AJP - Renal Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 286: F625-F633, 2004. First published December 2, 2003; doi:10.1152/ajprenal.00152.2003
0363-6127/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/4/F625    most recent
00152.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vrljicak, P.
Right arrow Articles by Gupta, I. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vrljicak, P.
Right arrow Articles by Gupta, I. R.

Smad expression during kidney development

P. Vrljicak,1,2 D. Myburgh,1 A. K. Ryan,1,2 M. A. van Rooijen,3 C. L. Mummery,3 and I. R. Gupta1,2

Departments of 1Pediatrics and 2Human Genetics, Montreal Children's Hospital, McGill University, Montreal, Quebec, Canada H3H 1P3; and 3Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands

Submitted 18 April 2003 ; accepted in final form 25 November 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Signaling by the transforming growth factor (TGF)-{beta} superfamily is important during kidney development. Here, we describe the spatial and temporal expression patterns of the Smads, the transcription factors that translate TGF-{beta} signals into gene expression. RT-PCR data and in situ hybridization analysis showed that the receptor-regulated (R) Smads (Smad1, -2, -3, -5, and -8), the common partner Smad (Smad4), and the inhibitory (I) Smads (Smad6 and -7) were all expressed during mouse kidney development from embryonic day 12 until the end of nephrogenesis at postnatal day 15. Each Smad had a distinct spatial distribution. All were expressed by mesenchymal cells in the nephrogenic zone and were downregulated once these cells began to epithelialize. The common partner Smad, Smad4, was present in uninduced mesenchymal cells and at ureteric bud tips. The bone morphogenetic-responsive R-Smads, Smad1, -5, and -8, were mainly expressed in the nephrogenic zone, whereas the TGF-{beta}- responsive R-Smads were predominantly noted in the medullary interstitium. Expression of the I-Smad Smad7 was also seen in mesenchymal cells in the interstitium. Based on the observed patterns of expression, we speculate that individual or combinations of Smads may play specific roles in cell-fate determination during kidney development.

transforming growth factor-{beta} signaling; mRNA


TRANSFORMING GROWTH FACTOR-{beta} (TGF-{beta}) superfamily ligands affect critical processes during organ development, including cell proliferation, differentiation, cell-fate determination, apoptosis, and morphogenesis by activating discrete signaling pathways (2, 18). The signaling pathway for all TGF-{beta} members begins with ligand binding to a cell-surface receptor complex of type I and type II serine-threonine kinases. The type I receptor then phosphorylates a group of transcription factors known as Smads, which initiate target gene transcription (2, 26). The eight Smads that have been identified so far in mammals can be divided into three subclasses: the receptor-regulated Smads (R-Smads), the common partner Smad (Smad4), and the inhibitory Smads (I-Smads). R-Smads Smad1, -5, and -8 are activated during bone morphogenetic protein (BMP) signaling, whereas Smad2 and -3 are part of the TGF-{beta} and activin signaling pathways. Smad4, the common partner, couples with the phosphorylated form of an R-Smad, and then the complex translocates to the nucleus to regulate transcription. The I-Smads Smad6 and -7 negatively regulate TGF-{beta} and BMP signaling by forming stable interactions with the activated type I receptor or by preventing Smad4 from coupling with activated R-Smads (14, 16, 19, 27).

The murine ureteric bud develops as an offshoot of the mesonephric duct at embryonic (E) day 10.5 (E10.5) and induces the adjacent mesenchyme to become the metanephric mesenchyme (38). Reciprocal inductive interactions between the ureteric bud and the metanephric mesenchyme are required to establish the structural organization of the kidney. The ureteric bud undergoes successive branching events to form the collecting duct network, and at the tips of the branching ureteric bud the adjacent metanephric mesenchyme is induced to form the majority of each nephron (1). Members of the TGF-{beta} superfamily have been shown to be important for these processes. Targeted inactivation of either bone morphogenic protein (Bmp)-7 or Bmp-4 leads to severe murine kidney malformations (9, 11, 22, 25). In addition, culture of embryonic kidney explants in the presence of TGF-{beta} growth factors such as TGF-{beta}1, activin, and BMP-2, -4, or -7 affects whole organ growth and the ability of the ureteric bud to undergo branching morphogenesis (30, 34, 35, 37, 44). Despite the importance of these signaling pathways, we know little about the Smads, the signal mediators downstream of the ligand/receptor complex, and their function during kidney development. Mouse knockouts have been of limited success in elucidating the function of many of the Smads because the embryos die before the formation of the final metanephric kidney (4, 41, 42, 45, 48, 49).

Here, we describe the spatial and temporal expression patterns, using RT-PCR and in situ hybridization, of the R-Smads (Smad1, -2, -3, -5, and -8), the common partner, Smad4, and the I-Smads (Smad6 and -7) during kidney development. In mice, the metanephric kidney develops at E11.At E12, nephrogenesis begins and continues until the first 2 wk of the postnatal period (38). We demonstrate that the R-Smads, Smad4, and the I-Smads are expressed in the mouse kidney from E12 until the end of nephrogenesis. Within the nephrogenic zone, Smads are expressed by cells at the tips of the ureteric bud and by mesenchymal cells. However, once these mesenchymal cells begin to undergo epithelialization, Smad expression is downregulated. From our expression data, we speculate that individual or combinations of Smads may play specific roles in determining cell fate during kidney development.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and tissue collection. Pregnant CD1 mice were obtained from Charles Rivers Laboratories. Embryos and their metanephric kidneys were microdissected at E12, E15, and E18, at postnatal days (P1 and P15), and at adulthood (2 mo or older). Animals were treated in accordance with the rules and regulations of the Canadian Council of Animal Care guidelines.

In situ hybridization. Whole mouse embryonic kidneys were fixed overnight in 4% paraformaldehyde in PBS, washed with PBS-0.1% Tween 20 (Sigma), and dehydrated in methanol. In situ hybridization was performed as described previously with some modifications (47). Briefly, the tissue was bleached with 6% hydrogen peroxide, treated with 10 µg/ml proteinase K (Invitrogen), and then washed in 0.2% glycine before refixation in 4% paraformaldehyde/0.2% glutaraldehyde. For 60 min, the tissue was prehybridized in a solution of 50% formamide, 5x SSC (pH 4.5), 50 µg/ml yeast tRNA, 1% SDS, and 50 µg/ml heparin. cRNA probes (1 µg/ml) were added for overnight hybridization at 65°C. The tissue was then washed with a solution of 50% formamide, 5x SSC (pH 4.5), and 1% SDS, followed by a solution of 50% formamide and 2x SSC at 65°C. Blocking in 10% sheep serum in Tris-buffered saline (TBS)-0.1% Tween 20 was followed by incubation in a 1:2,000 dilution of alkaline phosphatase-conjugated anti-digoxygenin (DIG) antibody (Roche). Samples were developed using nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (Roche) in 0.1 M NaCl, 0.1 M Tris (pH 9.5), 50 mM MgCl2, and 0.1% Tween 20. Samples were visualized as whole mounts using a dissecting microscope and then cryosectioned at 20-µm thickness.

Probe synthesis. Complete or partial coding sequences for the following mammalian cDNAs were linearized and in vitro transcribed in the antisense direction using the following combination of enzymes. Gdnf and c-Ret (a gift from Frank Costantini, Columbia University) were digested with HindIII and BamHI and transcribed using SP6 and T3 (Promega), respectively. Mouse Bmp-4 was linearized with EcoRV and transcribed with SP6. Rat Smad1, Smad2, and Smad3 (gifts from Jean-Jacques Lebrun, McGill University) were digested using HindIII and transcribed using SP6. Smad4 (a gift from Christian Sirard, McGill University) was linearized with HindIII and transcribed with T3. Smad5 (a gift from An Zwijsen, Flanders Inter-university Institute for Biotechnology) was digested with BamHI and transcribed with T7. Smad8 (a gift from Christian Sirard) was subcloned into pCR II vector (Invitrogen), linearized with HindIII, and transcribed using T7. Tgf-{beta}1 (a gift from Fuad Ziyadeh, University of Pennsylvania) was cut with XhoI and transcribed with SP6. Smad6 was digested with EcoRI and transcribed with T7. Smad7 (gift from An Zwijsen) was digested with XhoI and transcribed with T7. Probes were labeled with DIG-labeled UTP (Roche) according to the manufacturer's specifications.

Dolichos biflorus agglutinin for labeling ureteric bud elements. Visualization of ureteric bud derivatives was performed using Dolichos biflorus agglutinin (DBA) staining. Cryosections were washed in 1x TBS and treated with 0.25% trypsin in 0.272 M CaCl2 for 30 min at 37°C. After incubation, slides were exposed to 3% hydrogen peroxide in methanol for 30 min to block endogenous peroxidases. After a brief TBS wash, tissue was exposed to 10 µg/ml biotinylated D. biflorus agglutinin (Vector Labs) overnight at 4°C. The following day, sections were treated with the streptavidin complex provided by the Vectastain ABC kit (Vector Labs) followed by application of 3,3' diaminobenzidine according to the manufacturer's recommendations.

RT-PCR. The presence of Smad1, -2, -3, -4, -5, -6, -7, and -8 mRNAs was analyzed by RT-PCR.

RNA was extracted with the RNeasy kit (Qiagen). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen). Primer sequences were as follows: Smad1 (sense: ATGAATGTGACCAGCTTGTTT, antisense: CTGCTTGGAACCAAATGGGAA); Smad2 (sense: CCCACTCCATTCCAGAAAAC, antisense: GAGCCTGTGTCCATACTTTG); Smad3 (sense: GTTGGACGAGCTGGAGAAG, antisense: GTAGTAGGAGATGGAGCAC); Smad4 (sense: AAGGTGGGGAAAGTGAAAC, antisense: ATGCTTTAGTTCATTCTTGTG); Smad5 (sense: GGAACCTGAGCCACAATGAA, antisense: CTTGCTGGGGAGTTGGGATA); Smad6 (sense: CCACTGGATCTGTCCGATTC, antisense: AAGTCGAACACCTTGATGGAG); Smad7 (sense: TCCTGCTGTGCAAAGTGTTC, antisense: AGTAAGGAGGAGGGGGAGAC); Smad8 (sense: CACCGACCCTTCCAATAAC, antisense: CTGGACAAAGATGCTGCTG); and {beta}-actin (sense: CACAGCTGAGAGGGAAATC, antisense: TCAGCAATGCCTGGGTAC). {beta}-Actin was used as an internal control for sample normalization. For the negative controls, the RT step was omitted and PCR was performed directly from the RNA. RT was performed using 200 ng of total RNA with 100 ng of reverse primer at 50°C for 30 min. For the PCR, 100 ng of forward primer were used in each sample, and the conditions were as follows: 96°C for 60 s, 60°C for 60 s, and 72°C for 60 s.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Temporal expression. To determine the temporal sequence of Smad expression, RNA was extracted from whole kidneys at various times during embryonic and postnatal development using RT-PCR. The R-Smads (Smad1, -2, -3, -5, and -8), Smad4, and the I-Smads (Smad6 and -7) were detected at all embryonic and postnatal stages examined, including the adult kidney (Fig. 1).



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 1. Expression of Smads during kidney development. Total RNA was obtained from whole kidneys at embryonic (E12, E15, E18), postnatal (P1, P15), and adult (Ad.; >2 mo) stages and used for RT-PCR. A: transcripts for all receptor-regulated Smads (R-Smads) and Smad4 are detected at each stage examined. B: transcripts for the inhibitory Smads (I-Smads; Smad6 and Smad7) are detected at each stage examined. {beta}-Actin is amplified from each sample as an internal control.

 

Distribution of the common partner, Smad4, in relation to the TGF-{beta} ligands, TGF-{beta}1, and Bmp-4. The spatial expression of Smads in the developing kidney was characterized to determine whether they were expressed in the same cell types as TGF-{beta} ligands. Whole mount in situ hybridization was performed on kidneys at E12 (data not shown) and E15 with probes for all R-Smads, Smad4, I-Smads, Bmp-4, and Tgf-{beta}1 and compared with the expression patterns for c-Ret and Gdnf. As previously reported, c-Ret was expressed at the growing tips of the ureteric bud, and Gdnf was detected in uninduced mesenchymal cells adjacent to ureteric bud tips (17, 29). Kidneys were cryosectioned and then colabeled with biotinylated D. biflorus to identify ureteric bud cells. As shown in Fig. 2, Tgf-{beta}1, Bmp-4, and Smad4 were all expressed at E15. Differences in their expression patterns were readily apparent when these kidneys were sectioned. In whole-mount preparations, Tgf-{beta}1 was ubiquitously expressed. This was confirmed in the cryosections where Tgf-{beta}1 was detected in mesenchymal cells within the interstitium, in uninduced mesenchymal cells in the nephrogenic zone, and at the tips of the ureteric bud. Bmp-4 was detected mostly in the cortex in whole-mount prepartions (Fig. 2), but in the cryosections, intense expression was noted in the nephrogenic zone, and a fainter signal was observed within the medullary interstitial compartment (Fig. 2). Bmp-4 was expressed in the mesenchyme adjacent to the ureteric bud tips and in the tips themselves but not in mesenchymal cells undergoing epithelialization. Smad4 was strongly expressed in the nephrogenic zone and markedly reduced in the medulla in whole-mount preparations (Fig. 2). In the cryosections, Smad4 expression was similar to Bmp-4: a strong signal was detected in the uninduced mesenchyme and the ureteric bud tips within the nephrogenic zone. In contrast to Bmp-4, Smad4 was more weakly expressed by mesenchymal cells in the interstitium. Smad4 was noted to be weakly expressed in the mesenchymal cells surrounding the ureter (Fig. 2), as previously described for Bmp-4 (10, 25). Similar results were obtained at E12 for Tgf-{beta}1, Bmp-4, and Smad4 (data not shown).



View larger version (91K):
[in this window]
[in a new window]
 
Fig. 2. Expression of transforming growth factor (TGF)-{beta} ligands and the common partner, Smad4, by whole mount in situ hybridization. In situ hybridization was performed on whole-mount kidneys at E15 for c-Ret, Gdnf, bone morphogenetic protein (Bmp)-4, Tgf-{beta}1, and Smad4. Kidneys were sectioned at 20-µm thickness and biotinylated, and Dolichos biflorus was used to identify ureteric bud elements (brown) in each section. Whole-mount (x2.5; left), low (x10; middle)-, and high-power (x40; right) images for each section are shown. c-Ret is expressed exclusively at the tips of the ureteric bud. Gdnf is expressed by metanephric mesenchymal cells in the nephrogenic zone. Bmp-4 is strongly expressed by uninduced mesenchymal cells in the cortex and at the tips of the ureteric bud. Tgf-{beta}1 is ubiquitously expressed in uninduced mesenchymal cells in the nephrogenic zone, in medullary mesenchymal cells, and at the ureteric bud tips. Smad4 is strongly expressed in the cortex in whole-mount preparations. In the cryosections, Smad4 is strongly expressed by uninduced mesenchymal cells and at the ureteric bud tips. Boxes in low-power images (middle) are shown under high power (right). Arrows indicate expression at the tips of the ureteric bud. Examples of mesenchymal cells undergoing epithelialization are outlined in black.

 

Distribution of R-Smads. The BMP-responsive R-Smads, Smad1, -5, and -8, were all expressed by mesenchymal cells in the nephrogenic zone and at the ureteric bud tips at E15 (Fig. 3). A weaker signal was detected by all three probes in mesenchymal cells in the medulla and around the ureter.



View larger version (98K):
[in this window]
[in a new window]
 
Fig. 3. Expression of receptor-regulated Smads by whole mount in situ hybridization. In situ hybridization was performed on whole-mount kidneys at E15 for Smad1, Smad2, Smad3, Smad5, and Smad8. Kidneys were sectioned at 20-µm thickness, and biotinylated D. biflorus was used to identify ureteric bud elements (brown) in each section. Magnifcations for whole-mount, low-, and high-power images for each section are as defined in Fig. 2. Smad1 is strongly expressed in the cortex in uninduced mesenchymal cells and in ureteric bud tips. Smad2 is expressed predominantly by mesenchymal cells in the medulla. Smad3 is expressed throughout the kidney in mesenchymal cells in both the medullary interstitium and the nephrogenic zone and at ureteric bud tips. Smad5 expression is similar to Smad1. Smad8 expression is noteworthy in that it is expressed uniformly by mesenchymal cells in the nephrogenic zone and the medulla. Smad8 is also expressed at the ureteric bud tips. Boxes, arrows, and black outlines are as defined in Fig. 2.

 

The TGF-{beta}-responsive Smads, Smad2 and -3, had different expression patterns. Smad2 was strongly expressed in mesenchymal cells in the medulla at E15 and was difficult to detect in other regions of the kidney (Fig. 3). In contrast, Smad3 labeled strongly throughout all compartments of the kidney except for condensing mesenchymal structures where it was downregulated (Fig. 3). Smad3 was expressed in mesenchymal cells in both the nephrogenic zone and the medullary interstitium and in cells from ureteric bud tips. Similar results for Smad1, -2, -3, -5, and -8 were obtained at E12 (data not shown).

Distribution of I-Smads. Smad6 was mostly expressed by mesenchymal cells in the nephrogenic zone and at ureteric bud tips. In comparison, Smad7 showed similar expression to Smad6, but a signal was also noted within mesenchymal cells in the medullary interstitium (Fig. 4).



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 4. Expression of inhibitory Smads by whole mount in situ hybridization. In situ hybridization was performed on whole-mount kidneys at E15 for Smad6 and Smad7. Kidneys were sectioned at 20-µm thickness, and biotinylated D. biflorus was used to identify ureteric bud elements (brown) in each section. Magnifcations for whole-mount, low-, and high-power images for each section are as defined in Fig. 2. Smad6 is strongly expressed in the cortex in uninduced mesenchymal cells and in ureteric bud tips. Smad7 is expressed predominantly by mesenchymal cells in the medulla. Boxes, arrows, and black outlines are as defined in Fig. 2.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A number of lines of evidence confirm that members of the TGF-{beta} superfamily are important during murine kidney development. Targeted inactivation of Bmp-7 or Bmp-4, for example, leads to small, abnormal kidneys (9, 11, 22, 25). Furthermore, results from experiments using cultured embryonic kidney explants demonstrate that TGF-{beta}1, BMP-2, BMP-4, BMP-7, and activin affect organ growth and renal branching morphogenesis (30, 34, 35, 37, 44). Although Smads have been shown to be the intracellular mediators for all TGF-{beta} signaling pathways, little is known about their role during kidney development. The results reported here demonstrate that the R-Smads, Smad4, and I-Smads were expressed in the mouse kidney throughout development. Each Smad showed a distinct pattern of expression, and many of them were shown to co-occur in the same cell type (Fig. 5). Smads were expressed in the nephrogenic zone by uninduced mesenchymal cells adjacent to the ureteric bud tips and by mesenchymal cells in the peripheral cortex that were destined to become stromal cells. In mesenchymal cells adjacent to the ureteric bud tips, Smad expression was downregulated once they began to differentiate. Medium to high levels of expression for all of the R-Smads and Smad7 were detected within mesenchymal cells in the medullary interstitium, whereas Smad4 and -6 were weakly expressed within this cell type. All of the Smads were detected within the ureteric bud tips.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 5. Summary of expression patterns. In situ hybridization revealed 4 basic patterns of expression for Smads and TGF-{beta} ligands. These patterns are based on the relative intensity of expression for a given Smad among the cellular compartments and do not reflect differences in expression levels between Smads. Top left: Smad4 and Smad6 are strongly expressed in the nephrogenic zone and more weakly in the interstitium. Top right: Bmp-4, Smad1, Smad3, and Smad5 have high expression in the nephrogenic zone and a medium level of expression in the interstitium. Bottom left: Tgf-{beta}1 and Smad8 show a medium level of expression throughout the nephrogenic zone and the interstitium. Bottom right: Smad2 and Smad7 have high expression in the medullary interstitium and a medium level of expression in the nephrogenic zone including the ureteric bud tips. All of the Smads and TGF-{beta} ligands are downregulated in mesenchymal cells undergoing epithelialization.

 

Characterizing the mRNA expression patterns for the Smads is an important step toward understanding how these genes are expressed and regulated. Our mRNA results complement protein expression data reported by Oxburgh and Robertson (28), although they differ in some significant ways. Our images clearly demonstrate that each Smad has a particular pattern of expression (Fig. 5). Perhaps due to the greater sensitivity of in situ hybridization, we found that Smad5 and -8 mRNA transcripts are present in mesenchymal cells and ureteric bud tips, a result that has not been clearly demonstrated by protein immunohistochemistry. In addition, we noted that all Smads were expressed in the tips of the growing ureteric bud at E12 and at E15. This observation differs somewhat from that of Oxburgh and Robertson, who were unable to detect Smads at E11.5 in the ureteric bud, using RT-PCR or immunohistochemistry, although Smads were observed in ureteric bud derivatives or collecting ducts at E15.5. Thus either the Smads become turned on in ureteric bud tips only after the first branching event has passed at ~E12 or the methods differ in sensitivity. Oxburgh and Robertson observed that all of the Smads were downregulated in condensing mesenchyme but then reappeared in more mature structures such as glomeruli and tubules. Judging from their images, protein expression in glomeruli and tubules was only observed for Smad2, -3, and -4. We were unable to detect any significant Smad mRNA expression in either the condensing mesenchymal structures or their mature counterparts, suggesting that transcription was reduced in these locations.

It is unclear from the reported RNA and protein expression data whether TGF-{beta} ligands signal via paracrine or autocrine pathways or both during kidney development. Clearly, Bmp-4 is expressed in the same mesenchymal cell types that express the BMP-responsive Smads and Smad4 (Figs. 2 and 3). These results run counter to other reports in the literature that show Bmp-4 is expressed by condensing mesenchymal structures and not by cells at the ureteric bud tip (10, 25, 34). In these other reports, cell types were identified by histology rather than colabeling with known cell-specific markers. It is possible that the signal reported in cells of condensing mesenchymal structures actually originated from ureteric bud tips. Other differences in our expression data may be due to differences in the probes themselves or the detection system used for in situ hybridization (e.g., radioisotope vs. DIG labeling and detection). We are unaware of any study that documents the expression of BMP-4 protein in the developing kidney. Two reports have examined the expression of the BMP type I receptors, known as activin-like kinase (ALK)-3 and -6. Dewulf et al. (8) found expression of ALK-6 mRNA in ureteric bud cells and ALK-3 in both derivatives of the ureteric bud and mesenchymal cells at E12.5. Martinez et al. (23) reported similar findings using in situ hybridization, although they detected ALK-6 expression in mesenchymal cells as well as ureteric bud cells. They also detected expression of the BMP type II receptor in mesenchymal and ureteric bud cells. Collectively, the published results and those reported here suggest that all of the BMP signaling components are present in mesenchymal cells during kidney development. Thus BMP signaling within mesenchymal cells is likely autocrine.

TGF-{beta}1 mRNA was predominantly expressed in the interstitium and at ureteric bud tips. Smad2 was mostly expressed in mesenchymal cells of the interstitium, whereas Smad3 was ubiquitously expressed (Figs. 2 and 3). Although both TGF-{beta}- responsive Smads were expressed by mesenchymal cells in the interstitium, the common partner, Smad4, was only weakly expressed in these cells. This could reflect a discrepancy between transcription and translation such that there may be significant levels of protein present despite a reduction in the number of mRNA transcripts. However, the immunohisto-chemical data from Oxburgh and Robertson (28) also suggest that there is little Smad4 protein within the medullary interstitium. This, therefore, raises the possibility that there may be other common partner Smads that mediate TGF-{beta} signaling in these mesenchymal cells. Our expression data are consistent with those reported by Clark et al. (7), who demonstrated expression of TGF-{beta}1 mRNA in rat kidney at similar time points in mesenchymal cells of the nephrogenic zone and in epithelial cells at the tips of the ureteric bud. However, they did not see expression of the ligand in the interstitium itself, but this may be due to differences in our respective probes and/or differences between the two species. The mRNA for the TGF-{beta}1 type I receptor, ALK-5, is expressed in the interstitium of the developing kidney (7). In contrast, the type II receptor is detected in mesenchymal cells within the nephrogenic zone and the interstitium and in ureteric bud cells (6). All of this evidence suggests that TGF-{beta}1 signaling within mesenchymal cells in the interstitium is also autocrine.

When murine embryonic kidney explants are grown in the presence of TGF-{beta}1, BMP-2, or activin, renal branching morphogenesis is inhibited (12, 30, 35, 36). The effect of BMP-7 on renal branching morphogenesis is more complicated: some authors have reported no significant effect (44), whereas others have found it to be stimulatory or inhibitory depending on the dose (30). We observed some expression of all Smads within the tips of the ureteric bud. Future work will need to establish whether TGF-{beta} ligands are being secreted by mesenchymal or ureteric bud cells to determine whether signaling in ureteric bud cells is paracrine or autocrine. If the source of ligand were indeed from mesenchymal cells, then this would suggest a mechanism by which mesenchymal cells could regulate the extent of ureteric bud branching. Smads are highly expressed in uninduced mesenchyme but downregulated once these cells begin to differentiate (28). We speculate that mesenchymal cells secrete TGF-{beta} ligands that then relay signals to the ureteric bud tips to inhibit branching and prepare the ureteric bud tip to become the distal segment of the future nephron.

The I-Smads, Smad6 and -7, are induced by TGF-{beta} and BMP signaling and negatively regulate these pathways (40, 46). Although the I-Smads are known to be important for the function of glomerular cells in the adult kidney (5, 39, 43), we now demonstrate that they are also present during development in mesenchymal cells and at ureteric bud tips. The expression pattern of Smad6 parallels that of Smad4 in that the strongest signal is seen in mesenchymal cells within the nephrogenic zone. In contrast, Smad7 is detected in all cell types, including mesenchymal cells within the interstitium. Taken together, it is plausible that TGF-{beta} and BMP signaling within all cell types of the developing kidney can be regulated by at least one of the I-Smads.

By combining our results with the rest of the literature, a model for TGF-{beta} and BMP signaling can be proposed. All components of the BMP pathway including its R-Smads, Smad1, -5, and -8, are most highly expressed within mesenchymal cells within the nephrogenic zone and at the ureteric bud tips. In contrast, the components of the TGF-{beta} signaling pathway including Smad2 and -3 are mostly detected within mesenchymal cells of the medullary interstitium and at the ureteric bud tips. This suggests that these pathways may be spatially segregated so that BMP signaling predominates in the nephrogenic zone, whereas TGF-{beta} signaling predominates in the interstitium. The patterns of expression of the I-Smads also support this model. Smad6 is mostly reported to be a BMP inhibitor (13, 14, 20), and thus its expression in the nephrogenic zone would be consistent with this function. In contrast, Smad7 is reported to be both a TGF-{beta} and BMP inhibitor (13), which fits with its more ubiquitous expression within the developing kidney.

According to the results, each Smad has a particular expression pattern that may influence cellular differentiation. Mesenchymal cells are known to become epithelialized in the presence of a signal from the ureteric bud. In contrast, in the absence of a ureteric bud signal, the same cells may undergo apoptosis. Mesenchymal cells can also differentiate to become stromal or interstitial cells that express molecular markers such as BF-2, Pod-1, and retinoic acid receptor-{alpha} and -{beta} (15, 24, 32, 33). Some of the factors that are known to induce mesenchymal-to-epithelial transformation include Wnt4 (21) and leukemia inhibitory factor (3, 31). Plisov et al. (31) have shown that leukemia inhibitory factor with TGF-{beta}2 and FGF2 enhances Wnt signaling by promoting Tcf1/Lef1 DNA-binding activity. Furthermore, they demonstrated in electrophoretic mobility shift assays that Smad4 was able to interact with Tcf1 and Lef1. These results suggest that TGF-{beta} signaling plays a role in mesenchymal cell differentiation. We speculate that the types of Smads expressed and their relative levels may influence whether a mesenchymal cell will become epithelialized, undergo apoptosis, or become an interstitial stromal cell. By colabeling ureteric bud derivatives with D. biflorus, our data also demonstrate that all Smads are expressed in the tips of the growing ureteric bud and can therefore affect renal branching morphogenesis. In the future, conditional kidney-specific knockouts for individual Smads will be important tools with which to clarify the roles of these transcription factors in effecting mesenchymal and ureteric bud cell fates.


    ACKNOWLEDGMENTS
 
We thank Annie Simard for technical support and Oriana Yu for technical support and helpful insights.

GRANTS

This work was funded with the support of an operating grant from the Kidney Foundation of Canada (to I. R. Gupta).


    FOOTNOTES
 

Address for reprint requests and other correspondence: I. R. Gupta, Montreal Children's Hospital, 2300 Tupper St., Montreal, Quebec, Canada H3H 1P3 (E-mail: indra.gupta{at}muhc.mcgill.ca).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Al-Awqati Q and Goldberg M. Architectural pattens in branching morphogenesis in the kidney. Kidney Int 54: 1832-1842, 1998.[CrossRef][Web of Science][Medline]
  2. Attisano L and Wrana J. Signal transduction by the TGF-{beta} superfamily. Science 296: 1646-1647, 2002.[Abstract/Free Full Text]
  3. Barasch J, Yang J, Ware C, Taga T, Yoshida K, Erdjument-Bromage H, Tempst P, Parravicini E, Malach S, Aranoff T, and Oliver J. Mesenchymal to epithelial conversion in rat metanephros is induced by LIF. Cell 99: 377-386, 1999.[CrossRef][Web of Science][Medline]
  4. Chang H, Huylebroeck D, Verschueren K, Guo Q, Matzuk M, and Zwijsen A. Smad5 knockout mice die at mid-gestation due to multiple embryonic and extraembryonic defects. Development 126: 1631-1642, 1999.[Abstract]
  5. Chen R, Cancan H, Morinelli T, Trojanowska M, and Richard V P. Blockade of the effects of TGF-{beta} on mesangial cells by overexpression of Smad7. J Am Soc Nephrol 13: 887-893, 2002.[Abstract/Free Full Text]
  6. Choi M, Liu A, and Ballermann B. Differential expression of transforming growth factor-{beta} receptors in rat kidney development. Am J Physiol Renal Physiol 273: F386-F395, 1997.[Abstract/Free Full Text]
  7. Clark A, Young R, and Bertram J. In vitro studies on the roles of transforming growth factor-{beta}1 in rat metanephric development. Kidney Int 59: 1641-1653, 2001.[CrossRef][Web of Science][Medline]
  8. Dewulf N, Verschueren K, Lonnoy O, Moren A, Grimsby S, Van deSpiegle K, Miyazono K, Huylebroeck D, and ten Dijke P. Distinct spatial and temporal expression patterns of two type I receptors for bone morphogenetic proteins during mouse embryogenesis. Endocrinology 136: 2652-2663, 1995.[Abstract]
  9. Dudley A, Lyons K, and Robertson E. A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev 9: 2795-2807, 1995.[Abstract/Free Full Text]
  10. Dudley A and Robertson E. Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos. Dev Dyn 208: 349-362, 1997.[CrossRef][Web of Science][Medline]
  11. Dunn N, Winnier G, Hargett L, Schrick J, Fogo A, and Hogan B. Haploinsufficient phenotypes in Bmp4 heterozygous null mice and modificaton by mutations in Gli3 and Alx4. Dev Biol 188: 235-247, 1997.[CrossRef][Web of Science][Medline]
  12. Gupta I, Piscione T, Grisaru S, Phan T, Macias-Silva M, Zhou X, Whiteside C, Wrana J, and Rosenblum N. Protein kinase A is a negative regulator of renal branching morphogenesis and modulates inhibitory and stimulatory bone morphogenetic proteins. J Biol Chem 274: 26305-26314, 1999.[Abstract/Free Full Text]
  13. Hanyu A, Ishidou Y, Ebisawa T, Shimanuki T, Imamura T, and Miyazono K. The N domain of Smad7 is essential for specific inhibition of transforming growth factor-{beta} signaling. J Cell Biol 155: 1017-1027, 2001.[Abstract/Free Full Text]
  14. Hata A, Lagna G, Massague J, and Hemmati-Brivanlou A. Smad6 inhibits BMP/Smad1 signaling by specifically competing with the Smad4 tumor suppressor. Genes Dev 12: 186-197, 1998.[Abstract/Free Full Text]
  15. Hatini V, Huh S, Herzlinger D, Soares V, and Lai E. Essential role of stromal mesenchyme in kidney morphogenesis revealed by targeted disruption of winged helix transcription factor BF-2. Genes Dev 10: 1467-1478, 1996.[Abstract/Free Full Text]
  16. Hayashi H, Abdollah S, Qiu Y, Cai J, Xu YY, Grinnell B, Richardson M, Topper J, Gimbrone M, Wrana J, and Falb D. The MAD-related protein Smad7 associates with the TGF{beta} receptor and functions as an antagonist of TGF{beta} signaling. Cell 89: 1165-1173, 1997.[CrossRef][Web of Science][Medline]
  17. Hellmich H, Kos L, Cho E, Mahon K, and Zimmer A. Embryonic expression of glial cell-line derived neurotrophic factor (GDNF) suggests multiple developmental roles in neural differentiation and epithelial-mesenchymal interactions. Mech Dev 54: 95-105, 1996.[CrossRef][Web of Science][Medline]
  18. Hogan B. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev 10: 1580-1594, 1996.[Free Full Text]
  19. Imamura T, Takase M, Nishihara A, Oeda E, Hanai J, Kawabata M, and Miyazono K. Smad6 inhibits signalling by the TGF-{beta} superfamily. Nature 389: 623-626, 1997.
  20. Itoh S, Itoh F, Goumans MJ, and ten Dijke P. Signaling of transforming growth factor-family members through Smad proteins (Abstract). Eur J Biochem 267: 6954, 2000.[Web of Science][Medline]
  21. Kispert A, Vainio S, and McMahon A. Wnt-4 is a mesenchymal signal for epithelial transformation of metanephric mesenchyme in the developing kidney. Development 125: 4225-4234, 1998.[Abstract]
  22. Luo G, Hofmann C, Bronckers A, Sohocki M, Bradley A, and Karsenty G. BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning. Genes Dev 9: 2808-2820, 1995.[Abstract/Free Full Text]
  23. Martinez G, Loveland K, Clark A, Dziadek M, and Bertram J. Expression of bone morphogenetic protein receptors in the developing mouse metanephros. Exp Nephrol 9: 372-379, 2001.[CrossRef][Web of Science][Medline]
  24. Mendelsohn C, Batourina E, Fung S, Gilbert T, and Dodd J. Stromal cells mediate retinoid-dependent functions essential for renal development. Development 126: 1139-1148, 1999.[Abstract]
  25. Miyazaki Y, Oshima K, Fogo A, Hogan B, and Ichikawa I. Bone morphogenetic protein 4 regulates the budding site and elongation of the mouse ureter. J Clin Invest 105: 863-873, 2000.[Web of Science][Medline]
  26. Moustakas A, Souchelnytskyi S, and Heldin CH. Smad regulation in TGF-{beta} signal transduction. J Cell Sci 114: 4359-4369, 2001.[Abstract/Free Full Text]
  27. Nakao A, Afrakhte M, Moren A, Nakayama T, Christian J, Heuchel R, Itoh S, Kawabata M, Heldin NE, Heldin CH, and ten Dijke P. Identification of Smad7, a TGF{beta}-inducible antagonist of TGF-{beta} signalling. Nature 389: 631-635, 1997.[CrossRef][Medline]
  28. Oxburgh L and Robertson E. Dynamic regulation of Smad expression during mesenchyme to epithelium transition in the metanephric kidney. Mech Dev 112: 207-211, 2002.[CrossRef][Web of Science][Medline]
  29. Pachnis V, Mankoo B, and Costantini F. Expression of the c-ret proto-oncogene during mouse embryogenesis. Development 119: 1005-1017, 1993.[Abstract]
  30. Piscione TD, Yager TD, Gupta IR, Grinfeld B, Pei Y, Attisano L, Wrana JL, and Rosenblum ND. BMP-2 and OP-1 exert direct and opposite effects on renal branching morphogenesis. Am J Physiol Renal Physiol 273: F961-F975, 1997.[Abstract/Free Full Text]
  31. Plisov S, Yoshino K, Dove L, Higinbotham K, Rubin J, and Perantoni A. TGFB LIF and FGF2 cooperate to induce nephrogenesis. Development 128: 1045-1057, 2001.[Abstract]
  32. Quaggin S, Schwartz L, Cui S, Igarashi P, Deimling J, Post M, and Rossant J. The basic-helix-loop-helix protein Pod1 is critically important for kidney and lung organogenesis. Development 126: 5771-5783, 1999.[Abstract]
  33. Quaggin S, Vanden Heuvel G, and Igarashi P. Pod-1, a mesoderm-specific helix-loop-helix protein expressed in mesenchymal and glomerular epithelial cells in the developing kidney. Mech Dev 71: 37-48, 1998.[CrossRef][Web of Science][Medline]
  34. Raatikainen-Ahokas A, Hytonen M, Tenhunen A, Sainio K, and Sariola H. BMP-4 affects the differentiation of metanephric mesenchyme and reveals an early anterior-posterior axis of the embryonic kidney. Dev Dyn 217: 146-158, 2000.[CrossRef][Web of Science][Medline]
  35. Ritvos O, Tuuri T, Eramaa M, Sainio K, Hilden K, Saxen L, and Gilbert S. Activin disrupts epithelial branching morphogenesis in developing glandular organs of the mouse. Mech Dev 50: 229-245, 1995.[CrossRef][Web of Science][Medline]
  36. Rogers S, Ryan G, and Hammerman M. Metanephric transforming growth factor-{alpha} is required for renal organogenesis in vitro. Am J Physiol Renal Fluid Electrolyte Physiol 262: F533-F539, 1992.[Abstract/Free Full Text]
  37. Rogers S, Ryan G, Purchio A, and Hammerman M. Metanephric transforming growth factor-{beta}1 regulates nephrogenesis in vitro. Am J Physiol Renal Fluid Electrolyte Physiol 264: F996-F1002, 1993.[Abstract/Free Full Text]
  38. Saxen L. Organogenesis of the Kidney. Cambridge, UK: Cambridge University Press, 1987.
  39. Schiffer M, Bitzer M, Roberts I, Kopp J, t. Peter D, Mundel P, and Bottinger E. Apoptosis in podocytes induced by TGF-{beta} and Smad7. J Clin Invest 108: 807-816, 2001.[CrossRef][Web of Science][Medline]
  40. Schnaper H, Hayashida T, Hubchak S, and Poncelet AC. TGF-{beta} signal transduction and mesangial cell fibrogenesis. Am J Physiol Renal Physiol 284: F243-F284, 2003.[Abstract/Free Full Text]
  41. Sirard C, de la Pompa JL, Elia A, Itie A, Mirtsos C, Cheung A, Hahn S, Wakeham A, Schwartz L, Kern SE, Rossant J, and Mak TW. The tumor suppressor gene Smad 4/Dpc4 is required for gastrulation and later for anterior development of the mouse embryo. Genes Dev 12: 107-119, 1998.[Abstract/Free Full Text]
  42. Tremblay KD, Dunn NR, and Robertson EJ. Mouse embryos lacking Smad1 signals display defects in extra-embryonic tissues and germ cell formation. Development 128: 3609-3621, 2001.[Abstract/Free Full Text]
  43. Uchida K, Nitta K, Kobayashi H, Kawachi. H, Shimizu F, Yumura W, and Nihei H. Localization of Smad6 and Smad7 in the rat kidney and their regulated expression in the anti-Thy-1 nephritis. Mol Cell Biol Res Commun 4: 98-105, 2000.[CrossRef][Medline]
  44. Vukicevic S, Kopp J, Luyten F, and Sampath T. Induction of nephrogenic mesenchyme by osteogenic protein 1 (bone morphogenetic protein 7). Proc Natl Acad Sci USA 93: 9021-9026, 1996.[Abstract/Free Full Text]
  45. Weinstein M, Yang X, Li C, Xu X, Gotay J, and Deng CX. Failure of egg cylinder elongation and mesoderm induction in mouse embryos lacking the tumor suppressor smad2. Proc Natl Acad Sci USA 95: 9378-9383, 1998.[Abstract/Free Full Text]
  46. Whitman M. Feedback from inhibitory SMADS. Nature 389: 549-551, 1997.[Medline]
  47. Wilkinson D. Essential Developmental Biology: A Practical Approach. Oxford, UK: Oxford University Press, 1993.
  48. Yang X, Li C, Xu X, and Deng C. The tumor suppressor SMAD4/DPC4 is essential for epiblast proliferation and mesoderm induction in mice. Proc Natl Acad Sci USA 95: 3667-3672, 1998.[Abstract/Free Full Text]
  49. Zhao GQ. Consequences of knocking out BMP signaling in the mouse. Genesis 43-56, 2003.



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. C. Jeyaraj, M. Singh, D. A. Ayupova, S. Govindaraju, and B. S. Lee
Transcriptional Control of Human Antigen R by Bone Morphogenetic Protein
J. Biol. Chem., February 12, 2010; 285(7): 4432 - 4440.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
I. Kazama, Z. Mahoney, J. H. Miner, D. Graf, A. N. Economides, and J. A. Kreidberg
Podocyte-Derived BMP7 Is Critical for Nephron Development
J. Am. Soc. Nephrol., November 1, 2008; 19(11): 2181 - 2191.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Villanueva, C. Cespedes, A. A. Gonzalez, E. Roessler, and C. P. Vio
Inhibition of bFGF-receptor type 2 increases kidney damage and suppresses nephrogenic protein expression after ischemic acute renal failure
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R819 - R828.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
I. J. Murawski, D. B. Myburgh, J. Favor, and I. R. Gupta
Vesico-ureteric reflux and urinary tract development in the Pax21Neu+/ mouse
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1736 - F1745.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. van de Sluis, P. Muller, K. Duran, A. Chen, A. J. Groot, L. W. Klomp, P. P. Liu, and C. Wijmenga
Increased Activity of Hypoxia-Inducible Factor 1 Is Associated with Early Embryonic Lethality in Commd1 Null Mice
Mol. Cell. Biol., June 1, 2007; 27(11): 4142 - 4156.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
M. C. Banas, W. T. Parks, K. L. Hudkins, B. Banas, M. Holdren, M. Iyoda, T. A. Wietecha, J. Kowalewska, G. Liu, and C. E. Alpers
Localization of TGF-{beta} Signaling Intermediates Smad2, 3, 4, and 7 in Developing and Mature Human and Mouse Kidney
J. Histochem. Cytochem., March 1, 2007; 55(3): 275 - 285.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Villanueva, C. Cespedes, A. Gonzalez, and C. P. Vio
bFGF induces an earlier expression of nephrogenic proteins after ischemic acute renal failure
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1677 - R1687.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Villanueva, C. Cespedes, and C. P. Vio
Ischemic acute renal failure induces the expression of a wide range of nephrogenic proteins
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R861 - R870.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. C. McKarns and R. H. Schwartz
Distinct Effects of TGF-{beta}1 on CD4+ and CD8+ T Cell Survival, Division, and IL-2 Production: A Role for T Cell Intrinsic Smad3
J. Immunol., February 15, 2005; 174(4): 2071 - 2083.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/4/F625    most recent
00152.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vrljicak, P.
Right arrow Articles by Gupta, I. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vrljicak, P.
Right arrow Articles by Gupta, I. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.