AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 287: F17-F24, 2004. First published March 16, 2004; doi:10.1152/ajprenal.00397.2003
0363-6127/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/1/F17    most recent
00397.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, W.
Right arrow Articles by Cohen, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, W.
Right arrow Articles by Cohen, D. M.

Renal expression of osmotically responsive cation channel TRPV4 is restricted to water-impermeant nephron segments

Wei Tian,1,* Michele Salanova,2,* Hongshi Xu,1 Jessie N. Lindsley,1 Terry T. Oyama,1 Sharon Anderson,1 Sebastian Bachmann,2 and David M. Cohen1

1Division of Nephrology and Hypertension, Oregon Health and Science University and the Portland Veterans Affairs Medical Center, Portland, Oregon 97239; and 2Department of Anatomy, Charite School of Medicine, 10115 Berlin, Germany

Submitted 10 November 2003 ; accepted in final form 4 March 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
TRPV4, a nonselective cation channel of the transient receptor potential (TRP) family, is gated by hypotonicity. Expression of TRPV4 mRNA has been detected in the circumventricular organs of the brain responsible for sensing systemic tonicity and in the kidney distal convoluted tubule (DCT), among other sites. No analysis of TRPV4 expression at the protein level has been undertaken and no systematic analysis of expression of this channel has been reported in the kidney. Via RNAse protection assay and immunoblotting, abundant expression of TRPV4 was detected in the cortex, medulla, and papilla. The expression pattern of TRPV4 was characterized in both rat and mouse kidney, which revealed similar patterns of immunoreactivity. TRPV4 expression was absent from the proximal tubule (PT) and descending thin limb (DTL), whereas the strongest expression was observed in the ascending thin limb (ATL). The thick ascending limb (TAL) was strongly positive as was the DCT and connecting tubule. Importantly, the water-permeant cells of the macula densa were unstained. Moderate TRPV4 expression was noted in all collecting duct portions and in papillary epithelium; intercalated cells (type A) exhibited a particularly strong signal. In all positive segments, TRPV4 expression was concentrated at the basolateral membrane. Therefore, TRPV4 is expressed in only those nephron segments that are constitutively (i.e., ATL, TAL, and DCT) or conditionally (i.e., collecting duct) water impermeant and where generation of a substantial transcellular osmotic gradient could be expected. TRPV4 expression is absent from nephron segments exhibiting constitutive water permeability and unregulated apical aquaporin expression (i.e., PT and DTL). These data, although circumstantial, are consistent with a role for TRPV4 in the response to anisotonicity in the mammalian kidney.

water permeability; transient receptor potential


THE CATION CHANNEL TRPV4 was identified as a mammalian homolog (12, 21) of the Caenorhabditis elegans osmosensory protein OSM-9 (6). Although it had been described in other (principally mechanosensory) contexts (7, 26), these two reports were the first to attribute an osmotic sensing or effecting role to this protein in mammals. TRPV4 is a member of the transient receptor potential (TRP) family of cation channels named for its founding member (15). Electrophysiologically, TRPV4 is a nonselective outwardly rectifying cation channel activated by cell swelling in many experimental contexts (reviewed in Ref. 18). Progress has been made toward elucidating the molecular mechanism of TRPV4 gating by hypotonicity (22, 27), although other potential physiological agonists have recently been described (5, 8, 9, 2325).

Via in situ hybridization, TRPV4 mRNA expression was noted in the circumventricular organs of the brain that are believed to sense systemic tonicity (12). This observation underscored a potential role for TRPV4 in osmoregulation. In further support of either a mechanosensory or osmoregulatory role, TRPV4 expression has also been described in the epithelial lining of sweat glands (7) and in the cochlear hair cells of the inner ear (12).

TRPV4 mRNA was detected in the kidney (12, 21, 26), where in situ hybridization demonstrated expression in the distal convoluted tubule (DCT) (12, 21). TRPV4 –/– mice exhibit subtle perturbations in water handling that may be dramatically unmasked under conditions of physiological stress (13, 14). We observed significant expression of TRPV4 in the kidney cortex, medulla, and papilla. We therefore undertook a systematic analysis of renal TRPV4 expression to gain insight into its potential physiological role(s).


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
RNase protection assay and immunoblotting. For a RNase protection assay using RNA harvested from rat kidney tissue, a 315-bp fragment of rat TRPV4 3'-UTR was PCR-amplified from reverse-transcribed cDNA prepared from rat kidney mRNA using the following primer pair (written in 5' to 3' orientation): forward primer rTRPV4–2753-5' (gctcccacctacatttcagc) and rTRPV4–3060-3 (tccagctgcaggtagactcc). An additional 329-bp fragment of rTRPV4 coding sequence was amplified using primer pair rTRPV4–772-5' (atcaactcgcccttcagaga) and rTRPV4–1110-3' (ggtgttctctcgggtgttgt). PCR-generated fragments were T-A subcloned into pCR4 and linearized with SpeI. A biotinylated riboprobe was prepared from these partial cDNA sequences and used for the RNase protection assay with RNA harvested from rat tissue. For RNA preparation, rat kidney was grossly dissected into the cortex, medulla (including inner and outer medulla, but devoid of papilla), and papilla and then snap-frozen in liquid nitrogen. For the RNase protection assay, 20 µg of total RNA and 1.6 ng of labeled riboprobe were used per hybridization reaction (i.e., gel lane). Control hybridizations were performed in parallel with the rat actin riboprobe to ensure uniformity of lane loading across experimental conditions. RNA and protein extracts were isolated in parallel with TRIzol reagent in accordance with the manufacturer's instructions (LIFE Technologies). Protein extracts (20 µg) were used for immunoblotting with polyclonal rabbit anti-TRPV4 at 1:1,000 dilution as previously described (27). The secondary antibody was goat anti-rabbit-horseradish peroxidase at 1:4,000, and visualization was via Chemiluminescence Plus reagent (Perkin-Elmer Life Science).

Tissue preparation for immunohistochemistry. For preliminary studies with rat renal tissue addressing specificity of anti-TRPV4 antibody, kidneys were excised from male Sprague-Dawley rats (~200 g; Harlan) and immersed in 10% formalin. These studies were approved by the Portland Veterans Affairs Institutional Animal Care and Use Subcommittee. Fixed kidneys were dehydrated through a graded series of ethanols, embedded in paraffin, sectioned at 4-µm thickness, and placed onto glass slides (Portland Tissue Processing, Portland, OR). For detailed immunofluorescence studies with both murine and rat renal tissue, animals were perfused in retrograde fashion through the abdominal aorta using 0.1 M cacodylate buffer containing 4% hydroxyethyl starch (HAES), pH 7.4, for 20 s, followed by a solution of 3% paraformaldehyde in cacodylate buffer/HAES for another 5 min. Perfusion pressure was adjusted to 200 mmHg. Both kidneys were then removed and cut into small pieces. The pieces were shock-frozen in liquid nitrogen-cooled isopentane and stored at –70°C for subsequent cryostat sectioning.

Antibodies. Primary antibodies were as follows: anti-TRPV4, polyclonal antibody raised in rabbit, dilution 1:800 (27); anti-human Tamm-Horsfall protein (anti-THP), polyclonal antibody raised in sheep, dilution 1:800 (Bio Trend, Köln, Germany); anti-parvalbumin (anti-rat parvalbumin), polyclonal antibody raised in goat, dilution 1:5,000 (Swant Swiss antibodies); anti-NCC (anti-mouse thiazide-sensitive Na+-Cl cotransporter), polyclonal antibody raised in rabbit, dilution 1:500 (D. H. Ellison, Portland, OR); anti-aquaporin 2 (AQP-2; anti-rat AQP-2), polyclonal antibody raised in goat (gift from E. Klussmann, Campus Berlin-Buch, Berlin, Germany); band 3 (anti-band 3), polyclonal antibody raised in rabbit, diluted 1:1,000 (gift from T. Jöns, Berlin, Germany); anti-AQP-1 (anti-rat AQP-1), polyclonal antibody raised in rabbit, diluted 1:200 (Alpha Diagnostic Laboratory, catalog AQP11-A). With the exception of anti-TRPV4, these antibodies have been well characterized elsewhere in previous studies (e.g., Refs. 10, 20). On immunoblots, the band detected by anti-TRPV4 migrated more slowly than the predicted molecular mass of TRPV4 would suggest. We suspect that this is a consequence of glycosylation (27) and perhaps constitutive phosphorylation. Importantly, native and heterologously expressed TRPV4 exhibit similar apparent molecular masses on immunoblots (27), although splice variants have been deposited in the Entrez Nucleotides Database (www.ncbi.nlm.nih.gov/entrez). For immunoblot- and immunohistochemistry-based peptide competition experiments, TRPV4 immunizing peptide (CDGHQQGYAPKWRTDDAPL; Ref. 27) at 1–10 µg/ml was preincubated with an equal volume of affinity-purified antiserum for 20 min at 25°C, as recommended by the manufacturer (Alpha Diagnostic International).

Immunostaining procedure. For murine renal tissue, 4-µm-thick cryostat sections were cut. Sections were blocked with 5% normal goat serum in 0.3% PBS/Tween 20 and then incubated at room temperature for 1 h and then overnight with primary antibody in a humidified chamber. Bound primary antibody was visualized using Cy3-conjugated secondary antibody. For double-staining experiments, the two primary antibodies were incubated independently to avoid cross-reactivity between them. TRPV4 antibody was applied first, followed by washes and incubation with one fluorochrome-conjugated secondary antibody. Then, a second primary antibody was applied, followed by washes and incubation with a second fluorochrome-conjugated secondary antibody. Rabbit primary antibodies were visualized with anti-rabbit Cy2-conjugated secondary antibodies (Molecular Probes). Sheep, goat, and guinea pig primary antibodies were visualized with Cy3-conjugated secondary antibodies (DIANOVA, Hamburg, Germany). Because band 3, NCC, and TRPV4 were all rabbit antibodies, consecutive sections with the respective antibodies were evaluated. For rat kidney tissue, immunohistochemical demonstration of TRPV4 was performed in accordance with published methods (11). Immunostained specimens were analyzed with a Leica DMRB light microscope. Images were acquired using a digital camera (SPOT) and processed with MetaVue software.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In the kidney, TRPV4 expression has been reported only in the DCT and only at the mRNA level (12, 21). Because of its postulated osmotic sensing or effecting role, we sought TRPV4 expression elsewhere in the kidney. We generated two antisense riboprobes suitable for the RNase protection assay, using both rat TRPV4 3'-UTR and coding sequence. Abundant expression of TRPV4 mRNA was detected in all three kidney regions with both probes (Fig. 1). This suggested TRPV4 expression in sites other than the cortex, where the DCT resides. Using an affinity-purified rabbit polyclonal anti-TRPV4 antibody (27), we demonstrated TRPV4-like immunoreactivity in rat kidney lysates prepared from all three regions, with the strongest expression in the papilla and the weakest in the cortex (Fig. 1). We earlier reported that renal expression was strongest in the cortex (27). However, those data were acquired using a commercially available immunoblot and the papilla is technically challenging to isolate. To confirm that the immunodetectable band represented bona fide TRPV4, control experiments were performed in the presence and absence of immunogenizing peptide as a competitor (CDGHQQGYAPKWRTDDAPL; Ref. 27). On immunoblots, the faint band corresponding to native TRPV4 in the mDCT cell line (27) was fully competed by excess peptide, as was the abundant band detected in human embryonic kidney cells stably transfected with epitope-tagged murine TRPV4 (Fig. 2, top). Importantly, the nonspecific bands remained unaffected.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 1. TRPV4 expression at the mRNA and protein levels in the rat kidney. An RNase protection assay of total rat RNA isolated from the cortex, medulla, and papilla and hybridized with antisense riboprobe directed against a region of rat TRPV4 3' UTR (top) or coding sequence (middle; see METHODS) was performed. Right-most lane: undigested riboprobe. Bottom: anti-TRPV4 immunoblot of whole cell lysates prepared from the rat kidney cortex, medulla, and papilla. Top and middle: filled arrowhead denotes TRPV4-protected RNA fragment; open arrowhead indicates undigested probe, of which a small amount persists even in hybridization lanes. Bottom: filled arrowhead denotes TRPV4. Migration of molecular mass markers (expressed in kDa) is shown.

 


View larger version (135K):
[in this window]
[in a new window]
 
Fig. 2. Demonstration of the specificity of rabbit polyclonal anti-TRPV4 antibody. Top: detergent lysates prepared from cultured naive medullary distal convoluted tubule (mDCT) cells and from human embryonic kidney (HEK) cells stably transfected with murine TRPV4. Anti-TRPV4 immunoreactivity (open arrows) was detected in lysates in the absence of peptide competition (– peptide) but not in the presence of excess peptide competitor (+ peptide). Nonspecific bands remained unaffected. Of note, heterologously expressed TRPV4 was epitope-tagged (27) and migrated slightly more slowly. Bottom: anti-TRPV4 immunoreactivity observed in tubule segments morphologically consistent with DCT in the absence of peptide competition (A; TRPV4 – peptide) was abrogated by inclusion of peptide competitor (B; TRPV4 + peptide). The immunostaining pattern characteristic of the rabbit anti-TRPV4 antibody (C; immune) was not observed using preimmune serum from the same rabbit (D; preimmune).

 
We performed immunohistochemistry on rat renal cortical tissue using our anti-TRPV4 antibody. Consistent with the observations of Strotmann et al. (21), who used in situ hybridization, we detected abundant TRPV4 protein expression in tubule segments morphologically consistent with DCT (Fig. 2A). Coincubation of slides with competing immunizing peptide blocked this nephron segment-specific immunostaining pattern (Fig. 2B). Compared with anti-TRPV4 antibody (Fig. 2C), preimmune serum from the same rabbit failed to specifically stain tubule segments (Fig. 2D). These data demonstrated the utility of the anti-TRPV4 antibody for immunohistochemical analysis in rodent kidney.

To ascertain in detail the pattern of renal expression of TRPV4, antibody staining was performed using immunoperoxidase-based and immunofluorescence-based techniques. For the latter approach, secondary antibodies conjugated to different fluorochromes were used to permit double staining.

The distribution of renal anti-TRPV4 immunoreactivity was similar in the rat and mouse, based on studies performed with identical incubations for each species. Describing the distinct nephron segments in the direction of urine flow, TRPV4 immunoreactivity was absent from the glomerulus, proximal tubule (PT), and descending thin limb (DTL). The DTL was identified structurally at its origin by contiguity with the PT and identified immunohistochemically at its terminus by transition into the ascending thin limb (ATL) at the genu of Henle's loop. TRPV4 expression typically appeared abruptly several cell diameters before the genu (Fig. 3A); expression in this segment is shown in longitudinal (Fig. 3A) and cross-sectional (Fig. 3B) views of the papilla. The absence of TRPV4 expression in the DTL was demonstrated by immunostaining for the DTL marker, AQP-1. In the depicted example of the papilla (cross-sectional view; Fig. 3, B and C), TRPV4 and AQP-1 immunoreactivity are mutually exclusive. In long-looped nephrons, the ATLs were very strongly positive for TRPV4 throughout their course in the papilla and inner medulla to the junction with the thick ascending limbs (TAL; Fig. 3, AF). Staining was clearly concentrated in the basolateral membrane of ATL epithelium. In nephrons with short loops, TRPV4 immunoreactivity typically began with the abrupt onset of the TAL epithelium.



View larger version (123K):
[in this window]
[in a new window]
 
Fig. 3. Immunohistochemical identification of TRPV4 immunoreactivity in the rat (AC) and mouse (DJ) kidney. AC: immunoperoxidase staining with hematoxylin counterstaining of rat kidney; strong TRPV4 signal is seen in longitudinally sectioned (A) and cross-sectioned (B) ascending thin limbs (ATL) of the papilla. A: only a few cells of the descending thin limbs (DTL) proximal to the junction with ATL express TRPV4. C: section adjacent to B incubated with anti-aquaporin (AQP)-1 antibody demonstrating mutual exclusivity. Arrows denote ATL staining for TRPV4 (B) but not AQP1 (C). DJ: immunofluorescence staining in mouse kidney. Double staining of TRPV4 (green, D) and THP (red, E) and merged image (F) of the junction of inner and outer medulla (broken lines) revealing the transition of TRPV4-positive ATL into thick ascending limbs (TAL) coimmunostained with anti-THP. G: detail of a transition of strongly TRPV4-immunoreactive ATL (bottom) to typically less stained TAL (top) indicated by thin lines. H: dominant TRPV4 staining of TAL segments in a medullary ray. I and J: TAL contacting the glomerulus showing absence of TRPV4 immunoreactivity in macula densa (between thin lines; J: differential interference contrast view of same field). Magnifications are indicated by the horizontal bars.

 
For studies of the distal nephron, double- or parallel-staining techniques were used that combined anti-TRPV4 antibody with a nephron segment-specific marker. Specifically, segments were identified as follows: TAL was identified by immunostaining with anti-THP; DCT by anti-parvalbumin; anti-NCC, connecting tubule (CNT), and collecting duct by anti-AQP-2; and intercalated cells by anti-band 3. In addition, microanatomic criteria such as zonal location, vicinity to interlobular vessels, and identification of segment transitions were used for localization of distal nephron subdivisions in accordance with established criteria (3, 4). TRPV4 immunoreactivity was pronounced in the TAL, although less so than in adjacent ATL (Fig. 3, DG). The TAL staining localized principally to the basolateral membrane. This subcellular distribution was evident along all distal nephron segments with the exception of the macula densa (Fig. 3, I and J); cells of this specialized region of the TAL were devoid of TRPV4 immunoreactivity. Medullary and cortical TAL (Fig. 3, D-J), DCT (Fig. 4F), and CNT (Fig. 4, G and H) were all strongly positive for TRPV4 at their densely folded basolateral membranes. Type A intercalated cells within these segments showed particularly strong staining of TRPV4 along basal and lateral cell borders, coincident with band 3 immunoreactivity (Fig. 4, I and J).



View larger version (85K):
[in this window]
[in a new window]
 
Fig. 4. Immunohistochemical identification of TRPV4 immunoreactivity in the mouse (AE and IM) and rat (FH) kidney. AC: double immunofluorescence staining of TRPV4 (green, A) and parvalbumin (red, B) and merged image (C) showing DCT profiles (circles). Transition from TAL (+) to DCT is indicated by bars. D and E: double immunofluorescence staining of TRPV4 (green, D) and NCC (red, E) depicting coexpression in DCT (circles). F: immunoperoxidase staining with hematoxylin counterstaining; strong signal is evident in the distal convolutions near the glomeruli (detail at Fig. 2C). G and H: double immunofluorescence staining for TRPV4 (green, G) and AQP-2 (red, H) showing coincident staining in connecting tubule (*) and cortical collecting duct (square). I and J: immunofluorescence staining for TRPV4 (green, I) and band 3 (red, J) on consecutive sections (hence incomplete superimposability of images). Strong basolateral staining is present on intercalated cells positive for band 3 (arrows). KM: TRPV4 immunofluorescence in inner medullary cross section. Collecting duct profiles (squares) show strong basolateral TRPV4, and luminal AQP2 staining, whereas ATL profiles show only TRPV4 label (merge). Magnifications are indicated by the horizontal bars.

 
In the collecting duct, TRPV4 immunoreactivity was moderate from the cortex to papillary tip (Fig. 4, IM). In the mouse, the papillary surface epithelium also stained for TRPV4; although basolateral, as elsewhere, this staining was quite weak (data not shown). Intercalated cells of cortical, outer, and initial inner medullary collecting ducts were identified by parallel staining with anti-band 3 antibody (Fig. 4, I and J); they displayed strong lateral and basal staining, consistent with their appearance in the distal convolutions.

A model for TRPV4 expression is shown in Fig. 5. TRPV4 expression is absent in tubule segments proximal to the junction between the DTL and ATL (at the genu of Henle's loop). Expression is universal distal to this junction with the sole exception of the macula densa (Fig. 5A). Constitutive apical water permeability (Fig. 5B) and TRPV4 expression appear to be mutually exclusive.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. Summary of expression pattern of TRPV4 along the mouse and rat nephron. A: anti-TRPV4 immunoreactivity is shown in red. Type A intercalated cells of the collecting duct are highlighted because they exceed the principal cells in signal strength. Proximal to the junction of DTL and ATL, TRPV4 expression is absent; distal to this junction, only the macula densa is devoid of TRPV4 expression. B: blue coloration indicates tubule segments exhibiting constitutive apical water permeability. These regions and TRPV4-positive regions appear to be mutually exclusive.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
It is striking that the osmoresponsive cation channel TRPV4 localizes to only those nephron segments exhibiting either absolute or conditional impermeability to water. The PT and DTL are the sites of luminal AQP-1 expression (17, 19); here, rapid and essentially unregulated passive water absorption from the glomerular ultrafiltrate takes place (reviewed in Ref. 16). These nephron segments, devoid of a luminal-interstital osmotic gradient, lack TRPV4 expression. At the junction of the DTL and ATL of Henle's loop, where AQP-1 expression and passive water absorption abruptly cease, and a luminal-to-interstitial osmotic gradient abruptly emerges, TRPV4 expression suddenly appears. TRPV4 expression along the ATL is abundant and uniform. In the water-impermeant TAL, where filtrate is rendered hypotonic via the actions of the bumetanide-sensitive Na+-K+-2Cl cotransporter, among other transport proteins, TRPV4 expression remains abundant. Similarly, high levels of expression are evident in the water-impermeant DCT. In the absence of ADH, the cortical and medullary collecting ducts are functionally water impermeant. TRPV4 expression is correspondingly high in these segments. The ADH-unresponsive intercalated cells lacking plasma membrane water channels exhibit greater TRPV4 expression than their conditionally AQP-expressing and ADH-responsive principal cell brethren.

Although TRPV4 is expressed throughout all nephron segments distal to the junction of the DTL and ATL, a single exception was noted: the cells of the macula densa lack TRPV4 immunoreactivity. Whereas the TAL itself is water impermeant, the highly specialized cells of the macula densa are permeable to water (reviewed in Ref. 2). Therefore, the absence of TRPV4 expression in these cells is entirely consistent with a role restricted to constitutively or functionally water-impermeant nephron segments wherein a transcellular osmotic gradient is generated.

Data for a physiological osmoregulatory role for TRPV4 are emerging. Mice harboring a targeted gene deletion for TRPV4 express a relatively subtle phenotype. Brain slices from the mutant mice exhibited exaggerated ADH release in response to hypertonicity in vitro (14); however, there was no gross perturbation in water intake or systemic osmolarity under unstressed conditions. A second report noted that, in the absence of social and dietary cues, water consumption was lower and plasma osmolarity was correspondingly higher in trpv4 –/– mice (13). In addition, the trpv4-null mice exhibited a blunted ADH response to hyperosmotic challenge and, perhaps paradoxically, displayed enhanced water retention in response to continuous ADH administration (13). In the aggregate, the trpv4-null phenotype may reflect a complex interplay between absent TRPV4 function in both the brain and kidney. In a similarly integrative fashion, TRPV4 in sensory nerve endings was essential for hypotonicity-induced nociception (1). The present data, although based exclusively on expression patterns, are completely consistent with a role for TRPV4 in the kidney epithelial cell response to anisotonicity in vivo, particularly in the hypotonic luminal milieu of the TAL and DCT and the potentially hypotonic luminal milieu of the collecting duct.

TRPV4 expression in the kidney is predominantly basolateral and therefore potentially influenced by interstitial composition rather than luminal solute concentration. This is consistent with its expression at the mRNA level in the blood-brain barrier-free nuclei of the circumventricular organs in the brain, where a role for TRPV4 has been postulated in systemic osmoregulation (12).

In the aggregate, these data, although circumstantial, raise the possibility of an osmoregulatory role for TRPV4 in the mammalian kidney by demonstrating its complete restriction to constitutively or conditionally water-impermeant tubule segments characterized by a substantial transepithelial osmotic gradient.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-52494, the American Heart Association, and the Department of Veterans Affairs.


    FOOTNOTES
 

Address for reprint requests and other correspondence: D. M. Cohen, Mailcode PP262, Oregon Health and Science Univ., 3314 S.W. US Veterans Hospital Rd., Portland, OR 97239 (E-mail: cohend{at}ohsu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* W. Tian and M. Salanova contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alessandri-Haber N, Yeh JJ, Boyd AE, Parada CA, Chen X, Reichling DB, and Levine JD. Hypotonicity induces TRPV4-mediated nociception in rat. Neuron 39: 497–511, 2003.[CrossRef][Web of Science][Medline]
  2. Bell PD, Lapointe JY, and Peti-Peterdi J. Macula densa cell signaling. Annu Rev Physiol 65: 481–500, 2003.[CrossRef][Web of Science][Medline]
  3. Campean V, Kricke J, Ellison D, Luft FC, and Bachmann S. Localization of thiazide-sensitive Na+-Cl cotransport and associated gene products in mouse DCT. Am J Physiol Renal Physiol 281: F1028–F1035, 2001.[Abstract/Free Full Text]
  4. Campean V, Theilig F, Paliege A, Breyer M, and Bachmann S. Key enzymes for renal prostaglandin synthesis: site-specific expression in rodent kidney (rat, mouse). Am J Physiol Renal Physiol 285: F19–F32, 2003.[Abstract/Free Full Text]
  5. Chung MK, Lee H, and Caterina MJ. Warm temperatures activate TRPV4 in mouse 308 keratinocytes. J Biol Chem 278: 32037–32046, 2003.[Abstract/Free Full Text]
  6. Colbert HA, Smith TL, and Bargmann CI. OSM-9, a novel protein with structural similarity to channels, is required for olfaction, mechanosensation, and olfactory adaptation in Caenorhabditis elegans. J Neurosci 17: 8259–8269, 1997.[Abstract/Free Full Text]
  7. Delany NS, Hurle M, Facer P, Alnadaf T, Plumpton C, Kinghorn I, See CG, Costigan M, Anand P, Woolf CJ, Crowther D, Sanseau P, and Tate SN. Identification and characterization of a novel human vanilloid receptor-like protein, VRL-2. Physiol Genomics 4: 165–174, 2001.[Abstract/Free Full Text]
  8. Gao X, Wu L, and O'Neil RG. Temperature-modulated diversity of TRPV4 channel gating: activation by physical stresses and phorbol ester derivatives through protein kinase C-dependent and -independent pathways. J Biol Chem 278: 27129–27137, 2003.[Abstract/Free Full Text]
  9. Guler AD, Lee H, Iida T, Shimizu I, Tominaga M, and Caterina M. Heat-evoked activation of the ion channel, TRPV4. J Neurosci 22: 6408–6414, 2002.[Abstract/Free Full Text]
  10. Klussmann E, Tamma G, Lorenz D, Wiesner B, Maric K, Hofmann F, Aktories K, Valenti G, and Rosenthal W. An inhibitory role of Rho in the vasopressin-mediated translocation of aquaporin-2 into cell membranes of renal principal cells. J Biol Chem 276: 20451–20457, 2001.[Abstract/Free Full Text]
  11. Komers R, Lindsley JN, Oyama TT, Allison KM, and Anderson S. Role of neuronal nitric oxide synthase (NOS1) in the pathogenesis of renal hemodynamic changes in diabetes. Am J Physiol Renal Physiol 279: F573–F583, 2000.[Abstract/Free Full Text]
  12. Liedtke W, Choe Y, Marti-Renom MA, Bell AM, Denis CS, Sali A, Hudspeth AJ, Friedman JM, and Heller S. Vanilloid receptor-related osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor. Cell 103: 525–535, 2000.[CrossRef][Web of Science][Medline]
  13. Liedtke W and Friedman JM. Abnormal osmotic regulation in trpv4 –/– mice. Proc Natl Acad Sci USA 100: 13698–13703, 2003.[Abstract/Free Full Text]
  14. Mizuno A, Matsumoto N, Imai M, and Suzuki M. Impaired osmotic sensation in mice lacking TRPV4. Am J Physiol Cell Physiol 285: C96–C101, 2003.[Abstract/Free Full Text]
  15. Montell C and Rubin GM. Molecular characterization of the Drosophila trp locus: a putative integral membrane protein required for phototransduction. Neuron 2: 1313–1323, 1989.[CrossRef][Web of Science][Medline]
  16. Nielsen S, Frokiaer J, Marples D, Kwon TH, Agre P, and Knepper MA. Aquaporins in the kidney: from molecules to medicine. Physiol Rev 82: 205–244, 2002.[Abstract/Free Full Text]
  17. Nielsen S, Smith BL, Christensen EI, Knepper MA, and Agre P. CHIP28 water channels are localized in constitutively water-permeable segments of the nephron. J Cell Biol 120: 371–383, 1993.[Abstract/Free Full Text]
  18. Nilius B, Watanabe H, and Vriens J. The TRPV4 channel: structure-function relationship and promiscuous gating behaviour. Pflügers Arch 446: 298–303, 2003.[CrossRef][Web of Science][Medline]
  19. Sabolic I, Valenti G, Verbavatz JM, Van Hoek AN, Verkman AS, Ausiello DA, and Brown D. Localization of the CHIP28 water channel in rat kidney. Am J Physiol Cell Physiol 263: C1225–C1233, 1992.[Abstract/Free Full Text]
  20. Schmitt R, Ellison DH, Farman N, Rossier BC, Reilly RF, Reeves WB, Oberbaumer I, Tapp R, and Bachmann S. Developmental expression of sodium entry pathways in rat nephron. Am J Physiol Renal Physiol 276: F367–F381, 1999.[Abstract/Free Full Text]
  21. Strotmann R, Harteneck C, Nunnenmacher K, Schultz G, and Plant TD. OTRPC4, a nonselective cation channel that confers sensitivity to extracellular osmolarity. Nat Cell Biol 2: 695–702, 2000.[CrossRef][Web of Science][Medline]
  22. Vriens J, Watanabe H, Janssens A, Droogmans G, Voets T, and Nilius B. Cell swelling, heat, and chemical agonists use distinct pathways for the activation of the cation channel TRPV4. Proc Natl Acad Sci USA 101: 396–401, 2004.[Abstract/Free Full Text]
  23. Watanabe H, Davis JB, Smart D, Jerman JC, Smith GD, Hayes P, Vriens J, Cairns W, Wissenbach U, Prenen J, Flockerzi V, Droogmans G, Benham CD, and Nilius B. Activation of TRPV4 channels (hVRL-2/mTRP12) by phorbol derivatives. J Biol Chem 277: 13569–13577, 2002.[Abstract/Free Full Text]
  24. Watanabe H, Vriens J, Prenen J, Droogmans G, Voets T, and Nilius B. Anandamide and arachidonic acid use epoxyeicosatrienoic acids to activate TRPV4 channels. Nature 424: 434–438, 2003.[CrossRef][Medline]
  25. Watanabe H, Vriens J, Suh SH, Benham CD, Droogmans G, and Nilius B. Heat-evoked activation of TRPV4 channels in a HEK293 cell expression system and in native mouse aorta endothelial cells. J Biol Chem 277: 47044–47051, 2002.[Abstract/Free Full Text]
  26. Wissenbach U, Bodding M, Freichel M, and Flockerzi V. Trp12, a novel Trp related protein from kidney. FEBS Lett 485: 127–134, 2000.[CrossRef][Web of Science][Medline]
  27. Xu H, Zhao H, Tian W, Yoshida K, Roullet JB, and Cohen DM. Regulation of a transient receptor potential (TRP) channel by tyrosine phosphorylation. SRC family kinase-dependent tyrosine phosphorylation of TRPV4 on TYR-253 mediates its response to hypotonic stress. J Biol Chem 278: 11520–11527, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
W. Liu, Y. Wei, P. Sun, W.-H. Wang, T. R. Kleyman, and L. M. Satlin
Mechanoregulation of BK channel activity in the mammalian cortical collecting duct: role of protein kinases A and C
Am J Physiol Renal Physiol, October 1, 2009; 297(4): F904 - F915.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
S. Laycock, H. C. Taylor, C. Haigh, A. T. Lee, G. J. Cooper, A. C. M. Ong, and L. Robson
A novel dephosphorylation-activated conductance in a mouse renal collecting duct cell line
Exp Physiol, August 1, 2009; 94(8): 914 - 927.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
F. Gao, D. Sui, R. M. Garavito, R. M. Worden, and D. H. Wang
Salt Intake Augments Hypotensive Effects of Transient Receptor Potential Vanilloid 4: Functional Significance and Implication
Hypertension, February 1, 2009; 53(2): 228 - 235.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T. Karasawa, Q. Wang, Y. Fu, D. M. Cohen, and P. S. Steyger
TRPV4 enhances the cellular uptake of aminoglycoside antibiotics
J. Cell Sci., September 1, 2008; 121(17): 2871 - 2879.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. Kottgen, B. Buchholz, M. A. Garcia-Gonzalez, F. Kotsis, X. Fu, M. Doerken, C. Boehlke, D. Steffl, R. Tauber, T. Wegierski, et al.
TRPP2 and TRPV4 form a polymodal sensory channel complex
J. Cell Biol., August 11, 2008; 182(3): 437 - 447.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. N. Willette, W. Bao, S. Nerurkar, T.-l. Yue, C. P. Doe, G. Stankus, G. H. Turner, H. Ju, H. Thomas, C. E. Fishman, et al.
Systemic Activation of the Transient Receptor Potential Vanilloid Subtype 4 Channel Causes Endothelial Failure and Circulatory Collapse: Part 2
J. Pharmacol. Exp. Ther., August 1, 2008; 326(2): 443 - 452.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Galizia, M. P. Flamenco, V. Rivarola, C. Capurro, and P. Ford
Role of AQP2 in activation of calcium entry by hypotonicity: implications in cell volume regulation
Am J Physiol Renal Physiol, March 1, 2008; 294(3): F582 - F590.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
J. G. J. Hoenderop and R. J. M. Bindels
Calciotropic and Magnesiotropic TRP Channels
Physiology, February 1, 2008; 23(1): 32 - 40.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Wu, X. Gao, R. C. Brown, S. Heller, and R. G. O'Neil
Dual role of the TRPV4 channel as a sensor of flow and osmolality in renal epithelial cells
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1699 - F1713.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
L. Birder, F. A. Kullmann, H. Lee, S. Barrick, W. de Groat, A. Kanai, and M. Caterina
Activation of Urothelial Transient Receptor Potential Vanilloid 4 by 4{alpha}-Phorbol 12,13-Didecanoate Contributes to Altered Bladder Reflexes in the Rat
J. Pharmacol. Exp. Ther., October 1, 2007; 323(1): 227 - 235.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J.-B. Peng and D. G. Warnock
WNK4-mediated regulation of renal ion transport proteins
Am J Physiol Renal Physiol, October 1, 2007; 293(4): F961 - F973.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. Liu, T. Morimoto, C. Woda, T. R. Kleyman, and L. M. Satlin
Ca2+ dependence of flow-stimulated K secretion in the mammalian cortical collecting duct
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F227 - F235.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
R. D. Andrew, M. W. Labron, S. E. Boehnke, L. Carnduff, and S. A. Kirov
Physiological Evidence That Pyramidal Neurons Lack Functional Water Channels
Cereb Cortex, April 1, 2007; 17(4): 787 - 802.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Taniguchi, S. Tsuruoka, A. Mizuno, J.-i. Sato, A. Fujimura, and M. Suzuki
TRPV4 as a flow sensor in flow-dependent K+ secretion from the cortical collecting duct
Am J Physiol Renal Physiol, February 1, 2007; 292(2): F667 - F673.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Fu, A. Subramanya, D. Rozansky, and D. M. Cohen
WNK kinases influence TRPV4 channel function and localization
Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1305 - F1314.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Gamba
TRPV4: a new target for the hypertension-related kinases WNK1 and WNK4
Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1303 - F1304.
[Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. I. Abdullah, P. L. Pedraza, S. Hao, K. D. Rodland, J. C. McGiff, and N. R. Ferreri
NFAT regulates calcium-sensing receptor-mediated TNF production
Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1110 - F1117.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
D. E. Clapham, D. Julius, C. Montell, and G. Schultz
International Union of Pharmacology. XLIX. Nomenclature and Structure-Function Relationships of Transient Receptor Potential Channels
Pharmacol. Rev., December 1, 2005; 57(4): 427 - 450.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/1/F17    most recent
00397.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, W.
Right arrow Articles by Cohen, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, W.
Right arrow Articles by Cohen, D. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.