AJP - Renal Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 286: F564-F571, 2004. First published November 11, 2003; doi:10.1152/ajprenal.00257.2003
0363-6127/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/3/F564    most recent
00257.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kneuer, C.
Right arrow Articles by Honscha, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kneuer, C.
Right arrow Articles by Honscha, W.

Sodium-dependent methotrexate carrier-1 is expressed in rat kidney: cloning and functional characterization

Carsten Kneuer,1,* Kerstin U. Honscha,2,* and Walther Honscha1

1Institute of Veterinary Pharmacology, Pharmacy and Toxicology, and 2Institute of Veterinary Physiology, Faculty of Veterinary Medicine, University of Leipzig, 04103 Leipzig, Germany

Submitted 18 July 2003 ; accepted in final form 8 November 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Previous Northern blot studies suggested strong expression of a homolog to the sodium-dependent hepatocellular methotrexate transporter in the kidneys. Here, we report on the cloning of the cDNA for the renal methotrexate carrier isoform-1 (RK-MTX-1) and its functional characterization. Sequencing revealed 97% homology to the rat liver methotrexate carrier with an identical open reading frame. Differences were located in the 5'-untranslated region and resulted in the absence of putative regulatory elements (Barbie box, Ah/ARNT receptor) identified in the cDNA for the hepatocellular carrier. For functional characterization, MTX-1 cDNA was stably expressed in Madin-Darby canine kidney (MDCK) cells. A sodium-dependent transport of methotrexate with a Km of 41 µM and a Vmax of 337 pmol·mg protein-1·min-1 was observed. This uptake was blocked by the reduced folates dihydro- and tetrahydrofolate as well as by methotrexate itself. Folate was inhibiting only weakly, whereas 5-methyltetrahydrofolate was a strong inhibitor. Further inhibitors of the methotrexate transport included the bile acids cholate and taurocholate and xenobiotics like bumetanide and BSP. PAH, ouabain, bumetanide, cholate, taurocholate, and acetyl salicylic acid were tested as potential substrates. However, none of these substances was transported by MTX-1. Furthermore, expression of RK-MTX-1 in MDCK cells enhanced methotrexate toxicity in these cells fivefold. Analysis of a fusion protein of RK-MTX-1 and the influenza virus hemagglutinin epitope by immunoblotting revealed a major band at 72 kDa within the cell membrane but not in the soluble fraction of transfected MDCK. Indirect immunofluorescence staining revealed an exclusive localization of the carrier in the plasma membrane, and by confocal laser-scanning microscopy we were able to demonstrate that the protein is expressed in the serosal region of MDCK tubules grown in a morphogenic collagen gel model.

renal organic anion transporter; drug elimination; nephrotoxicity


AMONG THE VARIOUS DRUGS in use for the treatment of malignancies, the group of antimetabolites is of significant practical relevance. The antifolate methotrexate (Mtx) is also successfully used in various nononcological indications like rheumatoid arthritis and psoriasis (6, 8, 19, 23, 33). However, chemotherapy with Mtx is confronted with adverse effects such as bone marrow suppression, hepatotoxicity, as well as acute and long-term nephrotoxicity. Especially, the interest in chemotherapy-induced nephrotoxicity has grown, because an increasing number of individuals with curable cancer are potentially at risk for long-term renal sequelae (21). Furthermore, it has been reported that the concentration of Mtx in the kidney is 80-fold higher than in the liver and 28-fold higher than in the bone marrow under high-dose Mtx therapy (18). Taken together, this may suggest the involvement of active Mtx transport in the kidney.

Previously, two different classes of Mtx transporting carriers were identified in normal tissue from rat liver and kidney: one group of currently four families of sodium-independent proteins including organic anion transporter (OAT) kidney 1/2 (OAT-K1/OAT-K2), reduced folate carrier (rfc), the ABC pump mrp2, and the sodium-dependent rat liver Mtx transporter-1 (RL-MTX-1).

Sekine et al. (34) and Sweet et al. (39) independently cloned the first member of the sodium-independent OAT family (OAT1) from rat kidney. Its mRNA is translated into a protein of 551 amino acids with a calculated molecular weight of 60.7 kDa. OAT1 was demonstrated to transport PAH, cAMP, cGMP, PGE2, urate, {alpha}-ketoglutarate, and Mtx across the serosal membrane. Other family members that can interact with Mtx to different extents have been described since and include OAT2 (37), OAT3 (25), and OAT4 (3). All these transporters are expressed in the kidneys and other tissues including liver and placenta in a gender- and subtype-dependent manner (2, 3). The second family of sodium-independent Mtx facilitators is represented by OAT-K1 and -2, cloned by Saito et al. (31) and Masuda et al. (26). Both proteins are located in the apical (luminal) membrane of proximal tubule epithelial cells and mediate the exchange of folate and Mtx (26, 27, 31).

Moreover, it is well known that the rfcs are also able to facilitate the influx of Mtx. In humans, rfc1 mRNA expression has been reported in liver, placenta, and to a lesser extent in the kidneys, leucocytes, lung, and other tissues (44). A highly homologous transporter has also been reported in mouse (43) and hamster (45). The rfc-mediated Mtx uptake has been described as sodium independent but sensitive to pH, folates, and reduced folates.

Finally, the multidrug-resistance-related protein 2 (MRP2) is known to be involved in the active transport of Mtx (1). MRP2 expression in the kidneys has been reported for various species, where it localizes on the luminal membrane of tubule epithelial cells (32) to mediate ATP-driven export of unconjugated Mtx into the proximal tubule.

Recently, we demonstrated the existence of a sodium-dependent Mtx transport system in rat liver (14). In freshly isolated hepatocytes, this pathway dominates Mtx uptake to 90% and can be inhibited by reduced folates, bile acids, xenobiotics like ochratoxin A and bumetanide, but not by folate. Cloning of the cDNA for the carrier involved in this sodium-dependent process revealed two transcripts corresponding to rat liver Mtx carrier 1 and 2 (RL-MTX-1/2). RL-MTX-1 and -2 transported Mtx in a sodium-dependent manner by expression in Xenopus laevis oocytes (13). Northern blot analysis further suggested that a homologous mRNA was strongly expressed in the kidneys. We, therefore, now cloned and sequenced this isoform and characterized its substrate spectrum in a suitable mammalian expression system. In addition, we aimed to confirm the localization of the protein within the cell membrane and to collect information about potential involvement of the transporter in kidney toxicity of the drug.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Preparation of mRNA. Total RNA was prepared from frozen rat kidney according to the method of Chomczynski and Sacchi (5) where mRNA was isolated from total RNA with a Qiagen Oligotex mRNA kit (Qiagen, Hilden, Germany).

cDNA synthesis and rapid amplification of cDNA ends-PCR. First- and second-strand cDNA synthesis and the ligation of the adaptors were performed using a Marathon cDNA amplification kit (Clontech, Heidelberg, Germany) according to the manufacturer's instructions and as previously described (23). In brief, the first-strand cDNA synthesis was started with 1 µg poly A+-RNA and 10 pmol of the cDNA synthesis primer for 60 min at 42°C. Second-strand cDNA synthesis was performed at 16°C for 90 min using dNTPs, a mixture of Escherichia coli DNA polymerase I, E. coli DNA ligase, and E. coli RNAse H. Efficiency and yield were estimated by agarose gel electrophoresis and autoradiography. One-half of the product was ligated to 20 pmol Marathon cDNA adaptor using T4 DNA ligase (1 unit) at 16°C overnight.

The following gene-specific primers were used for amplification of the 5'- and 3'-rapid amplification of cDNA ends (RACE) products for the Mtx carrier: 5'-RACE, Mtx-2350: GACAACCATACAAACAAGCACCTC; 3'-RACE, Mtx-371: GCG(AGT)CCTGGGGA(AG)AGCTTCATCA.

For RACE-PCR, a master mix of PCR-buffer, dNTPs, and Taq Start antibody/polymerase (Expand high-fidelity polymerase, Boehringer, Mannheim, Germany) was prepared and added to 5 µl of diluted cDNA together with 10-20 pmol of the gene-specific primer and 10 pmol of the adaptor primer. For the final 3'-RACE-PCRs, the following protocol was used: 30 s 94°C, 5 cycles with 94°C (5 s), 70°C (30 s), 69°C (240 s), 10 cycles with an annealing temperature of 68°C, and 20 cycles with an annealing temperature of 66°C. The 5'-RACE-PCR was performed as follows: 30 s 94°C, 5 cycles with 94°C (5 s), 65°C (30 s), 69°C (240 s), 10 cycles with an annealing temperature of 63°C, and 20 cycles with an annealing temperature of 61°C. In both cases, a final elongation step over 7 min was added. Both final RACE products were cloned into the pCR 3.1 vector.

Sequencing. Different clones of the various RACE products were isolated and sequenced using the dye terminator cycle sequencing method on an ABI Prism (Applied Biosystems, Perkin Elmer, Weiterstadt, Germany). The final full-length cDNA clones (pRK-MTX-1) were generated by elimination of the overlapping DNA fragments through subcloning, and two resulting cDNA clones were sequenced. For generation of stably transfected cells, the RK-MTX-1 cDNA was subcloned into the pIRESneo vector (pIRES-MTX-1).

Tagging of RK-MTX-1 with the influenza virus hemagglutinin epitope. The TAG stop codon at position 1630 of the cDNA for RK-MTX-1 was replaced by PCR-directed mutagenesis using pRKMTX-1 as template and a reverse primer that contained a 5'-overhang coding for the hemagglutinin (HA) epitope followed by a new stop codon: 5'-t gag agt cga agc caa ggc cta cca tac gat gtt cca gat tac gct tag-3' in combination with the T7 primer binding upstream in pRKMTX-1. The PCR product was ligated into pCR4-TOPO-TA (Invitrogen, Karlsruhe, Germany), and the fusion construct was excised by EcoRI digestion and cloned into pCR3.1 to yield pRK-MTX1630HA.

Cell culture and transfection. Madin-Darby canine kidney (MDCK) cells were grown in DMEM medium (GIBCO-BRL, Eggenstein, Germany) supplemented with 10% FCS under 10% carbon dioxide atmosphere at 37°C. Three-dimensional branching tubule structures were obtained by morphogenic culture of MDCK cells (seeding density 106/ml) in a 0.2% type I collagen gel for 14 days as described by McAteer et al. (28).

For transfection, 2 x 105 MDCK cells were seeded into six-well plates 24 h before transfection. pIRES-MTX-1 plasmid DNA (2.4 µg), 19.2 µl Enhancer, and 15 µl Effectene (both Qiagen) or pRKMTX1630HA (2 µg) and 20 µg polyethylenimine (Sigma, Deisenhofen, Germany) were mixed and left for 10 min at room temperature. Transfection was carried out overnight, followed by 2-day incubation in growth medium before this was replaced by selection medium containing 200-400 µg/ml G418 (Sigma). Resistant single-cell clones were individually cloned and propagated.

Uptake experiments. The uptake measurements were performed as previously described (15). In brief, cells from two culture flasks (75-cm2 dishes) were collected by trypsinization and resuspended in fresh culture medium. After three washing cycles with Tyrode buffer (137 mM NaCl, 12 mM NaHCO3, 2.7 mM KCl, 1.05 mM MgCl2 * 6 H2O, 1.8 mM CaCl2 * 2 H2O, 5.55 mM glucose, 0.42 mM NaH2PO4, pH 7.4 at 37°C), the cells were equilibrated in the same buffer at 37°C for 10 min in a shaking water bath under carbogen. In general, viability was 95-98% by trypan blue exclusion. After addition of [3H]Mtx (2 x 105 dpm/ml, 9,25 MBq/mmol in 2 µM nonlabeled Mtx; Amersham, Braunschweig, Germany) to 1.2 ml of cell suspension, 100-µl aliquots were removed at different time points (15, 45, 75, 180, 300, 600, and 1,200 s). The cells were separated by immediate centrifugation across a silicone oil gradient and lysed in 4 M KOH overnight. Cell-associated radioactivity was measured by liquid scintillation counting. To determine sodium dependency, the tyrode buffer was substituted for sodium-free choline buffer or sodium-free N-methyl-D-glucamine buffer. For estimation of the Km value, the concentration-dependent uptake of Mtx (2 to 20 µM) was measured in the presence and in the absence of sodium ions. After subtraction of the sodium-independent uptake, the linear range (0, 0.25, 0.75, 1.25, and 3 min) of the sodium-dependent uptake was analyzed by linear regression.

Immunoblotting. Cell lysates were obtained by addition of 1 ml ice-cold lysis buffer (10 mM Tris·HCl, pH 7.5, 1 mM EDTA) supplemented with 1/50 of protease inhibitor cocktail (Sigma) to 107 freshly trypsinized cells, followed by homogenization on ice using an Ultra-Turrax (IKA, Staufen, Germany) at no more than 20,000 rpm. Large organelles were sedimented by centrifugation at 100 g for 5 min, and the membrane fraction was separated from the soluble proteins by ultracentrifugation at 50,000 g for 30 min at 4°C. The protein content of all fractions was determined using the Lowry assay. Aliquots of both fractions were mixed with 2x Laemmli denaturing SDS-PAGE sample buffer heated to 95°C for 5 min, and 40 µg total protein per lane were subjected to a standard Tris-Glycine polyacrylamide gel electrophoresis in 10 and 12% gels. Proteins were transferred onto a Millipore NC membrane by semidry blotting at 0.9 mA/cm2 over 90 min. The membrane was blocked overnight at 4°C with 1% blot-qualified BSA in TBS (20 mM Tris·HCl, pH 7.5, 150 mM NaCl). A rabbit polyclonal anti-HA antiserum (Sigma) was diluted 1:1,000 in TBST (TBS, 0.05% Tween 20) and applied to the membrane for 60 min at RT. After at least three washing steps with TBS, a 3,000-fold diluted anti-rabbit-AP conjugate (Promega, Mannheim, Germany) was added for 60 min followed by another three washing steps. Alkaline phosphatase activity was detected using a freshly prepared mixture of 66 µl NBT- and 33 µl BCIP-substrate (both Promega) in 10 ml AP buffer (100 mM Tris·HCl, pH 9.5, 100 mM NaCl, 5 mM MgCl2).

Immunofluorescence. For indirect immunofluorescent staining, MDCK cells were seeded onto glass coverslips, transfected as described above, and grown to confluency. Alternatively, polarized MDCK tubules were obtained by culture in collagen gel as described above. Fixation was achieved with freshly prepared 2% paraformaldehyde, followed by blocking with 50 mM ammonium chloride and permeabilization with 0.1% Triton X-100. Both rabbit polyclonal anti-HA antiserum and secondary FITC-labeled goat anti rabbit F(ab)2 fragment were obtained from Sigma and used at a dilution of 1:200 in PBS containing 1% BSA. Counterstaining of nuclei was performed where indicated by addition of 1 nM propidium iodide to the secondary antibody solution. Stained samples were embedded in FluorSave (Calbiochem, Bad Soden, Germany) and analyzed by conventional fluorescence microscopy or examined in PBS (collagen gels) using a confocal laser-scanning microscope (Zeiss LSM 410).

Cytotoxicity. The stably transfected cell line MDCK 3B and mock-transfected MDCK 7AP were seeded in 96-well plates at a density of 30,000 cells/cm2 in growth medium. After adhesion overnight, the wells were washed and serial dilutions of Mtx in DMEM were added. Overall cellular activity was determined 72 h later as mitochondrial conversion of WST-1 {4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]1,3-benzene disulfonate; Roche, Mannheim, Germany} into colored formazan.

Sequence analysis. DNASTAR (Lasergene, Madison, WI) was used for the assembly of all sequence data. Homology searches were performed on the server of the National Center for Biotechnology Information (USA) using the BLAST algorithm. Secondary structure analysis and searches for transcription factors were done on the Weizman server (Rehovot, Israel).

Statistical analysis. Transport activities are given as means ± SD of at least triplicate measurements. The significance of the results was determined using Student's t-test. Statistical significance was assumed at P values of <0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Molecular cloning and expression of the full-length RKMTX-1 cDNA. A Marathon cDNA library from rat renal mRNA was constructed and the 5'-RACE and 3'-RACE PCR product were amplified with gene-specific primers deduced from the hepatocellular RL-MTX-1 (13). Both fragments were sequenced and subcloned to yield the final full-length cDNA clone rat kidney (RK)-MTX-1. RK-MTX-1 consists of 2,290 bp with a predicted open reading frame of 1,539 bp from nucleotide 95 to position 1633. The entire sequence shows a 97% homology to the hepatocellular RL-MTX-1 (Fig. 1) with the coding regions being identical. Hence, both mRNAs encode the same protein of 512 amino acids with a putative molecular weight of 58, at least one potential N-glycosylation site at amino acid 58 and 12 predicted membrane-spanning domains. With this characteristic protein structure, the renal Mtx transporter may be classified as one of the family of solute carrier proteins. There was also a similar degree of homology (96%) to the rfc cDNA cloned from rat vascular smooth muscle (NCBI U38180 [GenBank] ).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1. Alignment of the nucleotide sequences (nucleotide 1 to 450) of rat liver and rat kidney methotrexate carrier isoform-1 (RL-MTX-1 and RK-MTX-1, respectively). The coding regions of both cDNA clones are identical (start of translation is identified by an arrow). Differences between the cDNA clones are located in the 5'-untranslated regions. The Barbie box, a putative pheno-barbital-responsive DNA sequence, was identified in the cDNA of the methotrexate carrier in the liver but is disrupted in the renal cDNA. The binding site for the arylhydrocarbon/arylhydrocarbon nuclear translocator (Ah/ARNT; dioxine receptor binding site) is also lost in the renal cDNA.

 

Major differences between the rat liver and RK-MTX-1 mRNA sequence were found in the 5'-UTR. It is interesting to note that the arylhydrocarbon receptor/arylhydrocarbon receptor nuclear translocator binding site and the so-called Barbie box (barbiturate-responsive DNA element) present in the cDNA of the hepatocellular carrier are absent in RK-MTX-1.

Currently, there is no antiserum available that is suitable for the specific detection of RK-MTX-1 protein by immunological techniques. We therefore generated a cell line that stably expresses the fusion construct RK-MTX1630HA consisting of the entire open reading frame of RK-MTX-1 fused with the influenza virus HA epitope at its COOH terminus (MDCK 2-19). Cell lysates as well as fractions representing the membrane-bound proteins and the soluble proteins were subjected to SDS-PAGE followed by Western blotting. Staining with an anti-HA antibody revealed a single band at an apparent molecular weight of 72 in the whole cell lysates as well as the membrane fractions but not the soluble fractions (Fig. 2A). The band at 72 kDa was comparably broad and migrated ~14 kDa higher than predicted from the cDNA sequence. Immunofluorescence studies were initiated to further confine the compartment to which the protein localizes. As shown in Fig. 2B, the staining was restricted to the plasma membrane region. No significant fluorescence activity could be observed within the cells, suggesting an exclusive localization of the protein near or within the outer cell membrane. To collect evidence about the polarization of MTX-1 expression, stably transfected MDCK cells were grown into three-dimensional tubules using a morphogenic model with correct sorting of apical proteins to the luminal and basolateral proteins to the serosal/outer side (28). Staining of the COOH-terminal HA-tag resulted in a positive fluorescence signal at the outer surface and the intercellular face, while the luminal membrane was clearly negative. This strongly suggests a basolateral localization of MTX-1.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 2. A-C: determination of cellular distribution and molecular weight of RK-MTX-1 by immunoblotting and immunofluorescence. A: membrane-bound and soluble fractions were prepared from Madin-Darby canine kidney (MDCK) cells transiently or stably transfected with pRK-MTX1630HA coding for a fusion protein of RK-MTX-1 and the influenza virus hemagglutinin (HA) epitope. SDS-PAGE of 40 µg total protein per lane followed by Western blotting using a polyclonal anti-HA antiserum and an anti-rabbit AP conjugate revealed a band with an apparent molecular weight of 72. Lane 1: transiently transfected MDCK; lanes 2-4: stably transfected MDCK; lane 2: membrane fraction; lane 3: whole lysate; lane 4: soluble fraction; lane 5: untransfected MDCK. B: MDCK cells transiently transfected with HA-tagged MTX-1 were stained by indirect immunofluorescence against the HA epitope. Fluorescence microscopy revealed a strong and well-focused signal along the plasma membrane. Surrounding untransfected cells did not stain. C: MDCK cells stably transfected with HA-tagged MTX-1 were cultured for 14 days in a collagen gel to form multicellular tubule-like structures. Staining with anti-HA antiserum (green) revealed the protein at the serosal (basal) and lateral but not the luminal (apical) side. Nuclei were counterstained with propidium iodide (red).

 

Functional characterization. So far, the activity of MTX-1 has only been characterized in X. laevis oocytes using rat liver cDNA for heterologous expression. MDCK cells provide a suitable mammalian model for transport studies as they can be grown into confluent polarized monolayers that maintain a differentiated phenotype and express only low levels of interfering transport activity (14). A cell line stably expressing RK-MTX-1 (MDCK 3B) as well as a mock-transfected clone (MDCK 7AP) were generated. [3H]Mtx (5 µM) was actively taken up in MDCK 3B as shown Fig. 3A but not in MDCK 7AP or untransfected MDCK cells. This uptake was sodium dependent. Figure 3B shows the corresponding Lineweaver-Burk plot. The Km was determined at 41 ± 13 µM and the Vmax was 337 ± 79 pmol·mg-1·min-1. This uptake activity is likely to increase the susceptibility to Mtx toxicity. In fact, a significant difference was observed in dose-response between functionally expressing MDCK 3B and mock-transfected MDCK 7AP cells (Fig. 4). The corresponding LD50 values differed fivefold (16 vs. 80 nM).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Sodium-dependent uptake of [3H]Mtx into MDCK-RK-MTX-1 cells and in the parental cell line. A: MDCK cells were stably transfected with RK-MTX-1, and the uptake of 5 µM [3H]Mtx into the cells compared with the nontransfected MDCK cells was measured as described in MATERIALS AND METHODS. The sodium dependency of the uptake was estimated by washing and measuring the cells in sodium-free choline or N-methyl-D-glucamin buffer. B: Lineweaver-Burk plot with initial vi values calculated from the period of the linear uptake into MDCK-RK-MTX-1 cells (0, 0.25, 0.75, 1.25, 3 min) at Mtx concentrations of 2, 5, 10, and 20 µM. Data are means ± SD of 6 independent experiments.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. Increased sensitivity to Mtx toxicity as a result of RK-MTX-1 expression. The stably transfected cell line MDCK 3B and mock-transfected MDCK 7AP were seeded in 96-well plates at a density of 30,000 cells/cm2 in growth medium. After adhesion overnight, the wells were washed and serial dilutions of Mtx in DMEM were added. Cell viability was determined 72 h later as mitochondrial metabolism of WST-1 (Roche).

 

In a previous report, we showed that the uptake of Mtx into hepatocytes is inhibited by various substances (14). However, due to the presence of further transport proteins, it remained unclear whether this activity was mediated via MTX-1. Figure 5 depicts the inhibitory potential of various of these substances in the RK-MTX-1-expressing cell line MDCK 3B. The most prominent effects were observed with Mtx (>100 µM) and 5-methyltetrahydrofolate (>50 µM). The IC50 value of 5-methyltetrahydrofolate was estimated to be 44 µM by regression analysis of the inhibition at various concentrations of the inhibitor. Dihydrofolate (FH2) and tetrahydrofolate (FH4) inhibited the Mtx transport by 40.92 and 33.38% at concentrations of 200 and 100 µM, respectively. Folate inhibited the transport of Mtx only at very high concentrations, and PAH was only a weak inhibitor of RK-MTX-1 at concentrations up to 200 µM. Taurocholate, cholate, bromosulfophthalein (BSP), and ouabain showed an intermediate inhibitory effect.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 5. Inhibition of [3H]Mtx uptake (5 µM) into MDCK-RK-MTX-1 cells by different substances. The uptake of 5 µM [3H]Mtx was measured in the presence of the indicated concentration of the inhibitor. For these inhibition studies, the cells were preincubated for 60 s with the inhibitor before the addition of the radiolabeled Mtx. The potency of inhibition for the individual compounds was estimated compared with the control uptake (without a competitor). Each value represents the data of at least 3 independent experiments. FH2, dihydrofolate; FH4, tetrahydrofolate; BSP, bromosulfophthalein; TC, taurocholate; C, cholate; ASS, acetyl salicylic acid.

 

We further tested whether the carrier is able to mediate the transport of other substrates like taurocholate, cholate, acetylsalicylate, oubain, and PAH. However, none of the tested compounds was taken up by RK-MTX-1-expressing cells compared with mock-transfected cells (Fig. 6).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 6. Uptake of different substrates into MDCK-RK-MTX-1 cells. [3H]taurocholate (10 µM), [3H]cholate (10 µM), [14C]acetyl salicylic acid (20 µM), [3H]ouabain (5 µM), and [3H]PAH (5 µM) were tested as possible substrates for the sodium-dependent methotrexate carrier 1 from the rat kidney. The uptake of these compounds was measured in the parental cell line MDCK, in MDCK-RK-Mtx-1 cells, and in MDCK-RK-MTX-1 cells in the presence of the appropriate inhibitor at a concentration of 100 µM. None of the tested compounds was a substrate of the carrier. Data are means ± SD of at least 5 independent experiments that were performed in triplicate.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In the past decade, more than 40 different carriers for organic anions and cations were identified and cloned. Most of these transporters were functionally characterized in detail. However, only a few sodium-dependent carriers could be isolated. The majority of carriers for anionic and zwitterionic drugs including organic anion transporting polypeptides (oatp) 1-4 (38), OAT1-5 (25, 34, 37, 39), and OAT-K1/K2 (2, 3, 26, 27, 31) are solely facilitating drug transport. The first carrier known to be actively driven by a sodium gradient was cloned by Hediger et al. (12) and is able to mediate the transport of glucose. Hagenbuch et al. (11) then identified the sodium-dependent taurocholate transporter in the liver, and Wong et al. (46) cloned the sodium-dependent bile acid transporter from the ileum. All these carriers have a narrow substrate spectrum in contrast to the sodium-independent facilitators. The latter are characterized by a broad and sometimes overlapping substrate specificity.

In addition to the previously described sodium-independent transporters for Mtx, we now identified a sodium-dependent Mtx carrier in the kidneys. On the protein level, this rat kidney Mtx carrier is likely to be identical to the previously cloned sodium-dependent rat liver Mtx carrier (13) as cDNA sequence analysis predicted the same open reading frames. In contrast, major differences in the MTX-1 mRNAs produced in rat liver and kidneys were identified in the 5'-UTR. This strongly suggests that both mRNAs are transcribed from different, tissue-specific promoters. Furthermore, the observed apparent molecular weight of 72 kDa, which is 14 kDa above the calculated molecular weight, suggests glycosylation of the protein and potential phosphorylation at two sites also allows for protein modification. Hence, regulation at the transcriptional and posttranscriptional level, as well as the lifetime expression course of MTX-1, is likely to vary between these two organs.

On the protein level, the rat kidney Mtx carrier-1 also shares high homology to rfc1 of rat (99%) and, to a lesser extent, mouse (88%) and human (62%). Of the 32 amino acids that have been identified as important for Mtx transport in murine and human rfc1 (7, 30, 35, 47, 48), only Ser 317 is mutated to alanine. Although in the rat rfc1 expression has only been reported in the vascular smooth muscle, murine rfc1 has been documented in kidney tubular cells by immunohistochemistry (43) and rfc1 mRNA expression was demonstrated in human placenta, liver, lung, and small intestine (29). However, it is not entirely clear whether the sodium-dependent Mtx carrier-1 represents the rat ortholog of human and murine rfc1. The murine rfc1 has been reported to be influenced by pH (43), whereas MTX-1 is strictly sodium and energy dependent (14). No such data are currently available on the human rfc1 and the protein encoded by the sequence designated as rat rfc1. With the use of rat and human kidney slices, Fleck et al. (9) demonstrated that the uptake but not the export of Mtx was energy dependent. Regression analysis of the published data revealed a Km between 30 and 100 µM for the Mtx uptake, indicating that RK-Mtx-1 is relevant in vivo.

For detailed characterization of the substrate specificity of MTX-1, we expressed the rat kidney cDNA in MDCK cells. In these cells, the Mtx uptake is sodium dependent to more than 90%. In accordance with previous results obtained on freshly isolated rat hepatocytes (14), Mtx uptake was inhibited by BSP, bile acids, and reduced folates like dihydro- and tetrahydrofolate, whereas folate as well as acetylsalicylate and PAH were only weak inhibitors. Previously, cholate and taurocholate were classified as competitive inhibitors of Mtx uptake into hepatocytes (14). Therefore, we tested these as potential substrates. However, none of the two substances was taken up by RK-MTX-1-transfected MDCK cells. With the exception of Mtx itself, only 5-methyltetrahydrofolate showed a very strong inhibitory effect at a concentration of 50 µM. As previous studies described sodium-independent (10, 24) and sodium-dependent carrier systems for Mtx and 5-methyltetrahydrofolate in the liver (22), it might be speculated that 5-methyltetrahydrofolate is the physiological substrate of the sodium-dependent Mtx carrier. Expression of rat liver cDNA in X. laevis oocytes (13) resulted in an active bumetanide uptake, whereas the corresponding renal clone was inactive in MDCK cells. This discrepancy is likely to be due to an artifact of the oocyte expression system. A similar observation has been reported for OATP8, which accepted different bile salts when expressed in oocytes but not in MDCK cells (16, 17). In addition, bumetanide was identified to be only a noncompetitive inhibitor of Mtx uptake in primary hepatocytes (14).

Subcellular fractionation and immunofluorescence studies clearly identified MTX-1 as a membrane protein localized within or at least near the outer plasma membrane. This would be consistent with glycosylation as the suggested apparent molecular weight that exceeds the predicted value. Moreover, the sorting of this transporter was restricted to the basolateral side in polarized multicellular tubules of MDCK epithelial cells. The validity of this model was confirmed earlier by Simmons et al. (36), who showed correct sorting of the apical transporter P-glycoprotein to the luminal membrane, resulting in secretion of the substrate into the tubule lumen. Taken together with the observation that MTX-1 expression increases the susceptibility to Mtx, MTX-1 can be classified as an import carrier that mediates cellular uptake of its substrate and, as a result of its basolateral localization in kidney epithelial cells, contributes to renal elimination by tubular secretion.

To put the Mtx transport by MTX-1 into a clinical perspective, the drug plasma levels as well as the properties of other Mtx carriers have to be considered. As described by Wall et al. (42), high-dose therapy with Mtx results in plasma concentrations of 1,700 µM 1 h pi, followed by a rapid decrease that can be accelerated by dialysis or diuretics. After 5 to 6 days, concentrations of less than 0.3 µM were measured after hemodialysis. The facilitators hOAT1 and 3 are expressed at the basolateral membrane and have Km values of 554 and 21 µM for Mtx (40). Therefore, it seems likely that these facilitators play a major role during the first hours after infusion when high plasma levels and concentration gradients are still present. With decreasing drug concentrations, Mtx uptake into the kidney epithelium should be shifted toward the pathways mediated by the human ortholog of RK-MTX-1 and hOAT3. Importantly, RK-MTX-1 is able to mediate the sodium-dependent uptake of the drug against a concentration gradient in contrast to hOAT3. For effective renal secretion, the serosal uptake of Mtx into epithelial cells must be followed by export at the apical side. The transport proteins present there are MRP2, Km = 2.5 to 3 mM (1); MRP4, Km 220 to 1,300 µM (4, 41); and hOAT4, Km = 18 µM (40). Interestingly, the carriers with high Km values (MRP2, 4) are energy driven and can work against a concentration gradient, whereas hOAT4 with a lower Km is solely facilitating transmembrane flux. It may therefore be speculated that the system hOAT1, 3/MRP2, 4 (influx/extrusion) is relevant at high plasma levels, whereas MTX-1/hOAT4 (import/efflux) is more prevalent at lower concentrations.

In this context, it may be interesting to note that Kinoshita et al. (20) reported that infusion of higher amounts of sodium results in significantly faster renal elimination of Mtx without affecting the glomerular filtration rate. At the same time, this high-saline infusion was found suitable to reduce systemic side effects and the need for leucovorin rescue in high-dose MTX therapy without a loss of antineoplastic activity in acute lymphoblastic leukemia patients. Presumably, an increased transmembrane sodium gradient may facilitate faster uptake of Mtx by the sodium-dependent MTX-1 into both kidney and neoplastic cells. However, in the kidneys cellular uptake will be followed by efflux unlike in MDCK or MRP2-negative tumor cells.

Interestingly, MTX-1 can be found in two organs that play major roles in the metabolism and elimination of Mtx, the liver and kidneys. Both organs are also heavily affected by Mtx toxicity and we could demonstrate a fivefold increase in toxicity toward MDCK cells expressing the RK-MTX1 carrier.

In conclusion, RK-MTX-1 is distinct from the hitherto cloned Mtx-transporting proteins of the OAT, OAT-K, and MRP families as we observed fundamental differences in sequence, ion, and energy dependency as well as the spectrum of substrates and inhibitors. In contrast to the homologous murine and human rfc1 proteins, MTX-1 is strictly sodium dependent. Whether this sodium dependency is due to changes in the amino acid sequence, or the result of tissue-specific modulation as suggested for murine rfc-1 by Wang et al. (43), remains unclear. The clinical relevance of the renal sodium-dependent Mtx carrier described here will also need to be elucidated further.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by the Deutsche Forschungsgemeinschaft (Graduiertenkolleg "Molekulare Veterinärmedizin" to K. U. Honscha) and a grant to W. Honscha (HO2103/1-1). The nucleotide sequence reported in this paper has been submitted to the National Institute of Biological Information/GenBank under accession number AF173642 [GenBank] .


    ACKNOWLEDGMENTS
 
The authors thank Prof. W. F. Flintoff, Department of Microbiology and Immunology, University of Western Ontario, London, Ontario, for the generous gift of the cDNA clone pMtx9, which allowed us to initiate this project. [3H]PAH was supplied by the Center of Physiology and Pathophysiology, Georg August University Göttingen and [3H]oubain by the Institute for Biochemistry and Endocrinology, Justus Liebig University of Giessen. We thank N. Thomsen and C. Lakoma for excellent technical assistance. Part of the work was conducted at the Institute of Pharmacology and Toxicology, Justus Liebig University Giessen. Confocal laser-scanning microscopy was performed at the laboratory of Dr. U. Rothe, Institute for Physiological Chemistry, Martin Luther University Halle Wittenberg.


    FOOTNOTES
 

Address for reprint requests and other correspondence: W. Honscha, Institute of Pharmacology, Pharmacy and Toxicology, Faculty of Veterinary Medicine, Univ. of Leipzig, An den Tierkliniken 15, D-04103 Leipzig, Germany (E-mail: honscha{at}vetmed.uni-leipzig.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* C. Kneuer and K. U. Honscha contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bakos E, Evers R, Sinko E, Varadi A, Borst P, and Sarkadi B. Interactions of the human multidrug resistance proteins MRP1 and MRP2 with organic anions. Mol Pharmacol 57: 760-768, 2000.[Abstract/Free Full Text]
  2. Buist SC, Cherrington NJ, Choudhuri S, Hartley DP, and Klaassen CD. Gender-specific and developmental influences on the expression of rat organic anion transporters. J Pharmacol Exp Ther 301: 145-151, 2002.[Abstract/Free Full Text]
  3. Cha SH, Sekine T, Kusuhara H, Yu E, Kim JY, Kim DK, Sugiyama Y, Kanai Y, and Endou H. Molecular cloning and characterization of multispecific organic anion transporter 4 expressed in the placenta. J Biol Chem 275: 4507-4512, 2000.[Abstract/Free Full Text]
  4. Chen ZS, Lee K, Walther S, Raftogianis RB, Kuwano M, Zeng H, and Kruh GD. Analysis of methotrexate and folate transport by multidrug resistance protein 4 (ABCC4): MRP4 is a component of the methotrexate efflux system. Cancer Res 62: 3144-3150, 2002.[Abstract/Free Full Text]
  5. Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987.[Web of Science][Medline]
  6. Delepine N, Delepine G, Cornille H, Brion F, Arnaud P, and Desbois JC. Dose escalation with pharmacokinetics monitoring in methotrexate chemotherapy of osteosarcoma. Anticancer Res 15: 489-494, 1995.[Web of Science][Medline]
  7. Drori S, Jansen G, Mauritz R, Peters GJ, and Assaraf YG. Clustering of mutations in the first transmembrane domain of the human reduced folate carrier in GW1843U89-resistant leukemia cells with impaired antifolate transport and augmented folate uptake. J Biol Chem 275: 30855-30863, 2000.[Abstract/Free Full Text]
  8. Erickson AR, Reddy V, Vogelsang SA, and West SG. Usefulness of the American college of rheumatology recommendations for liver biopsy in methotrexate-treated rheumatoid arthritis patients. Arthritis Rheum 38: 1115-1119, 1995.[Web of Science][Medline]
  9. Fleck C, Hilger R, Jurkutat S, Karge E, Merkel U, Schimske A, and Schubert J. Ex vivo stimulation of renal transport of the cytostatic drugs methotrexate, cisplatin, topotecan (Hycamtin) and ralitrexed (Tomudex) by dexamethasone, T3 and EGF in intact human and rat kidney tissue and in human renal cell carcinoma. Urol Res 30: 256-262, 2002.[CrossRef][Web of Science][Medline]
  10. Gewirtz DA, White JC, Randolph JK, and Goldman ID. Transport, binding, and polyglutamation of methotrexate in freshly isolated rat hepatocytes. Cancer Res 40: 573-578, 1980.[Abstract/Free Full Text]
  11. Hagenbuch B, Stieger B, Foguet M, Lübbert H, and Meier PJ. Functional expression cloning and characterization of the hepatocyte Na+/bile acid cotransport system. Proc Natl Acad Sci USA 88: 10629-10633, 1991.[Abstract/Free Full Text]
  12. Hediger MA, Coady MJ, Ikeda TS, and Wright EM. Expression cloning and cDNA sequencing of the Na+/glucose co-transporter. Nature 330: 379-381, 1987.[CrossRef][Medline]
  13. Honscha W, Dötsch KU, Thomsen N, and Petzinger E. Cloning and functional characterization of the bile acid-sensitive methotrexate carrier from rat liver cells. Hepatology 31: 1296-1304, 2000.[CrossRef][Web of Science][Medline]
  14. Honscha W and Petzinger E. Characterization of the bile acid sensitive methotrexate carrier of rat liver cells. Naunyn Schmiedebergs Arch Pharmacol 359: 411-419, 1999.[CrossRef][Web of Science][Medline]
  15. Honscha W, Platte HD, Oesch F, and Friedberg T. Relationship between the microsomal epoxide hydrolase and the hepatocellular transport of bile acids and xenobiotics. Biochem J 311: 975-979, 1995.[Medline]
  16. Horne DW. Na+ and pH dependence of 5-methyltetrahydrofolic acid and methotrexate transport in freshly isolated hepatocytes. Biochim Biophys Acta 1023: 47-53, 1990.[Medline]
  17. Horne DW and Reed KA. Transport of methotrexate in basolateral membrane vesicles from rat liver. Arch Biochem Biophys 298: 121-128, 1992.[CrossRef][Web of Science][Medline]
  18. Iqbal MP. Accumulation of methotrexate in human tissues following high-dose methotrexate therapy. J Pak Med Assoc 48: 341-343, 1998.[Medline]
  19. Jolivet J, Cowan KH, Curt GA, Clendeninn NJ, and Chabner BA. The pharmacology and clinical use of methotrexate. N Engl J Med 309: 1094-1104, 1983.[Web of Science][Medline]
  20. Kinoshita A, Kurosawa Y, Kondoh K, Suzuki T, Manabe A, Inukai T, Sugita K, and Nakazawa S. Effects of sodium in hydration solution on plasma methotrexate concentrations following high-dose methotrexate in children with acute lymphoblastic leukemia. Cancer Chemother Pharmacol 31: 256-260, 2003.
  21. Koch Nogueira PC, Hadj-Aïssa A, Schell M, Dubourg L, Brunat-Mentigny M, and Cochat P. Long-term nephrotoxicity of cisplatin, ifosfamide, and methotrexate in osteosarcoma. Pediatr Nephrol 12: 572-575, 1998.[CrossRef][Web of Science][Medline]
  22. König J, Cui Y, Nies A, and Keppler D. Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 275: 23161-23168, 2000.[Abstract/Free Full Text]
  23. Kremer JM, Kaye GI, Kaye NW, Ishak KG, and Axiotis CA. Light and electron microscopic analysis of sequential liver biopsy samples from rheumatoid arthritis patients receiving long-term methotrexate therapy. Arthritis Rheum 38: 1194-1203, 1995.[Web of Science][Medline]
  24. Kullak-Ublick GA, Ismair MG, Stieger B, Landmann L, Huber R, Pizzagalli F, Fattinger K, Meier PJ, and Hagenbuch B. Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver. Gastroenterology 120: 525-533, 2001.[CrossRef][Web of Science][Medline]
  25. Kusuhara H, Sekine T, Utsunomiya-Tate N, Tsuda M, Kojima R, Cha SH, Sugiyama Y, Kanai Y, and Endou H. Molecular cloning and characterization of a new multispecific organic anion transporter from rat brain. J Biol Chem 274: 13675-13680, 1999.[Abstract/Free Full Text]
  26. Masuda S, Ibaramoto K, Takeuchi A, Saito H, Hashimoto Y, and Inui KI. Cloning and functional characterization of a new multispecific organic anion transporter, OAT-K2, in rat kidney. Mol Pharmacol 55: 743-753, 1999.[Abstract/Free Full Text]
  27. Masuda S, Saito H, Nonoguchi H, Tomita K, and Inui KI. mRNA distribution and membrane localization of the OAT-K1 organic anion transporter in rat renal tubules. FEBS Lett 407: 127-131, 1997.[CrossRef][Web of Science][Medline]
  28. McAteer JA, Evan AP, and Gardner KD. Morphogenetic growth of kidney epithelial cell line MDCK. Anat Rec 217: 229-239, 1987.[CrossRef][Medline]
  29. Nguyen TT, Dyer DL, Dunning DD, Rubin SA, Grant KE, and Said HM. Human intestinal folate transport: cloning, expression, and distribution of complementary RNA. Gastroenterology 112: 783-791, 1997.[CrossRef][Web of Science][Medline]
  30. Roy K, Tolner B, Chiao JH, and Sirotnak FM. A single amino acid difference within the folate transporter encoded by the murine RFC-1 gene selectively alters its interaction with folate analogues. Implications for intrinsic antifolate resistance and directional orientation of the transporter within the plasma membrane of tumor cells. J Biol Chem 273: 2526-2531, 1998.[Abstract/Free Full Text]
  31. Saito H, Masuda S, and Inui KI. Cloning and functional characterization of a novel rat organic anion transporter mediating uptake of methotrexate in the kidney. J Biol Chem 271: 20719-20725, 1996.[Abstract/Free Full Text]
  32. Schaub TP, Kartenbeck J, Konig J, Spring H, Dorsam J, Staehler G, Storkel S, Thon WF, and Keppler D. Expression of the MRP2 gene-encoded conjugate export pump in human kidney proximal tubules and in renal cell carcinoma. J Am Soc Nephrol 10: 1159-1169, 1999.[Abstract/Free Full Text]
  33. Schornagel JH, Verweij J, de Mulder PHM, Cognetti F, Vermorken JB, Cappelaere P, Armand JP, Wildiers J, de Graeff A, Clavel M, Sahmoud T, Kirkpatrick A, and Lefebvre JL. Randomized phase III trial of edatrexate vs. methotrexate in patients with metastatic and/or recurrent squamous cell carcinoma of the head and neck: a European organization for research and treatment of cancer head and neck cancer cooperative group study. J Clin Oncol 13: 1649-1655, 1995.[Medline]
  34. Sekine T, Watanabe N, Hosoyamada M, Kanai Y, and Endou H. Expression cloning and characterization of a novel multispecific organic anion transporter. J Biol Chem 272: 18526-18529, 1997.[Abstract/Free Full Text]
  35. Sharina IG, Zhao R, Wang Y, Babani S, and Goldman ID. Mutational analysis of the functional role of conserved arginine and lysine residues in transmembrane domains of the murine reduced folate carrier. Mol Pharmacol 59: 1022-1028, 2001.[Abstract/Free Full Text]
  36. Simmons NL, Hunter J, and Jepson MA. Targeted delivery of a substrate for P-glycoprotein to renal cysts in vitro. Biochim Biophys Acta 1237: 31-36, 1995.[Medline]
  37. Simonson GD, Vincent AC, Roberg KJ, Huang Y, and Iwanij V. Molecular cloning and characterization of a novel liver-specific transport protein. J Cell Sci 107: 1065-1072, 1994.[Abstract]
  38. St.-Pierre MV, Kullak-Ublick GA, Hagenbuch B, and Meier PJ. Transport of bile acids in hepatic and non-hepatic tissues. J Exp Biol 204: 1673-1686, 2001.[Abstract]
  39. Sweet DH, Wolff NA, and Pritchard JB. Expression cloning and characterization of ROAT1. The basolateral organic anion transporter in rat kidney. J Biol Chem 272: 30088-30095, 1997.[Abstract/Free Full Text]
  40. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, and Endou H. Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther 302: 666-671, 2002.[Abstract/Free Full Text]
  41. Van Aubel RAMH, Smeets PHE, Peters JGP, Bindels RJM, and Russel FGM. The MRP4/ABCC4 gene encodes a novel apical organic anion transporter in human kidney proximal tubules: putative efflux pump for urinary cAMP and cGMP. J Am Soc Nephrol 13: 595-603, 2002.[Abstract/Free Full Text]
  42. Wall SM, Johansen MJ, Molony DA, DuBose TD Jr, Jaffe N, and Madden T. Effective clearance of methotrexate using high-flux hemodialysis membrane. Am J Kidney Dis 28: 846-854, 1996.[Web of Science][Medline]
  43. Wang Y, Zhao R, Russell RG, and Goldman ID. Localization of the murine reduced folate carrier as assessed by immunohistochemical analysis. Biochim Biophys Acta 1513: 49-54, 2001.[Medline]
  44. Whetstine JR, Flatley RM, and Matherly LH. The human reduced folate carrier gene is ubiquitously and differentially expressed in normal human tissues: identification of seven non-coding exons and characterization of a novel promoter. Biochem J 367: 629-640, 2002.[CrossRef][Web of Science][Medline]
  45. Williams FM, Murray RC, Underhill TM, and Flintoff WF. Isolation of a hamster cDNA clone coding for a function involved in methotrexate uptake. J Biol Chem 269: 5810-5816, 1994.[Abstract/Free Full Text]
  46. Wong MH, Oelkers PM, Craddock AL, and Dawson PA. Expression cloning and characterization of the hamster ileal sodium-dependent bile acid transporter. Biol Chem 269: 1340-1347, 1994.
  47. Zhao R, Gao F, Wang PJ, and Goldman ID. Role of the amino acid 45 residue in reduced folate carrier function and ion-dependent transport as characterized by site-directed mutagenesis. Mol Pharmacol 57: 317-323, 2000.[Abstract/Free Full Text]
  48. Zhao R, Sharina IG, and Goldman ID. Pattern of mutations that results in loss of reduced folate carrier function under antifolate selective pressure augmented by chemical mutagenesis. Mol Pharmacol 56: 68-76, 1999.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/3/F564    most recent
00257.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kneuer, C.
Right arrow Articles by Honscha, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kneuer, C.
Right arrow Articles by Honscha, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.