Am J Physiol Renal Physiol 287: F460-F468, 2004.
First published May 12, 2004; doi:10.1152/ajprenal.00107.2004
0363-6127/04 $5.00
AVP-induced VIT32 gene expression in collecting duct cells occurs via trans-activation of a CRE in the 5'-flanking region of the VIT32 gene
Christie P. Thomas,1,2,3
Randy W. Loftus,1 and
Kang Z. Liu1
1Department of Internal Medicine and the 2Graduate Program in Molecular Biology, University of Iowa College of Medicine, and the 3Veterans Affairs Medical Center, Iowa City, Iowa, 52246
Submitted 29 March 2004
; accepted in final form 11 May 2004
 |
ABSTRACT
|
|---|
VIT32, a vasopressin-induced transcript, inhibits Na+ transport when coexpressed with the epithelial sodium channel in Xenopus laevis oocytes (EMBO J 21: 51095117, 2002). To understand the mechanism of VIT32 gene regulation, we examined the effect of DDAVP and cAMP stimulation on VIT32 expression in M-1 mouse collecting duct cells and in H441 human airway epithelial cells. Elevation of cAMP with forskolin and IBMX increased VIT32 gene expression with a peak effect at 2 h. The increase in gene expression was abolished by H89 and by actinomycin D, suggesting that cAMP stimulates VIT32 mRNA expression by a PKA-mediated increase in gene transcription. An
1.5-kb fragment of the 5'-flanking region of VIT32 was cloned and was able to confer cAMP-stimulated reporter gene activity when transfected into M-1 and H441 cells. By deletion analysis and site-directed mutagenesis, a cAMP response element (CRE) was identified within the proximal promoter region that was sufficient to account for the increase in VIT32 gene expression seen with DDAVP and elevation of cAMP. Furthermore, DDAVP-stimulated VIT32 promoter-reporter activity was inhibited by H89 and by a dominant negative CREB construct. Finally, we were able to identify CREB as a nuclear protein that bound to the VIT32 CRE in gel mobility shift assays. In summary, DDAVP stimulates transcription of VIT32 via a CRE within the proximal promoter region of the VIT32 gene.
PP5395; epithelial sodium channel; sodium transport; airway epithelia; adenosine 3',5'-cyclic monophosphate response element binding protein
IN THE COLLECTING duct, AVP binds the V2 receptor and regulates water homeostasis by activation of the water channel, aquaporin-2 (34). AVP also regulates Na+ handling in the distal nephron by its effects on Na+ transporters (30). The principal effect is a stimulation of benzamil-sensitive Na+ transport, which has been noted in the toad bladder, in the isolated rat cortical collecting duct, in primary cultures of collecting duct cells, and in many distal nephron cell lines. The early effects of AVP may be mediated by cAMP and result in an increase in surface expression of the epithelial Na+ channel (ENaC) (24, 31, 35). Others have reported an increase in Na+-K+-ATPase activity in microdissected mouse and rat collecting ducts and in a mouse collecting duct cell line, mpkCCD14 (6, 8, 13). In A6 cells, an amphibian cell line used as a model of collecting duct epithelia, the early effects of AVP effect on Na+ transport appear to require phosphatidylinositol-3 kinase and be mediated by the regulatory kinase sgk1 (2, 11, 12).
Although the earliest effects of AVP on Na+ transport are independent of transcription, chronic effects are likely to require the transcription of target genes (18). DDAVP, a selective V2 receptor agonist, increases
- and
-ENaC expression in the renal cortex and in a collecting duct cell line, RCCD1 (9, 10, 25). In Brattleboro rats, a rodent model of central diabetes insipidus, DDAVP infusion increases
-ENaC and several other target genes in the renal inner medulla (5).
To identify genes that may be important for the AVP effect on collecting duct Na+ transport, Robert-Nicoud et al. (27) screened mpkCCD14 by serial analysis of gene expression (SAGE) library analysis and identified 48 vasopressin-induced transcripts (VIT). One of these, vit32 or PP5395 or Esau, is highly conserved across mammalian species and reduces Na+ transport when coexpressed with ENaC in Xenopus laevis oocytes (26). The mechanism for the regulation of Na+ transport in this heterologous expression system is unknown, but the effect is associated with meiotic maturation of the oocyte.
Given the potential importance of VIT32 for ENaC function in the collecting duct, we examined the mechanism for the regulation of VIT32 expression by AVP. Our results show that AVP increased vit32 gene expression and that this effect was mediated via a CRE within the 5'-flanking region of the gene.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Materials.
Dexamethasone, amiloride, DDAVP, and human placental collagen were purchased from Sigma (St. Louis, MO). Forksolin, IBMX, dibutyryl-cAMP (dbcAMP), and H89 were from EMD Biosciences (San Diego, CA). Actinomycin D was obtained from Roche Biochemicals (Indianapolis, IN), poly dI-dC from Pharmacia (Piscataway, NJ), and RU-38486 was a generous gift from Roussel Uclaf (Romainville, France). Culture materials were from Life Technologies (Gaithersburg, MD), and all radionucleotides were from PerkinElmer Life Sciences (Boston, MA). Stock solutions of actinomycin D and forskolin were made in DMSO and stocks of dexamethasone, IBMX, dbcAMP, and H89 were made in ethanol.
Tissue culture and RNA extraction.
The mouse renal cortical collecting duct cell line M-1, the human lung epithelial cell line H441, and the human embryonic kidney cell line HEK293 were cultured as previously described (16, 33). To examine the effects of forskolin (10 µM) and IBMX (100 µM) or dexamethasone (100 nM) on gene expression, cell culture media were switched to serum-free media and then exposed to these agents or vehicle for various time periods. Actinomycin D (1 µM) and H89 (10 µM) were used in some experiments and compared with control cultures in the presence of vehicle alone. Total RNA was prepared from cultured cells using TRI reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's instructions.
Mice injections.
The effect of exogenous DDAVP in C57BL/6J mice was tested as previously described with some modifications (1). Briefly, mice were injected with 1 µg/kg DDAVP sc the day before and 2 h before death. To suppress endogenous AVP secretion, control mice were given a 1.5-ml sc injection of 1% alcohol in 5% dextrose for two doses 8 h apart on the day before and an additional dose given 2 h before death. Total RNA was prepared from various mice tissues using TRI reagent. The research using animals was approved by the University of Iowa IACUC and conforms to APS's Guiding Principles in the Care and Use of Animals.
5'-RACE.
A cDNA library was made from H441 cell mRNA using an RNA ligase-dependent RACE kit (First Choice RLM-RACE, Ambion, Austin, TX), as previously described (17). The synthesized cDNA was subjected to nested PCR in sequential reactions using two adaptor-specific primers and two gene-specific primers complementary to a region in the 5'-end of the known transcript (hVIT32_5'RACE R1: 5'-CCGCCGACCTACGTACCTG; hVIT32_5'RACE R2: 5'-ACGCAGCCCCAAACTGGTC). Amplified DNA fragments were purified, ligated into pCRXL-topo (Invitrogen, Carlsbad, CA), and several clones were sequenced.
Ribonuclease protection assay.
A 301-bp mouse vit32 cDNA fragment was amplified by RT-PCR from mouse kidney using primers 5'-TTGTAAAAAGGACATCTGAGCA and 5'-GGCCTGTGGACAAAACAGAT. A 282-bp human VIT32 cDNA fragment was amplified by RT-PCR from fetal lung tissue using primers 5'-GTGTCTTCCCTCTTGCCAAA and 5'-TGCTGCATCTAAGTGCCTGT. These cDNA products were cloned into pCRXl-topo, screened for orientation, linearized, and then used to synthesize radiolabeled antisense cRNA probes. RNA samples were cohybridized in solution with VIT32 cRNA probes and 18S rRNA (Ambion), as a control for global changes in transcription and for RNA loading. Ribonuclease digestion and evaluation of protected fragments by PAGE were performed as previously described (33).
Construction of reporter plasmids.
Sequence information on human VIT32 gene available in Genbank (accession no. NT_030059) was used to amplify the putative regulatory regions of VIT32. To clone
1,500 bp of 5'-flanking region upstream of exon 1, primer hVIT32 F1: 5'-TTGCTGAACAAGTGCACAAACA was used with a reverse primer within the first exon, hVIT32_5'RACE R2, to amplify a DNA fragment from human placental genomic DNA (BD Biosciences, San Jose, CA). The PCR reaction was performed with the Advantage-GC2 kit (BD Biosciences) for 35 cycles with annealing at 60°C and the extension at 68°C. This fragment, which includes 267 nt of the 5'-UTR of hVIT32 F1, was directionally subcloned into pGL3basic (Promega, Madison, WI) upstream of the firefly luciferase coding region. Convenient restriction enzyme sites were used to create deletion variants of this construct.
The putative enhancer in hVIT32, TGACGTCA, was mutated to TGTGGCA using the Quikchange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and primers 5'-GGCCCTGGGGACTGTGGTCAATGAAGGGGGCGCC and 5'-GGCGCCCCCTTCATTGACCACAGTCCCCAGGGCC. Briefly, the above primers were annealed to the 842 +267 construct in pGL3basic at 55°C and then extended with Pfu DNA polymerase at 68°C for 18 cycles. The parental plasmid was then digested with Dpn I, and the newly extended circular double-strand DNA molecule (842 +267delCRE) was recovered by transformation into bacteria.
Transfection and functional analysis of the 5'-flanking VIT32 DNA.
Subconfluent H441, M-1, and HEK293 cells grown in 24-well plates were used for transfection using Lipofectin, Lipofectamine Plus, and Lipofectamine 2000, respectively (all from Invitrogen), as previously described (16, 21). One microgram of the firefly luciferase construct or the parent plasmid pGL3basic and 0.51 µg of a control plasmid pRL-SV40 (Promega), where the renilla luciferase gene is cloned downstream of the SV40 promoter, were cotransfected into each well. In some experiments, 1 µg of the plasmid pV2R-Flag, a vasopressin V2 receptor construct (gift from M. Birnbaumer) or pRSV-KCREB, a dominant negative CREB construct (gift from R. Goodman) was also cotransfected with the luciferase vectors. The following day, forskolin (10 µM) and IBMX (10 nM) or dbcAMP (10 mM) or vehicle was added to these wells and 24 h later cell lysates and dual luciferase activities were measured as previously described (21).
Nuclear extracts and EMSA.
M-1 and H441 cells were grown to confluence, treated with forskolin and IBMX for 4 h, and then nuclear extracts were made (Nuclear extraction kit, Panomics, Redwood, CA). Double-strand oligonucleotides that correspond to the human VIT32 CRE, the consensus ATF-2/CRE of the c-jun promoter (23), an irrelevant sequence (nonspecific) or a deletion variant of the hVIT32CRE (hVIT32 delCRE) was end-labeled with [
-32P]ATP using T4 polynucleotide kinase and then purified by G-25 Sephadex chromatography. hVIT32 CRE: CTGGGGACTGACGTCAATGAAGGG, GACCCCTGACTGCAGTTACTTCCC; ATF-2/CRE(c-jun): GATCCAGCTTGATGACGTCAGCCG, CTAGGTCGAACTACTGCAGTCGGC; nonspecific: CTAGGGGGCCTGGCCGGCC, CCCCGGACCGGCCGGCTAG; hVIT32 delCRE: CTGGGGACTGCAATGAAGGG, GACCCCTGACGTTACTTCCC.
A labeled probe (50,000 cpm) was then used in EMSA as previously described (19). Briefly, the probe was incubated with or without 1 to 10 µg whole cell extracts at 4°C for 20 min in a reaction mixture that contained 12.5 mM HEPES, pH 7.9, 100 mM KCl, 1 mM EDTA, 1 mM DTT, 1 µg poly dI-dC, and 10% glycerol. A 50-fold excess of nonradioactive oligonucleotides was used for competition experiments. For supershift assays, H441 extracts were preincubated with 4 µg of the anti-CREB Ab (Santa Cruz Biotechnology, Santa Cruz, CA) at 4°C for 16 h and then added to the labeled probe. Samples were analyzed on a 5% acrylamide gel containing 1% glycerol and 1x TBE, and the gel was dried and subjected to autoradiography.
 |
RESULTS
|
|---|
Vit32 is one of a group of recently identified vasopressin-induced transcripts in a mouse collecting duct cell line. It is the only one of these transcripts whose protein product reportedly alters ENaC function (26). The human transcript maps to chr 10q24.2, the mouse transcript to chr 19, and the rat transcript to 1q 54 (Human, mouse, and rat locus ID: 60370; 69534, 171386). Each transcript arises from three exons with the putative translation codon in exon 2 and stop codon in exon 3. The encoded protein VIP32 or Esau is a 17-kDa, 146-AA product that has no conserved domains when checked with the CDART program (http://www.ncbi.nlm.nih.gov/Structure/lexington/lexington.cgi) against the NCBI and the Conserved Domain Databases (14).
To examine VIT32 gene expression and regulation in human and mouse tissues, we amplified a cDNA fragment corresponding to a portion of the 3'-UTR from both species. Antisense cRNA probes were synthesized from these cDNAs and used for ribonuclease protection assays with RNAs from human and mouse tissues. Although the human cRNA probe gave a single predicted fragment (Fig. 1, A and B), we consistently saw two bands with the mouse probe in a variety of mouse tissues and in M-1 cells. A weaker 301-nt band corresponded to the full-length protected fragment and a stronger 220-nt band was suggestive of a variant transcript (Fig. 1, C and D). This could arise from a splicing signal within the 3'-UTR or from a premature polyadenylation signal sequence that would create a shorter 3'-UTR. A careful analysis of the sequence of exon 3 revealed two perfectly conserved consensus polyA signal sequences (AATAAA). The first was found 11 bp upstream of the polyA tail found in the Genbank sequence (Genbank accession no. NM_027106), and the second signal sequence was found a further 125 bp upstream. The location of the putative upstream polyA signal sequence fits perfectly with the size of the smaller protected fragment when one considers that an alternate polyA tail would be added 10 to 25 bp downstream of this signal sequence. Upon analysis of the EST database, we identified a mvit32 cDNA sequence (Genbank accession no. BF607237) with a polyA tail 13 bp downstream of the upstream polyA signal sequence, confirming that there is an upstream signal sequence. The upstream polyA signal sequence is conserved in the rat but not the human VIT32 sequence. Interestingly, the shorter UTR that arises from utilization of the upstream polyA signal sequence appears to be the predominant species in all mouse tissues examined (Thomas CP, unpublished observations).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1. Ribonuclease protection assay for vasopressin-induced transcript (VIT)32 in human and mouse epithelial cells. A and C: schematic of the 5'-end of the human and mouse VIT32 cDNA indicating the longest open reading frame (ORF), the position of the antisense probe used for ribonuclease protection assay, and the length of the protected fragment seen in mouse and human tissues. The putative polyadenylation signal sequence AATAAA and the poly A tail (A)n are shown. B and D: ribonuclease protection assay confirms a single protected VIT32 transcript in H441 cells and 2 protected VIT32 mRNA forms in M-1 cells. Samples were cohybridized with 18S rRNA probe and were run alongside yeast RNA (negative control) and (undigested) probe.
|
|
We then asked if vasopressin increases vit32 gene expression in vivo. We used a specific V2 receptor agonist DDAVP in mice provided free access to water and compared the vit32 gene expression to mice that had been deliberately water loaded to suppress endogenous AVP release (1). Our results show that vit32 gene is increased in the liver, kidney cortex, and in the kidney medulla roughly twofold in response to DDAVP given in two doses 24 and 2 h before death, although this increase was not statistically significant (Fig. 2, A and B).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 2. A: DDAVP increases vit32 expression in mouse kidney (Kid.) cortex and medulla (Med.) in vivo. After systemic administration of DDAVP or after water loading in control mice, RNA was extracted from various tissues and ribonuclease protection assay was performed using vit32 and 18S rRNA probes. Samples were analyzed by PAGE and autoradiography; Y indicates digested yeast lane. B: data from several experiments were pooled after correcting for 18S rRNA expression (n = 4 ± SE). C: effect of cAMP elevation and dexamethasone (dex) on VIT32 expression in M-1 cells. Cells were treated with forskolin and IBMX (cAMP), dexamethasone, or vehicle (veh) for various time periods and then vit32 expression was determined by ribonuclease protection assay. Samples were analyzed by PAGE and autoradiography. D: effect of 2-h cAMP stimulation on vit32 expression was quantitated by densitometry and corrected for 18S rRNA expression (n = 4 ± SE).
|
|
To examine the mechanism of the AVP effect on VIT32 gene expression, we used M-1 cells and H441 cells, kidney and lung cell lines with regulated Na+ transport. We were unable to detect an effect of AVP on VIT32 gene expression in M-1 cells even though the V2R could be detected by RT-PCR (data not shown). Because the classic effect of AVP on the V2 receptor is an activation of adenylyl cyclase with an increase in cAMP, we asked if the effects of AVP on VIT32 seen in vivo could be recapitulated by an elevation of cAMP. We used forskolin and IBMX to examine the effect of cAMP elevation in H441 and M-1 cells. We also examined the effect of corticosteroids on VIT32 gene expression because in the original analysis both aldosterone and AVP were reported to increase the abundance of this transcript (27). In M-1 cells, cAMP increased vit32 gene expression by 2 h with a peak effect by 4 h and the effect was persistent even at 24 h (Fig. 2, C and D). Dexamethasone also increased vit32 gene expression, although the effect was more modest. The effect of dexamethasone in M-1 cells confirmed that at least in collecting duct cell lines, dexamethasone, like aldosterone, could increase vit32 gene expression.
The effect of cAMP on VIT32 gene expression was more robust in H441 cells (Fig. 3, A and B). In contrast, dexamethasone was without effect. We then used H89, an inhibitor of protein kinase A (PKA), and actinomycin D, an inhibitor of RNA polymerase II-mediated transcription, to examine the mechanism for the increase in VIT32 gene expression seen with cAMP stimulation. In H441 cells, the cAMP effect was abolished by PKA blockade and by actinomycin D (Fig. 3C). These results suggest that the cAMP effect on VIT32 is mediated via activation of PKA and leads to increased transcription of VIT32. Similar results were seen in M-1 cells treated with H89 and actinomycin D (Thomas CP, unpublished observations).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3. A: effect of cAMP elevation and dexamethasone on VIT32 expression in H441 cells. Cells were treated with forskolin and IBMX (cAMP), dexamethasone, or vehicle for various time periods and then VIT32 expression was determined by ribonuclease protection assay. Samples were analyzed by PAGE and autoradiography. B: effect of 2-h cAMP stimulation on VIT32 expression was quantitated by densitometry and corrected for 18S rRNA expression (n = 3 ± SE). C: effect of H89 and actinomycin D (Act. D) on cAMP-stimulated VIT32 expression. H441 cells were treated with vehicle or forskolin and IBMX (cAMP) with or without H89 or actinomycin D for 2 h and then VIT32 expression was determined by ribonuclease protection assay.
|
|
Because the actinomycin D experiments seemed to indicate that cAMP increases the transcription of VIT32, we decided to test proximal 5'-flanking regulatory sequences for constitutive and cAMP-stimulated cis-elements. We first mapped the transcription start site of the hVIT32 gene by 5'-RACE using a RNA ligase-mediated, adaptor-ligated H441 cDNA library. Identified clones were sequenced and two 5'-termini were noted with the longer clone adding 191 nt to the known 5'-end of hVIT32 cDNA (Fig. 4A). The 5'-end of the hVIT32 gene (Genbank accession no. NT_030059) was then analyzed for core promoter elements using Omiga sequence analysis software (Accelrys, San Diego, CA). Three TFIIB recognition elements (BRE) and three Sp1 binding sites were identified just upstream of the more proximal transcription start site. Other promoter elements such as a TATA box, CAAT box, an Inr or downstream promoter element were not identified (Fig. 4B). The 5'-end of the hVIT32 gene is GC rich and fulfills the definition of a CpG island (20).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 4. 5'-End of VIT32. A: transcription start site of hVIT32 was mapped by 5'-RACE. The known extent of the first exon of VIT32 mRNA is shown as a hatched box, and the 2 transcription start sites are indicated with arrowheads. The more proximal transcription start site has been arbitrarily assigned as +1. The 5'-end of the gene is contained within a CpG island. B: nucleotide sequence data of the 5'-end of hVIT32. The newly identified 5'-termini are boxed, and the original extent of VIT32 was indicated with an *. The primer used for 5'-RACE is indicated with an arrow, and the position of putative transcription factor binding sites is also indicated.
|
|
A
1,400-bp fragment of the 5'-flanking region including both transcription start sites was then cloned and ligated in sense orientation to the luciferase coding region in pGL3basic. The plasmid construct was then transfected into H441 and M-1 cells, treated with either forskolin and IBMX or dbcAMP, and lysates were analyzed 24 h later. Compared with the promoterless plasmid, there was a substantial increase in luciferase activity with the VIT32 5'-flanking construct consistent with the presence of a promoter element within this sequence (Fig. 5, A and B). Furthermore, elevation of cAMP significantly increased luciferase activity in M-1 and H441 cells transfected with the VIT32 promoter-reporter construct. These results indicate that the 5'-flanking regulatory region contains cAMP-regulated enhancer element(s). We were unable to find evidence for glucocorticoid regulation of this promoter construct in M-1 cells, although endogenous gene expression was modestly stimulated by dexamethasone.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5. 5'-Flanking region of hVIT32 contains a cAMP-responsive enhancer. A 1.5-kb fragment of the 5'-flanking region of VIT32 ligated into pGL3basic was transfected into H441 (A) and M-1 cells (B) and compared with the empty plasmid pGL3basic (pGL3bas). Forskolin (Forsk) and IBMX (cAMP) or dibutyrl cAMP or dexamethasone was added to H441 or M-1 cells for 24 h and then luciferase activity was measured. There is a significant increase in luciferase activity in the presence of VIT32 sequence, which is further stimulated by cAMP but not by dexamethasone. *P < 0.05 compared with pGL3bas control (ctrl). #P < 0.05 (Bonferroni t-test) compared with VIT32 ctrl.
|
|
To identify the cis-elements that account for the cAMP stimulation, we made deletion constructs within the 5'-flanking region using convenient restriction enzyme sites. Of the three deletions tested, cAMP stimulation was substantially reduced in the smallest construct in M-1 cells and completely abolished in H441 cells (Fig. 6, A and B). A closer analysis of the 5'-flanking sequence demonstrated that the Aat II site used to derive the smallest construct disrupted a consensus cAMP response element (CRE). To confirm that this CRE was necessary for the cAMP effect, a 3-base mutation within the CRE was created in the context of a larger construct (Fig. 6B). Our results demonstrate that cAMP stimulation was eliminated with loss of this CRE. A comparative analysis of mouse and human 5'-flanking regulatory sequences confirmed that this CRE was perfectly conserved between both species (Fig. 6C). Furthermore, disruption of the CRE reduced basal promoter activity in M-1 and H441 cells (Fig. 6, A and B), suggesting that the CRE, which is at 73 to the transcription start site, may be part of the core promoter.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 6. Mapping a functional cAMP response element (CRE). A: deletional analysis and testing in H441 cells indicate that the sequence between 441 and 73 contains a CRE. B: deletion to 73 abolished the cAMP response in M-1 cells. Selective mutation of a putative CRE at 73 within the full-length sequence also abolished the cAMP response. *P < 0.005 compared with VIT32 ctrl. #P < 0.05 compared with full-length VIT32. C: alignment of the proximal 500 bp of the human and mouse VIT32 gene reveals a high degree of identify within the first exon and in the region surrounding a CRE. The CRE (boxed) is perfectly conserved between both species. The mouse sequence has not been numbered because the transcription start site has not been mapped.
|
|
To determine if DDAVP could stimulate VIT32 gene transcription, we tested DDAVP with the VIT32 promoter-reporter construct in HEK293 cells, a cell line that has been used to reconstitute vasopressin-signaling pathways (29). DDAVP stimulated luciferase expression in the presence of cotransfected V2 receptor but not in its absence (Fig. 7A). Furthermore, DDAVP was no longer able to stimulate reporter gene activity when the CRE was selectively mutated (Thomas CP, unpublished observations). These results indicate that DDAVP signals through the V2 receptor to activate VIT32 gene transcription. The effect of DDAVP was inhibited by H89 and the expression of a dominant negative CRE binding protein (CREB) protein, KCREB, also inhibited the DDAVP effect (Fig. 7B). Together, these data suggest that DDAVP activates PKA and stimulates CREB to induce VIT32 gene expression.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 7. DDAVP-stimulated VIT32 gene transcription in human embryonic kidney (HEK)293 cells. A: effect of DDAVP on VIT32 promoter-luciferase (luc) constructs was tested in HEK293 cells with and without expressed V2R. DDAVP-stimulated luciferase activity only in the presence of cotransfected V2R. *P < 0.001 for pGL3bas DDAVP vs. ctrl; #P < 0.001 for VIT32-luc DDAVP vs. ctrl. B: DDAVP-stimulated luciferase expression is abolished by H89 and substantially diminished by KCREB. *P < 0.001 compared with ctrl.
|
|
To identify trans-acting factors that bind to the CRE, we performed gel mobility shift assays using nuclear extracts from H441 and M-1 cells. We saw specific binding of nuclear extracts that were competed by a cold excess of VIT32_CRE oligonucleotide and a consensus ATF-2/CRE oligonucleotide but not by a nonspecific oligonucleotide (Fig. 8, A and B). Furthermore, a 4-bp deletion within the CRE of the VIT32 CRE oligonucleotides disrupted the ability of this sequence to compete for nuclear extracts that bound VIT32 CRE (Fig. 9A). These results suggested that the nuclear extracts specifically recognized the CRE within the VIT32_CRE oligonucleotide. To confirm the identify of this protein, we incubated nuclear extracts with an anti-CREB antibody before the addition of oligonucleotides and demonstrated that specific binding pattern was "supershifted," indicating that CREB is part of the protein-DNA complex (Fig. 9B).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 8. Nuclear (nuc.) extracts specifically bind the hVIP32 CRE in gel mobility shift assays. An end-labeled double-strand oligonucleotide that corresponded to the CRE in hVIT32 was incubated with nuclear extracts from H441 and M-1 cells (A and B, respectively). Compared with free probe (lane 1 in A and B), at least 2 proteins indicated by open arrowheads retard DNA mobility and are seen. Increasing nuclear extracts increases the abundance of protein bound (lanes 4 > 3 > 2). DNA protein binding is specifically competed by excess of unlabeled VIP32_CRE oligonucleotide (lane 5) or by a consensus ATF-2/CRE oligonucleotide (lane 6) but not by a nonspecific oligonucleotide (lane 7).
|
|

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 9. Nuclear extracts that bind hVIP32 CRE contain CREB. A: to confirm that nuclear extracts were binding to the CRE within the VIT32_CRE oligonucleotide, an additional oligonucleotide was made with a 4-bp deletion within the VIT32 (VIT32_delCRE). Increasing H441 nuclear extracts led to an increasing abundance of DNA protein complexes (open arrowheads) that were poorly competed by an excess (50x and 250x) of unlabeled VIT32_delCRE (lanes 5 and 6). B: H441 and M-1 nuclear extracts are preincubated with an anti-CREB antibody leading to a specific protein-DNA complex at a higher position consistent with a "supershifted" CREB protein-DNA complex (closed arrowhead).
|
|
Taken together, the data indicate that DDAVP and elevations in intracellular cAMP increase VIT32 gene transcription in a PKA-dependent fashion. This increase in transcription is mediated via the binding of CREB to a consensus CRE in the 5'-flanking region of the VIT32 gene.
 |
DISCUSSION
|
|---|
Vasopressin is considered to be an important physiological regulator of trans-epithelial Na+ transport in the collecting duct of the kidney. Generally, in culture models of the collecting duct and in rodents in vivo, AVP appears to stimulate Na+ transport (30). However, in isolated perfused rabbit cortical collecting ducts, the sustained effect of AVP and its second messenger cAMP is to inhibit Na+ reabsorption (4). Furthermore, in the syndrome of inappropriate ADH (SIADH) secretion in humans, increased water reabsorption is associated with reduced renal Na+ absorption (3, 22). The water-reabsorptive defect in SIADH can be corrected by the use of a competitive V2 antagonist VPA-985, and this correction is associated with an increase in urinary Na+ excretion (7). One of the vasopressin-regulated transcripts, vit32, reduces ENaC-mediated Na+ transport when coexpressed in X. laevis oocytes, establishing one mechanism by which elevated levels of AVP may reduce renal Na+ reabsorption (26).
We set out to examine the basis for the increase in VIT32 gene expression seen with AVP in collecting duct cells. We identified an alternate polyadenylation signal sequence in mouse tissues that leads to a shorter 3'-UTR. The tissue distribution of vit32 transcripts has been examined by Northern analysis (26). Although a 1-kb transcript was identified in all mouse tissues examined, an additional band corresponding to a 1.4-kb transcript was also seen in the kidney and lung. This may correspond to an alternate transcript or represent cross-hybridization to a paralog. The mouse EST database contains a vit32 transcript that includes an alternatively spliced 191-bp exon between exon 1 and 2 (Genbank accession no. BY007322). The larger 1.4-kb transcript could thus arise from this splicing event or from the longer 3'-UTR that results from the use of the downstream polyadenylation site described here.
We confirmed that a selective V2 receptor agonist DDAVP increased VIT32 gene expression in the mouse kidney cortex and medulla. We then examined the effect of cAMP stimulation with forskolin and IBMX on VIT32 gene expression in M-1 cells and in H441 cells, models for collecting duct and airway epithelial Na+ transport. Our data confirmed an early increase in VIT32 mRNA expression that was inhibitable by actinomycin D and by H89. We also tested DDAVP in M-1 cells, and although we detected the vasopressin V2 receptor by RT-PCR, we saw no effect on vit32 gene expression. In previous studies, 100 nM AVP was shown to be sufficient to increase PKA in M-1 cells (36). Although we did not specifically measure cAMP levels or PKA activity in M-1 cells, it is possible that the degree of cAMP elevation with DDAVP is insufficient to stimulate vit32 gene expression in culture.
Corticosteroids are perhaps the most important physiological regulators of Na+ transport in the collecting duct and in airway epithelia (28). VIT32 was initially identified as an AVP and aldosterone-regulated transcript in a collecting duct cell line. In M-1 cells but not in H441 cells, dexamethasone was able to regulate VIT32 gene expression, although the level of induction was significantly less than that seen with cAMP. The lack of effect of dexamethasone in H441 cells would suggest that corticosteroid regulation of VIT32 is a tissue-specific response. We were unable to find corticosteroid-regulated reporter gene activity in M-1 cells using a limited region of the VIT32 promoter. These data suggest that the increase in VIT32 gene expression seen with corticosteroids may be secondary to a reduction in mRNA turnover or that regulatory elements that direct corticosteroid-dependent expression are elsewhere in the 5'-flanking region of the gene. Further studies will have to be done to determine the mechanism of action of corticosteroids.
To determine the basis for the cAMP-mediated increase in VIT32 gene expression, we mapped the transcription start site of the hVIT32 transcript and then cloned the proximal 5'-flanking region of the hVIT32 gene to use in promoter-reporter experiments. The promoter-reporter construct was noted to be cAMP responsive, and by deletional analysis, a perfect palindromic CRE was mapped 73 nt upstream of the transcription start site. This CRE was also required for the AVP-mediated increase in VIT32 gene transcription.
Two pieces of evidence together confirmed that CREB might be required for the stimulation of VIT32 CRE. First, we were able to show that the effect of AVP on VIT32 gene transcription could be abolished by coexpression of a dominant negative form of CREB. Second, we demonstrated that CREB was part of the transcription factor complex that bound to this CRE in gel shift assays.
Although the regulation of water permeability and Na+ transport in the collecting duct by DDAVP is well established, DDAVP is not expected to have physiological effects in lung tissue because the V2 receptor is not expressed here. Yet, in a recent study (25), it was reported that chronic infusion of DDAVP in Brattleboro and in Sprague-Dawley rats led to increases in ENaC mRNA expression in the lung and in the renal cortex. Clearly, many other hormones and autacoids such as adrenaline and prostaglandins increase cAMP in airway and alveolar epithelia and directly or indirectly regulate Na+ transport (15, 32). cAMP-regulated VIP32 expression may thus be involved in the modulation of Na+ transport in the collecting duct and in lung epithelia.
 |
GRANTS
|
|---|
The nucleotide sequence reported in this paper will appear in DDBJ, EMBL, Genbank, and GSDB Nucleotide Sequence Databases with accession numbers AY505173-AY505175. United States Public Health Service Grants DK-54348 and HL-71664 and a Department of Veterans Affairs Merit Review Grant supported this work. C. P. Thomas is an Established Investigator of the American Heart Association.
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank R. Goodman (Oregon Health Sciences University for the gift of pRSV-KCREB), M. Birnbaumer (National Institute of Environmental Health Sciences for pV2R-Flag), and the University of Iowa DNA core facility for DNA synthesis and sequencing services provided.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: C. P. Thomas, Division of Nephrology, Dept. of Internal Medicine, Univ. of Iowa Hospitals and Clinics, 200 Hawkins Drive, Iowa City, IA 52242-1081 (E-mail: christie-thomas{at}uiowa.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Alfie ME, Alim S, Mehta D, Shesely EG, and Carretero OA. An enhanced effect of arginine vasopressin in bradykinin B2 receptor null mutant mice. Hypertension 33: 14361440, 1999.[Abstract/Free Full Text]
- Alvarez de la Rosa D and Canessa CM. Role of SGK in hormonal regulation of epithelial sodium channel in A6 cells. Am J Physiol Cell Physiol 284: C404C414, 2003.[Abstract/Free Full Text]
- Baylis PH. The syndrome of inappropriate antidiuretic hormone secretion. Int J Biochem Cell Biol 35: 14951499, 2003.[CrossRef][Web of Science][Medline]
- Breyer MD. Feedback inhibition of cyclic adenosine monophosphate-stimulated Na+ transport in the rabbit cortical collecting duct via Na+-dependent basolateral Ca2+ entry. J Clin Invest 88: 15021510, 1991.[Web of Science][Medline]
- Brooks HL, Ageloff S, Kwon TH, Brandt W, Terris JM, Seth A, Michea L, Nielsen S, Fenton R, and Knepper MA. cDNA array identification of genes regulated in rat renal medulla in response to vasopressin infusion. Am J Physiol Renal Physiol 284: F218F228, 2003.[Abstract/Free Full Text]
- Coutry N, Farman N, Bonvalet JP, and Blot-Chabaud M. Synergistic action of vasopressin and aldosterone on basolateral Na+-K+-ATPase in the cortical collecting duct.J Membr Biol 145: 99106, 1995.[Web of Science][Medline]
- Decaux G. Difference in solute excretion during correction of hyponatremic patients with cirrhosis or syndrome of inappropriate secretion of antidiuretic hormone by oral vasopressin V2 receptor antagonist VPA-985. J Lab Clin Med 138: 1821, 2001.[CrossRef][Web of Science][Medline]
- Djelidi S, Beggah A, Courtois-Coutry N, Fay M, Cluzeaud F, Viengchareun S, Bonvalet JP, Farman N, and Blot-Chabaud M. Basolateral translocation by vasopressin of the aldosterone-induced pool of latent Na-K-ATPases is accompanied by
1 subunit dephosphorylation: study in a new aldosterone-sensitive rat cortical collecting duct cell line.J Am Soc Nephrol 12: 18051818, 2001.[Abstract/Free Full Text]
- Djelidi S, Fay M, Cluzeaud F, Escoubet B, Eugene E, Capurro C, Bonvalet JP, Farman N, and Blot-Chabaud M. Transcriptional regulation of sodium transport by vasopressin in renal cells.J Biol Chem 272: 3291932924, 1997.[Abstract/Free Full Text]
- Ecelbarger CA, Kim GH, Terris J, Masilamani S, Mitchell C, Reyes I, Verbalis JG, and Knepper MA. Vasopressin-mediated regulation of epithelial sodium channel abundance in rat kidney. Am J Physiol Renal Physiol 279: F46F53, 2000.[Abstract/Free Full Text]
- Edinger RS, Rokaw MD, and Johnson JP. Vasopressin stimulates sodium transport in A6 cells via a phosphatidylinositide 3-kinase-dependent pathway. Am J Physiol Renal Physiol 277: F575F579, 1999.[Abstract/Free Full Text]
- Faletti CJ, Perrotti N, Taylor SI, and Blazer-Yost BL. sgk: An essential convergence point for peptide and steroid hormone regulation of ENaC-mediated Na+ transport.Am J Physiol Cell Physiol 282: C494C500, 2002.[Abstract/Free Full Text]
- Feraille E, Mordasini D, Gonin S, Deschenes G, Vinciguerra M, Doucet A, Vandewalle A, Summa V, Verrey F, and Martin PY. Mechanism of control of Na,K-ATPase in principal cells of the mammalian collecting duct. Ann NY Acad Sci 986: 570578, 2003.[Web of Science][Medline]
- Geer LY, Domrachev M, Lipman DJ, and Bryant SH. CDART: protein homology by domain architecture. Genome Res 12: 16191623, 2002.[Abstract/Free Full Text]
- Graham A, Steel DM, Alton EW, and Geddes DM. Second-messenger regulation of sodium transport in mammalian airway epithelia. J Physiol 453: 475491, 1992.[Abstract/Free Full Text]
- Itani OA, Auerbach SD, Husted RF, Volk KA, Ageloff S, Knepper MA, Stokes JB, and Thomas CP. Glucocorticoid-stimulated Na+ transport in human lung epithelia is associated with regulated ENaC and sgk1 expression. Am J Physiol Lung Cell Mol Physiol 282: L631L641, 2002.[Abstract/Free Full Text]
- Itani OA, Campbell JR, Herrero J, Snyder PM, and Thomas CP. Alternate promoters and variable splicing lead to hNedd42 isoforms with a C2 domain and varying number of WW domains. Am J Physiol Renal Physiol 285: F916F929, 2003.[Abstract/Free Full Text]
- Kamynina E and Staub O. Concerted action of ENaC, Nedd42, and Sgk1 in transepithelial Na+ transport. Am J Physiol Renal Physiol 283: F377F387, 2002.[Abstract/Free Full Text]
- Kapatos G, Stegenga SL, and Hirayama K. Identification and characterization of basal and cyclic AMP response elements in the promoter of the rat gtp cyclohydrolase I gene. J Biol Chem 275: 59475957, 2000.[Abstract/Free Full Text]
- Li LC and Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 18: 14271431, 2002.[Abstract/Free Full Text]
- Mick VE, Itani OA, Loftus RW, Husted RF, Schmidt TJ, and Thomas CP. The
subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5' flanking region of the gene. Mol Endocrinol 15: 575588, 2001.[Abstract/Free Full Text]
- Milionis HJ, Liamis GL, and Elisaf MS. The hyponatremic patient: a systematic approach to laboratory diagnosis. CMAJ 166: 10561062, 2002.[Abstract/Free Full Text]
- Morooka H, Bonventre JV, Pombo CM, Kyriakis JM, and Force T. Ischemia and reperfusion enhance ATF-2 and c-Jun binding to cAMP response elements and to an AP-1 binding site from the c-jun promoter. J Biol Chem 270: 3008430092, 1995.[Abstract/Free Full Text]
- Morris RG and Schafer JA. cAMP increases density of ENaC subunits in the apical membrane of MDCK Cells in direct proportion to amiloride-sensitive Na+ transport. J Gen Physiol 120: 7185, 2002.[Abstract/Free Full Text]
- Nicco C, Wittner M, DiStefano A, Jounier S, Bankir L, and Bouby N. Chronic exposure to vasopressin upregulates ENaC and sodium transport in the rat renal collecting duct and lung. Hypertension 38: 11431149, 2001.[Abstract/Free Full Text]
- Nicod M, Michlig S, Flahaut M, Salinas M, Fowler Jaeger N, Horisberger JD, Rossier BC, and Firsov D. A novel vasopressin-induced transcript promotes MAP kinase activation and ENaC downregulation. EMBO J 21: 51095117, 2002.[CrossRef][Web of Science][Medline]
- Robert-Nicoud M, Flahaut M, Elalouf JM, Nicod M, Salinas M, Bens M, Doucet A, Wincker P, Artiguenave F, Horisberger JD, Vandewalle A, Rossier BC, and Firsov D. Transcriptome of a mouse kidney cortical collecting duct cell line: effects of aldosterone and vasopressin. Proc Natl Acad Sci USA 98: 27122716, 2001.[Abstract/Free Full Text]
- Rossier BC, Pradervand S, Schild L, and Hummler E. Epithelial sodium channel and the control of sodium balance: interaction between genetic and environmental factors. Annu Rev Physiol 64: 877897, 2002.[CrossRef][Web of Science][Medline]
- Sadeghi H, Robertson GL, Bichet DG, Innamorati G, and Birnbaumer M. Biochemical basis of partial nephrogenic diabetes insipidus phenotypes. Mol Endocrinol 11: 18061813, 1997.[Abstract/Free Full Text]
- Schafer JA. Abnormal regulation of ENaC: syndromes of salt retention and salt wasting by the collecting duct. Am J Physiol Renal Physiol 283: F221F235, 2002.[Abstract/Free Full Text]
- Schafer JA and Troutman SL. cAMP mediates the increase in apical membrane Na+ conductance produced in rat CCD by vasopressin. Am J Physiol Renal Fluid Electrolyte Physiol 259: F823F831, 1990.[Abstract/Free Full Text]
- Stutts MJ, Canessa CM, Olsen JC, Hamrick M, Cohn JA, Rossier BC, and Boucher RC. CFTR as a cAMP-dependent regulator of sodium channels. Science 269: 847850, 1995.[Abstract/Free Full Text]
- Thomas CP, Auerbach SD, Stokes JB, and Volk KA. 5' Heterogeneity in amiloride-sensitive epithelial sodium channel
-subunit mRNA leads to distinct NH2-terminal variant proteins. Am J Physiol Cell Physiol 274: C1312C1323, 1998.[Abstract/Free Full Text]
- Ward DT, Hammond TG, and Harris HW. Modulation of vasopressin-elicited water transport by trafficking of aquaporin2-containing vesicles. Annu Rev Physiol 61: 683697, 1999.[CrossRef][Web of Science][Medline]
- Weisz OA, Wang JM, Edinger RS, and Johnson JP. Non-coordinate regulation of endogenous epithelial sodium channel (ENaC) subunit expression at the apical membrane of A6 cells in response to various transporting conditions. J Biol Chem 275: 3988639893, 2000.[Abstract/Free Full Text]
- Wong R, Heasley L, Ao L, and Berl T. Expression of GTPase-deficient Ras inhibits vasopressin signaling in cultured cortical collecting duct cells. J Clin Invest 96: 597601, 1995.[Web of Science][Medline]
Copyright © 2004 by the American Physiological Society.