AJP - Renal Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 286: F1226-F1231, 2004. First published January 28, 2004; doi:10.1152/ajprenal.00378.2003
0363-6127/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/F1226    most recent
00378.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grossmann, C.
Right arrow Articles by Gekle, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grossmann, C.
Right arrow Articles by Gekle, M.

CALL FOR PAPERS
Aldosterone and ENaC: From Genetics to Physiology

Evidence for epidermal growth factor receptor as negative-feedback control in aldosterone-induced Na+ reabsorption

Claudia Grossmann, Ruth Freudinger, Sigrid Mildenberger, Alexander W. Krug, and Michael Gekle

Physiologisches Institut, University of Würzburg, 97070 Wurzburg, Germany

Submitted 29 October 2003 ; accepted in final form 21 January 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS AND DISCUSSION
 GRANTS
 REFERENCES
 
Aldosterone enhances Na+ reabsorption via epithelial Na+ channels (ENaC). Aldosterone also stimulates the protein kinase ERK1/2- and the epidermal growth factor (EGF) receptor (EGFR)-signaling pathway. Yet EGF and ERK1/2 are known inhibitors of ENaC-mediated Na+ reabsorption. In the present study, using the well-established Madin-Darby canine kidney C7 cell line, we tested the hypothesis that EGFR represents a negative-feedback control for chronic aldosterone-induced Na+ reabsorption [amiloride-inhibitable short-circuit current (Isc)]. Mineralocorticoid receptor expression was confirmed by RT-PCR and Western blot analysis. Aldosterone enhanced ERK1/2 phosphorylation in an EGFR-dependent way. Furthermore, aldosterone stimulated EGFR expression. Aldosterone (10 nmol/l) induced a small transient increase in Isc under control conditions. Inhibition of ERK1/2 phosphorylation with U-0126 (10 µmol/l) stimulated Isc, indicating constitutive ENaC inhibition. Aldosterone exerted a significantly larger effect in the presence of U-0126 than without U-0126. EGF (10 µg/l) inhibited Isc, whereas inhibition of EGFR kinase by tyrphostin AG-1478 (100 nmol/l) enhanced Isc. Aldosterone was more effective in the presence of AG-1478 than without AG-1478. In summary, we propose that the EGFR-signaling cascade can serve as a negative-feedback control to limit the effect of aldosterone-induced Na+ reabsorption.

extracellular signal-regulated kinase 1/2; Madin-Darby canine kidney C7 cells


SINCE THE DISCOVERY THAT aldosterone regulates NaCl reabsorption in epithelia, efforts have been expended in delineating the mechanisms of its action as well as its interaction with other hormones relevant for Na+ transport (27). Aldosterone binds to the cytosolic mineralocorticoid receptor (MR) (1), which modulates expression of such proteins as the epithelial Na+ channel (ENaC), the Na+-K+-ATPase, or the serum- and glucocorticoid-regulated kinase, thereby affecting Na+ reabsorption (1, 5, 11, 32, 35, 36). Aldosterone has the ability to interact with peptide hormone signaling (22), similar to angiotensin II and vasopressin (29, 39). Another important peptide-signaling "system" with respect to aldosterone is the epidermal growth factor (EGF) and its receptor (EGFR) (13, 22). It has been shown that aldosterone stimulates the EGF-EGFR-ERK1/2-signaling module (12, 22, 33). Aldosterone can also stimulate EGFR expression (21, 22). EGF regulates cell proliferation, differentiation, and tissue repair (18, 24). Furthermore, EGF affects epithelial salt transport in a cell-specific manner, leading to enhanced or reduced salt reabsorption (10, 19, 20, 26, 38). In renal collecting duct cells, EGF inhibits Na+ reabsorption via ERK1/2 (30). Thus aldosterone stimulates a signaling pathway (EGF-EGFR-ERK1/2) that acts in the opposite direction with respect to Na+ reabsorption in collecting duct cells. The potential functional consequence of this interaction is not known. Activation of an antagonistic signaling system would impose a negative feedback on the action of aldosterone. In the present study, we tested the hypothesis that EGFR can act as a negative-feedback control for chronic aldosterone-induced Na+ reabsorption in a cell culture system. For this purpose, we used the Madin-Darby canine kidney (MDCK) cell clone C7, which shows characteristics of principal cells, including ENaC-mediated Na+ transport (3, 15, 16, 23, 28). The data suggest that the EGFR-signaling cascade can serve as a negative-feedback control to limit the effect of aldosterone-induced Na+ reabsorption, at least in MDCK C7 cells.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS AND DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture. We used a subtype of MDCK cells, denominated C7 (MDCK C7), which has been cloned recently in our laboratory (16). MDCK C7 cells show characteristics of principal cells, including amiloride-sensitive Na+ transport and aldosterone responsiveness (3, 15, 16, 23, 28). Cells were cultivated in MEM supplemented with 10% fetal calf serum at 37°C and 5% CO2. At 24 h before the experiments, serum was removed from the medium. The cells were cultivated on permeable supports (Becton Dickinson, Heidelberg, Germany) or in 96-well plates [for phosphorylated ERK1/2 (pERK1/2) ELISA]. To rule out toxic effects during treatment, lactate dehydrogenase release was measured (2). No significant increase in lactate dehydrogenase release was detected.

Transmonolayer measurements. For the investigation of short-circuit current (Isc) and transepithelial resistance (Rte), cells were seeded near density [5 x 105 cells/cm2 (8)] on 4.9-cm2 permeable filters (Falcon, Heidelberg, Germany) that were placed in six-well dishes. Because Rte and transepithelial potential difference (PDte) were measured repeatedly over a period of several days, we used the voltohmmeter system (EVOM, WPI, Sarastoa, FL). The measurements were performed immediately after removal of the filters from the incubator, preventing a significant alteration of the milieu. Temperature was 32–36°C. From previous pH measurements, we know that CO2 remains stable during this time period. C7 cells lower pH slightly to ~7.3. Resistance of the filters alone (120 ± 5 {Omega}·cm2, n = 20) was measured in parallel and subtracted from the values measured for the monolayers. The equivalent Isc was calculated as PDte/Rte according to Ohm's law. Control experiments showed no loss of medium due to evaporation during the experimental period.

A second approach to investigate transepithelial reabsorptive transport was determination of dome formation (25, 34). Cells were seeded in 24-well dishes with a marked area of 25 mm2 each, and the number of >=50-µm-diameter domes in the marked areas was counted.

Western blot analysis. Cells were washed three times with ice-cold phosphate-buffered saline (PBS) and lysed in ice-cold Triton X-100 lysis buffer (50 mM Tris·HCl, pH 7.5, 100 mM NaCl, 5 mM EDTA, 200 µM sodium orthovanadate, 0.1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 1 µM pepstatin A, 40 mg/l bestatin, 2 mg/l aprotinin, and 1% Triton X-100) or RIPA buffer for 25 min at 4°C. Insoluble material was removed by centrifugation at 12,000 g for 15 min at 4°C. Cell lysates were matched for protein content, separated by SDS-PAGE, and transferred to a nitrocellulose membrane. Subsequently, membranes were blotted with a rabbit anti-pERK1/2 antibody (1:1,000; New England Biolabs, Beverly, MA), anti-EGFR antibody (1:1,000; catalog no. sc-03, Santa Cruz Biotechnology, Santa Cruz, CA), or anti-MR antibody (1:1,000; catalog no. sc-6860, Santa Cruz Biotechnology). The bound primary antibody was visualized using horseradish peroxidase-conjugated secondary IgG (1:25,000) and the ECL system (Amersham). Linearity of the signal has been verified by serial dilution as recommended by the manufacturer. Densitometric analysis was performed using Sigmagel 1.05 software (Jandel, Corte Madera, CA). We routinely used the flood, as well as the line, method to determine density. For the line method, three independent lines were quantified per band. Both methods gave similar results.

Quantification of ERK1/2 phosphorylation by ELISA. For quantification of ERK1/2 phosphorylation, we performed pERK1/2 ELISA according to Versteeg et al. (37). In control experiments, we compared the effect of EGF determined by Western blot analysis and pERK1/2 ELISA and found no significant difference, as described elsewhere (13). Thus the results obtained by Western blot analysis and pERK1/2 ELISA were pooled. The cells were seeded in 96-well plates (Maxisorp, Nunc) and serum starved for 24 h before the experiment. After stimulation, the cells were fixed with 4% formaldehyde in PBS for 20 min at room temperature and washed three times with PBS containing 0.1% Triton X-100. Endogenous peroxidase was quenched with 0.6% H2O2 in PBS-Triton X-100 for 20 min. The cells were washed three times in PBS-Triton X-100, blocked with 10% fetal calf serum in PBS-Triton X-100 for 1 h, and incubated overnight with the above-described primary antibody (1:1,000) in PBS-Triton X-100 containing 5% BSA at 4°C. On the following day, the cells were washed three times with PBS-Triton X-100 for 5 min and incubated with the secondary antibody (peroxidase-conjugated mouse anti-rabbit antibody, diluted 1:10,000) in PBS-Triton X-100 with 5% BSA for 1 h at room temperature and washed three times with PBS-Triton X-100 for 5 min and twice with PBS. Subsequently, the cells were incubated with 50 µl of a solution containing 0.4 mg/ml o-phenylenediamine, 11.8 mg/ml Na2HPO4, 7.3 mg/ml citric acid, and 0.015% H2O2 for 15 min at room temperature in the dark. The resulting signal was detected at 490 nm with a multiwell multilabel counter (Victor2, Wallac, Turku, Finland). After the peroxidase reaction, the cells were washed twice with PBS-Triton X-100 and twice with demineralized water. After the wells were dried for 5 min, trypan blue solution (100 µl, 0.2% in PBS) was added for 5 min at room temperature. Subsequently, the cells were washed four times with demineralized water, 1% SDS solution (100 µl) was added, and the cells were incubated on a shaker for 1 h at room temperature. Finally, the absorbance was measured at 595 nm with the ELISA reader (see above).

RT-PCR. RNA was isolated using the TRIzol reagent (Life Technologies). RT-PCR was performed using the SuperScript One-Step RT-PCR kit (Invitrogen, Karlsruhe, Germany). The MR primers were as follows: 5'ATCACGATCGGCTAGAGACC (forward) and 5'CCCATAATGGCATCCTGAAG (reverse). The reaction was carried out at an annealing temperature of 55°C for 35 cycles; product size was 244 bp. The primers span intron B of the MR. Therefore, the expected product will be obtained only if the template is mRNA.

Materials. U-0126, tyrphostin AG-1478, and compound 56 were obtained from Calbiochem (Bad Soden, Germany). Unless stated otherwise, all other materials were obtained from Sigma (Munich, Germany).

Statistics. Values are means ± SE; n represents the number of tissue culture dishes investigated. Significance of difference was tested by paired or unpaired Student's t-test or ANOVA as applicable. Differences were considered significant if P < 0.05. Cells from at least two different passages were used for each experimental series.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS AND DISCUSSION
 GRANTS
 REFERENCES
 
Because we wanted to investigate the long-term effects of aldosterone on Na+ transport, first, we tested whether the parameters of C7 cells cultivated on permeable supports are stable. Figure 1A shows that Rte and Isc are stable over 72 h once the monolayers are confluent. The transepithelial potential was also constant (5.2 ± 0.4 mV apical compartment negative, n = 24). ENaC-mediated Na+ transport in C7 cells has been shown in several studies (3, 23). The data shown in Fig. 1B confirm these studies. Isc is almost completely inhibited by 10 µmol/l amiloride. Similar results were obtained for all time periods and also during stimulation of Isc. Thus Isc is a suitable functional parameter for estimation of ENaC function. Although MDCK cells have been widely used to study effects of mineralocorticoids, expression of the MR in these cells has not been definitively determined. Western blot analysis showed a band of the expected size (Fig. 1C) in MDCK C7 cells, but not in opossum kidney cells, used as a negative control. MDCK C11 cells, for which we previously demonstrated expression of the MR by RT-PCR, also gave a band of the expected size (21). In addition, using an MR primer pair that spans intron B of the MR, we performed RT-PCR with RNA from MDCK C7 cells. The expected product obtained from RNA has a size of 244 bp. As shown in Fig. 1D, we obtained a product of the expected size. Thus MDCK C7 cells used in this study express endogenous MR spontaneously and represent a model system to investigate the modulation of ENaC function by mineralocorticoids.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. A: transepithelial resistance (Rte) and short-circuit current (Isc) in Madin-Darby canine kidney (MDCK) C7 cells. Rte and Isc were stable over a period of 96 h. Values are means ± SE; n = 15. B: 10 µM amiloride reduced Isc almost completely. Values are means ± SE; n = 6. C: Western blot analysis of mineralocorticoid receptor (MR) expression. A band of the expected size was detected in MDCK C7 (MDCK-7) and C11 (MDCK-11) cells, but not in opossum kidney (OK) cells. D: RT-PCR with RNA from C7 cells with MR-specific primers gave a product of the expected size (RNA from Chinese hamster ovary cells transfected with human MR were used as positive control). Thus C7 cells express MR.

 
Because we wanted to test the hypothesis that upregulation of the EGFR-signaling pathway by aldosterone may serve as a negative-feedback control system, we had to test whether aldosterone also exerts this effect in C7 cells. Because MDCK cells express EGF in addition to EGFR, they are subject to an autocrine activation loop, which is responsible for basal ERK1/2 phosphorylation (13, 31). We tested whether this autocrine activation loop is also present in our C7 clone. Using the ELISA technique described by Versteeg et al. (37) and adapted by us (22), we determined the effect of the EGFR kinase inhibitor tyrphostin AG-1478 on basal and stimulated ERK1/2 phosphorylation in C7 cells. EGF (10 µg/l) stimulated ERK1/2 phosphorylation to 210 ± 15% of control after 5 min (n = 9). Tyrphostin AG-1478 (100 nmol/l) reduced basal ERK1/2 phosphorylation almost completely (to 15 ± 6% of control, n = 6) and prevented the effect of EGF (22 ± 7% of control, n = 6). These data show that an autocrine activation loop involving EGF and EGFR is active in C7 cells also.

Figure 2A shows that long-term aldosterone exposure leads to enhanced ERK1/2 phosphorylation with only a minor increase in total ERK1/2 expression. Exposure to EGF also enhances ERK1/2 phosphorylation (Fig. 2A). Thus, in C7 cells, aldosterone and EGF elicit prolonged ERK1/2 activation (4). Using a pharmacological approach, we tested whether aldosterone-induced ERK1/2 phosphorylation depends on EGFR. The inhibitor of EGFR kinase, tyrphostin AG-1478 (100 nmol/l), prevented the aldosterone-induced increase in pERK1/2 (Fig. 2B). A similar effect was observed for an inhibitor of MEK, the kinase upstream of ERK1/2 (9). U-0126 (10 µmol/l) also prevented the aldosterone-induced increase of pERK1/2 (Fig. 2B). Finally, we tested whether aldosterone stimulates EGFR expression, as observed elsewhere in other cell types and after heterologous MR expression (17, 21). The Western blot analysis in Fig. 2C shows that aldosterone exposure stimulates EGFR expression in C7 cells after 24, 48, and 72 h. Expression was increased to 180% after 24 h, to 160% after 48 h, and to 190% after 72 h (average of 2 or 3 blots). In an additional series of experiments, we determined aldosterone-induced ERK phosphorylation after 24, 48, and 72 h and tested the inhibitory effect of two EGFR kinase inhibitors: tyrphostin AG-1478 (100 nmol/l) and compound 56 (100 nmol/l) (7). As shown in Fig. 2D, both inhibitors prevented aldosterone-induced ERK phosphorylation. Taken together, these data support the hypothesis that aldosterone stimulates the EGF-EGFR-signaling cascade in C7 cells. The question now was whether this signaling cascade antagonizes the action of aldosterone.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2. A: Western blot analysis of ERK1/2 phosphorylation (p) and ERK1/2 expression after 48 h of exposure to 10 nmol/l aldosterone (aldo) or 10 µg/l epidermal growth factor (EGF). B: MEK inhibitor U-0126 (10 µmol/l) as well as EGF receptor (EGFR) kinase inhibitor tyrphostin AG-1478 (100 nmol/l) prevented the effect of aldosterone on ERK1/2 phosphorylation. Incubation time = 48 h. C: aldosterone exposure (10 nmol/l) stimulated EGFR expression. D: time course of aldosterone (10 nmol/l)-induced ERK phosphorylation. Two inhibitors of EGFR kinase, AG-1478 (100 nmol/l) and compound 56 (c56, 100 nmol/l), prevented the action of aldosterone. Values are means ± SE; n = 6.

 
We and others previously showed that aldosterone, at high concentrations (1 µmol/l), stimulates Isc in C7 cells (3, 14, 16, 23). In this concentration range, aldosterone can act via the MR as well as via the glucocorticoid receptor. Therefore, we tested the effect of 10 nmol/l aldosterone on Isc. Figure 3A shows that aldosterone alone elicits a significant, although small, increase in Isc only after 24 h. Later, Isc returned to control level. One explanation for the transient effect of aldosterone is the existence of a negative-feedback loop. To test whether the inhibitory action of ERK1/2 contributes to a putative negative-feedback loop and limits the effect of aldosterone, we added an inhibitor of ERK1/2 activation, U-0126 (10 µmol/l). U-0126 alone led to a significant increase in Isc (Fig. 3A). These data are in good agreement with other studies describing the inhibitory action of ERK1/2 on ENaC (6). Furthermore, these data support our hypothesis of tonic suppression of ENaC by the EGF-EGFR autocrine activation loop. Interestingly, aldosterone stimulated Isc significantly in the presence of U-0126 (Fig. 3A). These data are in good agreement with the model depicted in Fig. 3B indicating that ERK1/2 antagonizes the stimulatory action of aldosterone on Na+ transport.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3. A: effects of aldosterone and the MEK inhibitor U-0126 on Rte and Isc in C7 cells. Values are means ± SE; n = 9. *P < 0.05. B: interaction of aldosterone and ERK1/2 with respect to the epithelial Na+ channel.

 
A classic stimulator of ERK1/2 is EGF, which acts via the EGFR. Because MDCK cells express EGFR (13), also shown in Fig. 2C, we tested whether it is possible to reproduce the inhibitory effect of EGF on ENaC (30) in C7 cells. Application of EGF (10 µg/l) reduced Isc significantly (Fig. 4A). The effect of EGF was strongest after 24 h, with a tendency to decline thereafter. The reason for this partial transient action of EGF is not known. Possibly, the concentration of EGF in the medium decreased or the cells reacted with an adaptive response. These data show that EGF also inhibits ENaC in C7 cells.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. A: effect of 10 µg/l EGF on Rte and Isc in C7 cells. Values are means ± SE; n = 12. *P < 0.05. B: effect of EGFR kinase inhibition by tyrphostin AG-1478 on basal and aldosterone-stimulated Isc in C7 cells. Values are means ± SE; n = 9. *P < 0.05. C: interaction of aldosterone and EGF with respect to the epithelial Na+ channel.

 
To test whether the autocrine EGF-EGFR activation loop is involved in the inhibition of aldosterone-induced stimulation of ENaC, we tested the effect of tyrphostin AG-1478 on Isc. Application of AG-1478 led to a slight increase in Isc, similar to U-0126 (Fig. 4B). Furthermore, AG-1478 and U-0126 prevented the action of EGF. In the presence of one of the two substances, EGF had no significant effect. These data support the hypothesis of an autocrine EGF-EGFR activation loop suppressing ENaC. In the presence of AG-1478, aldosterone significantly stimulated Isc (Fig. 4B), and this stimulatory effect was no longer transient (cf. Fig. 3A), indicating the absence of the negative-feedback control consisting of the autocrine EGF-EGFR activation loop. Taken together, these data allow us to extend our model (Fig. 4C): EGF antagonizes the stimulatory action of aldosterone on Na+ transport via ERK1/2.

In a final series of experiments, we investigated dome formation, another measure for reabsorptive transport (25, 34). Domes are localized regions of the monolayer sheet that are lifted off the culture dish as the result of net apical-to-basolateral movement of osmotically active constituents and water. Aldosterone induced a slight increase in dome formation (Fig. 5) that was significantly potentiated by 100 nmol/l AG-1478. Dome formation was inhibited by amiloride with an EC50 of ~1.26 µmol/l. Thus dome formation results mainly from amiloride-sensitive Na+ reabsorption. In some preliminary experiments, we overexpressed human EGFR (HER1) in C7 cells (22) and tested whether the effect of aldosterone is reduced. In mock-transfected cells, 10 nmol/l aldosterone induced a slight increase in Na+ transport (+25 ± 10%, n = 6); this was not the case in HER1-transfected cells (+2 ± 9%, n = 6). These data support the hypothesis that EGFR acts as a negative feedback on aldosterone.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5. A: 10 nmol/l aldosterone stimulates dome formation in C7 cells (24-h incubation). Effect of aldosterone is potentiated by 100 nmol/l tyrphostin AG-1478. B: amiloride led to a dose-dependent reduction of dome formation. Half-maximum effect (EC50) of amiloride was 1.26 µmol/l. Values are means ± SE; n = 4.

 
From our data, we conclude that EGF inhibits ENaC in C7 cells, as shown for the mCT1 cell line (30). Furthermore, the EGF-signaling pathway can exert a tonic suppressive effect on the action of aldosterone with respect to ENaC. Finally, aldosterone exerts a long-term stimulatory action on the EGF-signaling pathway. Thus aldosterone upregulates a signaling system that antagonizes its own action. Inhibition of the EGF-signaling pathway enhances the action of aldosterone. All these components form a negative-feedback loop and support the hypothesis that the EGF-signaling pathway helps prevent overstimulation of Na+ reabsorption by aldosterone. This is still a working hypothesis, and further work is required to show that these mechanisms are also active in native tissue and affect Na+ excretion in vivo.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS AND DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by Deutsche Forschungsgemeinschaft Grants Ge 905/4-2, 4-3, and Ge 905/8-1.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. Gekle, Physiologisches Institut, Universität Würzburg, Röntgenring 9, 97070 Würzburg, Germany (E-mail: michael.gekle{at}mail.uni-wuerzburg.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS AND DISCUSSION
 GRANTS
 REFERENCES
 

  1. Arriza JL, Weinberger C, Cerelli G, Glaser TM, Handelin BL, Housman DE, and Evans RM. Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237: 268–275, 1987.[Abstract/Free Full Text]
  2. Bergmeyer HU and Bernt E. Methoden der enzymatischen Analyse. Weinheim: Verlag Chemie, 1974, p. 607–612.
  3. Blazer-Yost BL, Record RD, and Oberleithner H. Characterization of hormone-stimulated Na+ transport in a high-resistance clone of the MDCK cell line. Pflügers Arch 432: 685–691, 1996.[CrossRef][ISI][Medline]
  4. Bokemeyer D, Sorokin A, and Dunn MJ. Multiple intracellular MAP kinase signaling cascades. Kidney Int 49: 1187–1198, 1996.[ISI][Medline]
  5. Bonvalet JP. Regulation of sodium transport by steroid hormones. Kidney Int 53: S49–S56, 1998.
  6. Booth RE and Stockand JD. Targeted degradation of ENaC in response to PKC activation of the ERK1/2 cascade. Am J Physiol Renal Physiol 284: F938–F947, 2003.[Abstract/Free Full Text]
  7. Bridges AJ, Zhou H, Cody DR, Rewcastle GW, McMichael A, Showalter HD, Fry DW, Kraker AJ, and Denny WA. Tyrosine kinase inhibitors. 8. An unusually steep structure-activity relationship for analogues of 4-(3-bromoanilino)-6,7-dimethoxyquinazoline (PD 153035), a potent inhibitor of the epidermal growth factor receptor. J Med Chem 39: 267–276, 1996.[CrossRef][ISI][Medline]
  8. Cereijido M, Robbins ES, Dolan WJ, Rotunno CA, and Sabatini DD. Polarized monolayers formed by epithelial cells on a permeable and translucent support. J Cell Biol 77: 853–880, 1978.[Abstract/Free Full Text]
  9. Crews CM, Alessandrini A, and Erikson RL. The primary structure of MEK, a protein kinase that phosphorylates the ERK gene product. Science 258: 478–480, 1992.[Abstract/Free Full Text]
  10. Danto SI, Borok Z, Zhang XL, Lopez MZ, Patel P, Crandall ED, and Lubman RL. Mechanisms of EGF-induced stimulation of sodium reabsorption by alveolar epithelial cells. Am J Physiol Cell Physiol 275: C82–C92, 1998.[Abstract/Free Full Text]
  11. Eaton DC, Malik B, Saxena NC, Al-Khalili OK, and Yue G. Mechanisms of aldosterone's action on epithelial Na+ transport. J Membr Biol 184: 313–319, 2001.[CrossRef][ISI][Medline]
  12. Fiebeler A, Schmidt F, Muller DN, Park JK, Dechend R, Bieringer M, Shagdarsuren E, Breu V, Haller H, and Luft FC. Mineralocorticoid receptor affects AP-1 and nuclear factor-{kappa}B activation in angiotensin II-induced cardiac injury. Hypertension 37: 787–793, 2001.[Abstract/Free Full Text]
  13. Gekle M, Freudinger R, Mildenberger S, and Silbernagl S. Aldosterone interaction with epidermal growth factor receptor signaling in MDCK cells. Am J Physiol Renal Physiol 282: F669–F679, 2002.[Abstract/Free Full Text]
  14. Gekle M, Gabner B, Freudinger R, Mildenberger S, Silbernagl S, Pfaller W, and Schramek H. Characterization of an ochratoxin-A-dedifferentiated and cloned renal epithelial cell line. Toxicol Appl Pharmacol 152: 282–291, 1998.[CrossRef][ISI][Medline]
  15. Gekle M, Golenhofen N, Oberleithner H, and Silbernagl S. Rapid activation of Na+/H+-exchange by aldosterone in renal epithelial cells requires Ca2+ and stimulation of a plasma membrane proton conductance. Proc Natl Acad Sci USA 93: 10500–10504, 1996.[Abstract/Free Full Text]
  16. Gekle M, Wünsch S, Oberleithner H, and Silbernagl S. Characterization of two MDCK-cell subtypes as a model system to study principal and intercalated cell properties. Pflügers Arch 428: 157–162, 1994.[CrossRef][ISI][Medline]
  17. Govindan MV and Warriar N. Reconstitution of the N-terminal transcription activation function of human mineralocorticoid receptor in a defective human glucocorticoid receptor. J Biol Chem 273: 24439–24447, 1999.
  18. Hackel PO, Zwick E, Prenzel N, and Ullrich A. Epidermal growth factor receptors: critical mediators of multiple receptor pathways. Curr Opin Cell Biol 11: 184–189, 1999.[CrossRef][ISI][Medline]
  19. Keely SJ, Uribe JM, and Barrett KE. Carbachol stimulates transactivation of epidermal growth factor receptor and mitogen-activated protein kinase in T84 cells. Implications for carbachol-stimulated chloride secretion. J Biol Chem 273: 27111–27117, 1998.[Abstract/Free Full Text]
  20. Khurana S, Nath SK, Levine SA, Bowser JM, Tse CM, Cohen ME, and Donowitz M. Brush border phosphatidylinositol 3-kinase mediates epidermal growth factor stimulation of intestinal NaCl absorption and Na+/H+ exchange. J Biol Chem 271: 9919–9927, 1996.[Abstract/Free Full Text]
  21. Krug AW, Grossmann C, Schuster C, Freudinger R, Mildenberger S, Govindan MV, and Gekle M. Aldosterone stimulates epidermal growth factor receptor (EGFR) expression. J Biol Chem 278: 43060–43066, 2003.[Abstract/Free Full Text]
  22. Krug AW, Schuster C, Gassner B, Freudinger R, Mildenberger S, Troppmair J, and Gekle M. Human EGF receptor 1 (HER1) expression renders CHO cells sensitive to alternative aldosterone signaling. J Biol Chem 277: 45892–45897, 2002.[Abstract/Free Full Text]
  23. Mick VE, Itani OA, Loftus RW, Husted RF, Schmidt TJ, and Thomas CP. The {alpha}-subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5'-flanking region of the gene. Mol Endocrinol 15: 575–588, 2001.[Abstract/Free Full Text]
  24. Moghal N and Sternberg PW. Multiple positive and negative regulators of signaling by the EGF-receptor. Curr Opin Cell Biol 11: 190–196, 1999.[CrossRef][ISI][Medline]
  25. Oberleithner H, Vogel U, and Kersting U. Madin-Darby canine kidney cells. I. Aldosterone-induced domes and their evaluation as a model system. Pflügers Arch 416: 526–532, 1990.[CrossRef][ISI][Medline]
  26. Ookawara S, Tabei K, Furuya H, and Asano Y. The effect of EGF on electrolyte transport is mediated by tyrosine kinases in the rabbit cortical collecting duct. Miner Electrolyte Metab 25: 191–198, 1999.[CrossRef][ISI][Medline]
  27. Schafer JA. Abnormal regulation of ENaC: syndromes of salt retention and salt wasting by the collecting duct. Am J Physiol Renal Physiol 283: F221–F235, 2002.[Abstract/Free Full Text]
  28. Schramek H, Sorokin A, Watson RD, and Dunn MJ. Differential long-term regulation of MEK and of p42 MAPK in rat glomerular mesangial cells. Am J Physiol Cell Physiol 270: C40–C48, 1996.[Abstract/Free Full Text]
  29. Schwab A and Oberleithner H. The early response to aldosterone in the kidney. In: Genomic and Non-Genomic Effects of Aldosterone, edited by Wehling M. Boca Raton, FL: CRC, 1995, p. 51–76.
  30. Shen JP and Cotton CU. Epidermal growth factor inhibits amiloride-sensitive sodium absorption in renal collecting duct cells. Am J Physiol Renal Physiol 284: F57–F64, 2003.[Abstract/Free Full Text]
  31. Shi W, Fan H, Shum L, and Derynck R. The tetraspanin CD9 associates with transmembrane TGF-{alpha} and regulates TGF-{alpha}-induced EGF receptor activation and cell proliferation. J Cell Biol 148: 591–601, 2000.[Abstract/Free Full Text]
  32. Stockand JD. New ideas about aldosterone signaling in epithelia. Am J Physiol Renal Physiol 282: F559–F576, 2002.[Abstract/Free Full Text]
  33. Stockand JD and Meszaros JG. Aldosterone stimulates proliferation of cardiac fibroblasts by activating Ki-RasA and MAPK1/2 signaling. Am J Physiol Heart Circ Physiol 284: H176–H184, 2003.[Abstract/Free Full Text]
  34. Tanner C, Frambach DA, and Misfeldt DS. Transepithelial transport in cell culture. A theoretical and experimental analysis of the biophysical properties of domes. Biophys J 43: 183–190, 1983.[Abstract/Free Full Text]
  35. Verrey F. Early aldosterone action: toward filling the gap between transcription and transport. Am J Physiol Renal Physiol 277: F319–F327, 1999.[Abstract/Free Full Text]
  36. Verrey F, Pearce D, Pfeiffer R, Spindler B, Mastroberardino L, Summa V, and Zecevic M. Pleiotropic action of aldosterone in epithelia mediated by transcription and post-transcription mechanisms. Kidney Int 57: 1277–1282, 2000.[CrossRef][ISI][Medline]
  37. Versteeg HH, Nijhuis E, Van den Brink GR, Evertzen M, Pynaert GN, van Deventer SJ, Coffer PJ, and Peppelenbosch MP. A new phosphospecific cell-based ELISA for p42/p44 mitogen-activated protein kinase (MAPK), p38 MAPK, protein kinase B and cAMP-response-element-binding protein. Biochem J 350: 717–722, 2000.
  38. Warden DH and Stokes JB. EGF and PGE2 inhibit rabbit CCD Na+ transport by different mechanisms: PGE2 inhibits Na+-K+ pump. Am J Physiol Renal Fluid Electrolyte Physiol 264: F670–F677, 1993.[Abstract/Free Full Text]
  39. Wehling M, Neylon CB, Fullerton M, Bobik A, and Funder JW. Nongenomic effects of aldosterone on intracellular Ca2+ in vascular smooth muscle cells. Circ Res 76: 973–979, 1995.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
HypertensionHome page
H. A. Drummond, N. L. Jernigan, and S. C. Grifoni
Sensing Tension: Epithelial Sodium Channel/Acid-Sensing Ion Channel Proteins in Cardiovascular Homeostasis
Hypertension, May 1, 2008; 51(5): 1265 - 1271.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Grossmann, R. Freudinger, S. Mildenberger, B. Husse, and M. Gekle
EF Domains Are Sufficient for Nongenomic Mineralocorticoid Receptor Actions
J. Biol. Chem., March 14, 2008; 283(11): 7109 - 7116.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Soodvilai, A. Chatsudthipong, and V. Chatsudthipong
Role of MAPK and PKA in regulation of rbOCT2-mediated renal organic cation transport
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F21 - F27.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Taruno, N. Niisato, and Y. Marunaka
Hypotonicity stimulates renal epithelial sodium transport by activating JNK via receptor tyrosine kinases
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F128 - F138.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. W. Good
Nongenomic Actions of Aldosterone on the Renal Tubule
Hypertension, April 1, 2007; 49(4): 728 - 739.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. C. Grifoni, K. P. Gannon, D. E. Stec, and H. A. Drummond
ENaC proteins contribute to VSMC migration
Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H3076 - H3086.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
V. Bhalla, R. Soundararajan, A. C. Pao, H. Li, and D. Pearce
Disinhibitory pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ
Am J Physiol Renal Physiol, October 1, 2006; 291(4): F714 - F721.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. Markadieu, R. Crutzen, D. Blero, C. Erneux, and R. Beauwens
Hydrogen peroxide and epidermal growth factor activate phosphatidylinositol 3-kinase and increase sodium transport in A6 cell monolayers
Am J Physiol Renal Physiol, June 1, 2005; 288(6): F1201 - F1212.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/F1226    most recent
00378.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grossmann, C.
Right arrow Articles by Gekle, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grossmann, C.
Right arrow Articles by Gekle, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.