progesterone mediates decreases in uterine smooth muscle cell interleukin-1{alpha} by a mechanism involving decreased stability of IL-1{alpha} mRNA. Mol Cell Endocrinol 155: 123-133, 1999.[CrossRef][Web of Science][Medline]
  13. Lang JA, Ying LH, Morris BJ, and Sigmund CD. Transcriptional and posttranscriptional mechanisms regulate human renin gene expression in Calu-6 cells. Am J Physiol Renal Fluid Electrolyte Physiol 271: F94-F100, 1996.[Abstract/Free Full Text]
  14. Ma XM, Camacho C, and Aguilera G. Regulation of corticotropin-releasing hormone (CRH) transcription and CRH mRNA stability by glucocorticoids. Cell Mol Neurobiol 21: 465-475, 2001.[CrossRef][Web of Science][Medline]
  15. Paek I and Axel R. Glucocorticoids enhance stability of human growth hormone mRNA. Mol Cell Biol 7: 1496-1507, 1987.[Abstract/Free Full Text]
  16. Pan L, Black TA, Shi Q, Jones CA, Petrovic N, Loudon J, Kane C, Sigmund CD, and Gross KW. Critical roles of a cyclic AMP responsive element and an E-box in regulation of mouse renin gene expression. J Biol Chem 276: 45530-45538, 2001.[Abstract/Free Full Text]
  17. Pascall JC. Post-transcriptional regulation of gene expression by androgens: recent observations from the epidermal growth factor gene. J Mol Endocrinol 18: 177-180, 1997.[Abstract/Free Full Text]
  18. Schneider N, Lanz S, Ramer R, Schaefer D, and Goppelt-Struebe M. Up-regulation of cyclooxygenase-1 in neuroblastoma cell lines by retinoic acid and corticosteroids. J Neurochem 77: 416-424, 2001.[CrossRef][Web of Science][Medline]
  19. Scholz H and Kurtz A. Disparate effects of calcium channel blockers on pressure dependence of renin secretion and flow in the isolated perfused rat kidney. Pflügers Arch 421: 155-162, 1992.[CrossRef][Web of Science][Medline]
  20. Sigmund CD, Okuyama K, Ingelfinger J, Jones CA, Mullins JJ, Kane C, Kim U, Wu CZ, Kenny L, Rustum Y, Dzau VJ, and Gross KW. Isolation and characterization of renin-expressing cell lines from transgenic mice containing a renin-promoter viral oncogene fusion. J Biol Chem 265: 19916-19922, 1990.[Abstract/Free Full Text]
  21. Sinn PL and Sigmund CD. Human renin mRNA stability is increased in response to cAMP in Calu-6 cells. Hypertension 33: 900-905, 1999.[Abstract/Free Full Text]
  22. Vitzthum H, Abt I, Einhellig S, and Kurtz A. Gene expression of prostanoid forming enzymes along the rat nephron. Kidney Int 62: 1570-1581, 2002.[CrossRef][Web of Science][Medline]
  23. Wagner C, Jensen BL, Kramer BK, and Kurtz A. Control of the renal renin system by local factors. Kidney Int Suppl 67: S78-S83, 1998.[Medline]



This article has been cited by other articles:


Home page
HypertensionHome page
I. Kuipers, P. van der Harst, G. Navis, L. van Genne, F. Morello, W. H. van Gilst, D. J. van Veldhuisen, and R. A. de Boer
Nuclear Hormone Receptors as Regulators of the Renin-Angiotensin-Aldosterone System
Hypertension, June 1, 2008; 51(6): 1442 - 1448.
[Full Text] [PDF]


Home page
HypertensionHome page
Y. Yu, S.-G. Wei, Z.-H. Zhang, E. Gomez-Sanchez, R. M. Weiss, and R. B. Felder
Does Aldosterone Upregulate the Brain Renin-Angiotensin System in Rats With Heart Failure?
Hypertension, March 1, 2008; 51(3): 727 - 733.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Z.-H. Zhang, Y. Yu, Y.-M. Kang, S.-G. Wei, and R. B. Felder
Aldosterone acts centrally to increase brain renin-angiotensin system activity and oxidative stress in normal rats
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H1067 - H1074.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
V. T. Todorov, M. Desch, N. Schmitt-Nilson, A. Todorova, and A. Kurtz
Peroxisome Proliferator-Activated Receptor-{gamma} Is Involved in the Control of Renin Gene Expression
Hypertension, November 1, 2007; 50(5): 939 - 944.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Hautmann, U. G. Friis, M. Desch, V. Todorov, H. Castrop, F. Segerer, C. Otto, G. Schutz, and F. Schweda
Pituitary Adenylate Cyclase-Activating Polypeptide Stimulates Renin Secretion via Activation of PAC1 Receptors
J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1150 - 1156.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. Grunberger, B. Obermayer, J. Klar, A. Kurtz, and F. Schweda
The Calcium Paradoxon of Renin Release: Calcium Suppresses Renin Exocytosis by Inhibition of Calcium-Dependent Adenylate Cyclases AC5 and AC6
Circ. Res., November 24, 2006; 99(11): 1197 - 1206.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. Makhanova, G. Lee, N. Takahashi, M. L. Sequeira Lopez, R. A. Gomez, H.-S. Kim, and O. Smithies
Kidney function in mice lacking aldosterone
Am J Physiol Renal Physiol, January 1, 2006; 290(1): F61 - F69.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Klar, M. Sigl, B. Obermayer, F. Schweda, B. K. Kramer, and A. Kurtz
Calcium Inhibits Renin Gene Expression by Transcriptional and Posttranscriptional Mechanisms
Hypertension, December 1, 2005; 46(6): 1340 - 1346.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. M. Perez-Rojas, S. Derive, J. A. Blanco, C. Cruz, L. M. de la Maza, G. Gamba, and N. A. Bobadilla
Renocortical mRNA expression of vasoactive factors during spironolactone protective effect in chronic cyclosporine nephrotoxicity
Am J Physiol Renal Physiol, November 1, 2005; 289(5): F1020 - F1030.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. C. Prieto-Carrasquero, H. Kobori, Y. Ozawa, A. Gutierrez, D. Seth, and L. G. Navar
AT1 receptor-mediated enhancement of collecting duct renin in angiotensin II-dependent hypertensive rats
Am J Physiol Renal Physiol, September 1, 2005; 289(3): F632 - F637.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/2/F349    most recent
00411.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klar, J.
Right arrow Articles by Kurtz, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klar, J.
Right arrow Articles by Kurtz, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.