AJP - Renal Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 288: F98-F107, 2005. First published September 21, 2004; doi:10.1152/ajprenal.00246.2004
0363-6127/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/1/F98    most recent
00246.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fan, H.
Right arrow Articles by El-Dahr, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fan, H.
Right arrow Articles by El-Dahr, S. S.

A novel pathological role of p53 in kidney development revealed by gene-environment interactions

Hao Fan, Jessica R. Harrell, Susana Dipp, Zubaida Saifudeen, and Samir S. El-Dahr

Department of Pediatrics, Section of Pediatric Nephrology, Tulane University Health Sciences Center, New Orleans, Louisiana

Submitted 1 July 2004 ; accepted in final form 14 September 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Gene-environment interactions are implicated in congenital human disorders. Accordingly, there is a pressing need to develop animal models of human disease, which are the product of defined gene-environment interactions. Previously, our laboratory demonstrated that gestational salt stress of bradykinin B2 receptor (B2R)-null mice induces renal dysgenesis and early death of the offspring (El-Dahr SS, Harrison-Bernard LM, Dipp S, Yosipiv IV, and Meleg-Smith S. Physiol Genomics 3: 121–131, 2000). In contrast, salt-stressed B2R +/+ or +/– littermates have normal development. The present study investigates the mechanisms underlying the susceptibility of B2R-null mice to renal dysgenesis. Proteomic and conventional Western blot screens identified E-cadherin among the differentially repressed proteins in B2R–/– kidneys, whereas the checkpoint kinase Chk1 and its substrate P-Ser20 p53 were induced. We tested the hypothesis that p53 mediates repression of E-cadherin gene expression and is causally linked to the renal dysgenesis. Genetic crosses between B2R –/– and p53+/– mice revealed that germline reduction of p53 gene dosage rescues B2R–/– mice from renal dysgenesis and restores kidney E-cadherin gene expression. Furthermore, {gamma}-irradiation induces repression of E-cadherin gene expression in p53+/+ but not –/– cells. In transient transfection assays, p53 repressed human E-cadherin promoter-driven reporter activity, whereas a mutant p53, which cannot bind DNA, did not. Functional promoter analysis indicated the presence of a p53-responsive element in exon 1, which partially mediates p53-induced repression. Chromatin immunoprecipitation assays revealed that p53 inhibits histone acetylation of the E-cadherin promoter. Treatment with a histone deacetylase inhibitor reversed both p53-mediated promoter repression and deacetylation. In conclusion, this study demonstrates that gene-environment interactions cooperate to induce congenital defects through p53 activation.

bradykinin B2 receptor; knockout mice; checkpoint kinase; histone acetylation


CONGENITAL RENAL DYSGENESIS, leading to hypoplasia, dysplasia, and cystogenesis, accounts for 40% of chronic renal failure cases in infants and children, requiring dialysis or transplantation (42). While monogenetic renal dysgenesis syndromes continue to be unraveled, a sizable proportion of cases are sporadic and considered polygenic traits or a result of gene-environment interactions. We recently developed and characterized a unique mouse model of renal dysgenesis that is produced by defined gene-environment interactions. This animal model established that the bradykinin B2 receptor (B2R) is required for normal renal development under conditions of fetal stress (16). Thus, if salt loading is initiated during embryogenesis, the B2R-null progeny acquire an aberrant renal phenotype that is evident histologically on embryonic day 16 (E16), shortly after the onset of metanephric B2R gene expression. The renal phenotype consists of collecting duct dysgenesis, cyst formation, and stromal expansion. In contrast, B2R mutant mice maintained on normal-sodium intake or salt-loaded wild-type mice do not develop kidney abnormalities (16). Postnatal follow-up of gestational salt-stressed B2R–/– mice revealed early-onset salt-sensitive hypertension (9), which was followed by progression to salt-losing nephropathy by 1 yr of age (23). By 18 mo of age, surviving B2R–/– mice show downregulation of the renin-angiotensin system, experience salt wasting, and acquire renal mesenchymal tumors (23).

To gain insights into the underlying susceptibility to renal dysgenesis, we performed a targeted proteomic screen on kidneys from B2R–/– and B2R+/+ pups born to mothers subjected to high-salt intake during gestation. The results revealed that E-cadherin, a key cell adhesion molecule in epithelial tissues, is one of several epithelial proteins that are differentially repressed in dysplastic kidneys. In contrast, dysplastic kidneys expressed higher levels of the checkpoint kinase Chk1. In addition to phosphorylation of Cdc25 and regulation of G2-M transition (21), Chk1 phosphorylates the tumor suppressor protein p53 on serine residue 20 (48). Ser20 phosphorylation is believed to prevent MDM2 interaction with the NH2 terminus of p53 and to stabilize p53 (1). Some studies have shown an association between downregulation of E-cadherin protein expression and alterations of the p53 protein (p53 gene mutation or accumulation of p53) in tumor samples from patients with breast carcinomas (19). It has also been suggested that E-cadherin repression is a necessary step in the pathways leading to apoptosis (3, 6, 19, 24, 50), e.g., in response to DNA damage or ATP depletion. Furthermore, downregulation of E-cadherin is required for execution of morphogenetic movements and epithelial cell migration during embryogenesis (12, 32, 40, 53). Finally, a recent study has shown that p53 stimulates cell migration (45), raising a possible negative link between p53- and cadherin-mediated cell adhesion during development. Collectively, these findings prompted us to explore the potential role of p53 in mediating downregulation of E-cadherin gene expression in renal dysgenesis. The results indicate that repression of endogenous E-cadherin gene expression depends on p53 gene dosage and suggest a novel role for p53 in the regulation of E-cadherin gene transcription.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Targeted proteomics of normal and abnormal kidneys. B2R-null mice have been described previously (5, 16, 23). Pairs of male and female B2R+/+ and –/– mice were placed on high-salt (5% NaCl) isocaloric chow (Harlan Laboratories, Madison, WI) 1 day before mating. Pregnant +/+ and –/– mice were continued on their diets for the duration of gestation. The animal study protocol was in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee.

Kidneys from B2R–/– (n = 32) and wild-type +/+ (n = 29) pups were harvested at 1–3 days of postnatal age and kept at –80°C. Approximately 100 mg pooled kidney tissue from each group were homogenized in 1.7 ml boiling lysis buffer (10 mM Tris·HCl, pH 7.4, 1 mM sodium orthovanadate, 1% SDS) using a polytron at full speed for 15 s. Protein extracts were subjected to Western array analysis as per manufacturer's protocol (BD Transduction). All the primary antibodies were mouse monoclonal, so only one secondary antibody was needed. The membrane was then washed and developed with chemiluminescence using SuperSignal West Pico (Pierce). Significant changes in protein expression were defined as a change of 1.5-fold or greater observed in two separate experiments, each performed in duplicate.

Genetic crossing of B2R–/– and p53+/– mice. Breeding pairs of p53+/– mice on a C57BL6 background were obtained from the Jackson Laboratories (Bar Harbor, ME). Crossing B2R–/– with p53+/– mice generated B2R+/–;p53+/– (F1), which were subsequently mated, and the females were placed on a high-salt diet during pregnancy. The F2 progeny consisted of wild-type, compound heterozygous, and homozygous null genotypes. PCR genotyping was performed on tail genomic DNA according to protocols established by the Jackson Laboratories.

Plasmids. Plasmid pCMV-p53 expresses a wild-type p53 protein from the cytomegalovirus promoter-enhancer in the pCG expression vector. pCMVp53E258K encodes a DNA-binding mutant p53. Human E-cadherin promoter-luciferase constructs (–1359, –368, and –37) were previously described (22, 25). Mutagenesis of the p53 site was performed by the QuickChange mutagenesis system (Stratagene, La Jolla, CA) following the manufacturer's recommendations. The primer sequence (forward) used for mutagenesis is 5'-GTCAGTTCAGACTACATCCCGCTACATCCCGGCCCGAC. All constructs were sequenced to verify the sequence by automated DNA sequencing (model 373A, Applied Biosystems).

Cell culture and transfection. Mouse inner medullary collecting duct cells (IMCD3) were maintained in DMEM/F-12 containing 10% FBS (GIBCO BRL) at 37°C in a humidified incubator with 5% CO2. H1299 (p53-null lung carcinoma) cells were maintained in DMEM/high glucose containing 4,500 mg/l D-glucose, L-glutamine, and 25 mM HEPES buffer, no sodium pyruvate, and 10% FBS. Isogenic HCT116 (human colon carcinoma) p53–/– and p53+/+ cells were cultured in McCoy's 5A modified medium supplemented with 10% FBS. Cells were plated in duplicate in six-well plates at 5–7 x 105 cells/well in DMEM containing 10% FBS 1 day before transfection. Transfections were performed using LipofectAMINE PLUS Reagent (GIBCO BRL) according to the manufacturer's recommendations, as described (46). In experiments utilizing trichostatin A (TSA), cells were treated with TSA (100 ng/ml) or vehicle (DMSO) 2 h after plating, transfected the following day, and cell extracts were harvested 24 h later.

Preparation of nuclear extracts and EMSA. EMSA was performed as described (41). The oligonucleotide sequences used in the gel shift assays were as follows: the high-affinilty p53-binding site (P1) from the rat B2R gene promoter, 5'-ggggGGAGGTGCCCAGGAGAGTGAtgaca-3' (47); the p53-consensus sequence in the human E-cadherin promoter (7); wild-type (wtE-cad), 5'-cagACTCCAGCCCGCTCCAGCCCggc-3' (nucleotide position 1072; accession NM009864); and mutant (mtE-cad): cagACTACATCCCGCTACATCCCggc.

Immunoblotting.. Western blot analysis was performed as previously described (23) using a polyclonal E-cadherin antibody diluted 1:500.

{gamma}-Irradiation, RNA extraction, and RT-PCR. Confluent HCT116 p53+/+ and p53–/– cells were subjected to irradiation (8-Gy), and total RNA was isolated at 0, 2, and 6 h after irradiation using the TRIzol reagent (Invitrogen). First-strand cDNA was synthesized using 5 µg of total cellular RNA as a template, 0.1 µg random hexamers (Invitrogen), 4 µl of 5x first-strand buffer (Invitrogen), 2 µl of 10 mM dithiothreitol, 0.5 µl of 20 mM dNTPs, and 1 µl of Superscript II (Invitrogen) in a volume of 20 µl. For E-cadherin, 8 µl of cDNA template, 5 µl 10x PCR buffer, 1.5 µl of 50 mM MgCl2, 0.5 µl of 20 mM dNTPs, 1 µl of 25 pmol forward and reverse primers, and 1 µl (5 U) of Taq polymerase (Invitrogen) were applied to the following PCR program: 4 min at 95°C, 40 s at 95°C, 30 s at 53°C, 1 min at 72°C, and final extension 7 min at 72°C for 35 cycles. After amplification, 15 µl of each PCR reaction mixture were electrophoresed through a 1% agarose gel with ethidium bromide (0.5 µg/ml). The gel was scanned with ultraviolet illumination using digital imaging and analysis (Alpha Innotech). For GAPDH, the same protocol was used except for 2 µl of cDNA template, annealing temperature of 55°C, and 30 cycles. The E-cadherin primers are forward (exon 12): 5'-TTCCTCCCAATACATCTCCCTTCACAGCAG and 5'-reverse (exon 14): 5'-CGAAGAAACAGCAAGAGCAGCAGAATCAGA. The GAPDH primers are forward 5'-AATGCATCCTGCACCACCAA and reverse 5'-GTAGCCATATTCATTGTCATA. The expected sizes of the E-cadherin and GAPDH PCR products are 339 and 515 bp, respectively.

Chromatin immunoprecipitation. Chromatin immunoprecipitation (ChIP) assays were performed using reagents from Upstate Biotechnology. p53 Null H1299 cells were plated in 6-well plates at a density of 4 x 105 cells/well and cultured in DMEM/D-glucose, L-glutamine, and 25 mM HEPES buffer and 10% FBS. The following day, the cells were treated with TSA or its vehicle (DMSO; 100 ng/ml). After 18 h, the cells were either transfected with pCMV-p53 plasmid DNA (100 ng) or mock transfected. Twenty-four hours after transfection, cells were treated with a 1% formaldehyde solution in PBS for cross-linking for 10 min at 37°C. Reaction was quenched by addition of 0.125 M glycine. Cells were rinsed twice in ice-cold 1x PBS and lysed in SDS lysis buffer with protease inhibitors. DNA was sheared by sonication and diluted 10-fold in ChIP dilution buffer. Immunoprecipitation was done with anti-acetylated histone H4 (Upstate Biotechnology) antibody (1:150 dilution) overnight at 4°C. DNA-protein-antibody complexes were captured on protein A-conjugated agarose beads. After washing and elution of the complexes from the beads, DNA-protein cross-links were reversed at 65°C overnight. Immunoprecipitated DNA was ethanol precipitated after proteins were removed by phenol-chloroform-isoamyl alcohol extraction after proteinase K treatment and used for PCR of the human E-cadherin gene in the region flanking the p53-binding site. Sequences of the primers used for 30 cycles of PCR are as follows: forward primer 5'-TAGACCCTAGCAACTCCAG with reverse primer 5'-CTGAACTGACTTCCGCAAGC to amplify the endogenous human E-cadherin DNA (size of amplicon is 241 bp).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Differentially expressed proteins in dysplastic kidneys. B2R-knockout mice are phenotypically normal, but, when B2R–/– mice are exposed to high-salt stress in utero, a kidney-specific developmental defect is induced. To gain insights into the pathogenesis of the renal lesion, we performed a targeted proteomic screen. Of the 724 proteins surveyed, 22 (3%) showed a reproducible change of at least 1.5-fold in dysplastic (i.e., salt-stressed B2R–/–) compared with normal (i.e., salt-stressed B2R+/+) kidneys (Tables 1 and 2). Of these, 14 proteins were downregulated. Conventional Western blotting confirmed the results in 5 randomly selected proteins (PCNA, Cul-2, E-cadherin, eNOS, HNF-1) (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Proteins downregulated in dysplastic kidneys

 

View this table:
[in this window]
[in a new window]
 
Table 2. Proteins upregulated in dysplastic kidneys

 
Dysplastic kidneys have lower levels of E-cadherin and higher levels of Chk1 and Ser20-p53. Dysplastic kidneys expressed higher levels of the checkpoint kinase Chk1 (+19.5-fold) and c-Jun and JNK1, components of the Jun kinase signaling pathway (Table 2). Representative Western arrays are shown in Figs. 1 and 2. Chk1 and JNK are activated by stressful stimuli, and both kinases phosphorylate p53 (20, 48). Chk1 phosphorylates p53 on Ser20. This modification stabilizes p53. Western blot analysis of nuclear extracts prepared from salt-stressed B2R–/– and +/+ pups revealed a 2.5-fold higher level of Ser20-p-p53 in B2R–/– than +/+ kidneys (Fig. 3A), indicating activation of p53 in the dysplastic kidneys.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. Reduced E-cadherin expression in dysplastic bradykinin B2 receptor (B2R)-null kidneys. A representative example of Western array analysis is shown. See text for methods and Tables 1 and 2 for results. Only those protein bands showing reproducible changes in duplicate from 2 separate experiments are identified.

 


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2. Upregulated expression of Chk1 in B2R–/– dysplastic kidneys. A representative example of Western array analysis is shown. Only those protein bands showing reproducible changes in duplicate from 2 separate experiments are identified.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3. A: Western blot analysis of kidney nuclear extracts from gestational salt-stressed B2R–/– and +/+ newborn pups. Each group consisted of a pool of 10–12 animals. Each lane contains 30 µg of nuclear proteins. The blot was incubated with a polyclonal p-Ser20-p53 antibody (1:1,000). The blot was stripped and reprobed with a monoclonal {beta}-actin antibody (1:4,000) as a loading control. B: breeding strategy and genotyping of the F2 progeny of B2R–/– x p53+/– crosses. C: RT-PCR showing restoration of E-cadherin mRNA levels by reduced p53 gene dosage in salt-stressed F2 progeny of p53+/– and B2R+/– crosses.

 
p53 Gene dosage reduction restores kidney E-cadherin gene expression and nephron differentiation in B2R–/– mice. To determine whether there is a functional link between p53 and E-cadherin in vivo, we crossed p53+/– with B2R–/– mice to generate p53+/–;B2R+/– mice, which were then mated and placed on high salt during pregnancy (Fig. 3B). Kidney E-cadherin/GAPDH mRNA levels were 3.3-fold lower in kidneys of salt-stressed B2R–/–;p53+/+ mice than in littermates with other genotypes (Fig. 3C). Importantly, the p53 gene dosage reduction (i.e., B2R–/–;p53+/–) was sufficient to restore E-cadherin mRNA levels. These results strongly argue in favor of the notion that p53 downregulates E-cadherin gene expression in vivo.

We next examined the effect of p53 gene dosage reduction on the renal phenotype of salt-stressed B2R–/– mice. As previously described, salt-stressed B2R–/–;p53+/+ pups have renal dysgenesis, including cyst formation and dedifferentiation of renal epithelia (Fig. 4, C and D). In contrast, the renal architecture in B2R–/–;p53+/– littermates was normal (Fig. 4, A and B), indicating that p53 activation plays a role in the pathogenesis of the renal dysgenesis.



View larger version (127K):
[in this window]
[in a new window]
 
Fig. 4. Rescue of renal development in salt-stressed B2R–/– pups by p53 gene deletion. Periodic acid-Schiff (PAS)-stained 5-µm kidney tissue sections from salt-stressed littermates are shown. A and B: normal kidney from a B2R–/–;p53+/– pup. C and D: dysplastic kidney from a salt-stressed B2R–/–;p53+/+ littermate showing large cysts (*) and dilated collecting ducts (arrowheads) and expanded surrounding stroma. Magnification: x40 (A and C); x200 (B and D).

 
p53 Represses E-cadherin promoter activity. Sequence analysis of the human E-cadherin gene promoter (7) for putative transcription factor binding sites revealed the presence of a putative p53 binding site with sequence similarity to the p53 consensus sequence RRRC(A/T)(T/A)GYYY located in exon 1, ~50 nucleotides downstream of the transcription initiation site (underlined sequence in rectangle, Fig. 5A). Using EMSA, we tested the binding of bacterially produced full-length human p53 to this DNA element (in the presence of activating antibody Pab421). As shown in Fig. 5B, p53 binds with relatively high affinity to the radiolabeled E-cadherin oligoduplex but does not bind a mutant oligoduplex (compare lanes 1 and 3). The binding intensity of p53 to the E-cadherin DNA element is lower than that of a high-affinity p53 binding site in the rat B2R gene (47) (compare lanes 1 and 4). Recombinant p73{alpha}, a p53-related family member, also binds the E-cadherin p53 binding-site, albeit at a lower affinity than p53 (compare lanes 1 and 2).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5. p53-Mediated repression of the human E-cadherin promoter. A: schematic of the E-cadherin promoter constructs and location of the p53-binding site (underlined sequence in rectangle). B: EMSA using radiolabeled oligoduplexes representing wild-type (wt) or mutant (mut) E-cadherin p53-binding sites (E-cadp53BS). The p53-binding site from the B2R (B2Rp53BS) (47) was used as a positive control probe. Recombinant bacterially produced p53 and p73{alpha} (500 ng each) were used as a source of protein in the presence of Pab421-activating antibody. C and D: H1299 cells (p53-null human lung carcinoma) and mouse inner medullary collecting duct cells (IMCD3) were transfected with the indicated amounts of p53 expression plasmid DNA and E-cadherin promoter-reporter constructs (1.0 µg each). Transfection efficiency was monitored by cotransfection with pSV-lacZ in all experiments involving transient transfection of reporter constructs. Values are means ± SE of at least 3 experiments performed in duplicate. D, inset: immunoblot of E-cadherin of whole cell extracts from p53-transfected IMCD3 cells. RLU, relative light units.

 
To determine the effect of p53 on E-cadherin transcription, luciferase reporter constructs driven by various lengths of the human E-cadherin promoter were transfected with or without pCMV-p53 into either H1299 (p53-null lung carcinoma cells) or mIMCD3 (immortalized mouse inner medullary collecting duct cells). As shown in Fig. 5C, p53 dose dependently repressed E-cadherin promoter activity up to 10-fold in H1299 cells. Introduction of p53 into IMCD3 cells caused a similar inhibitory effect on E-cadherin promoter activity (Fig. 5D), although baseline E-cadherin promoter activity was ~50- to 100-fold higher in IMCD3 than H1299 cells (Fig. 5, C and D). Importantly, p53 repressed all three E-cadherin-luciferase constructs (position –1359/+125, –368/+125, and –37/+125), consistent with the location of the p53-binding site (position +50). Western blots of extracts from p53-transfected cells revealed that p53 represses endogenous E-cadherin expression (Fig. 5D, inset). Of note is that the p53 homolog p73{beta} was also capable of repressing the three promoter constructs in H1299 cells but to a lower extent (~50% that of p53) (data not shown).

As mentioned above, a p53-binding site (ACTCCAGCCCGCTCCAGCCC) is present at nucleotide position +50 of the human E-cadherin promoter, and mutagenesis of this site (underlined bases) eliminates p53-binding (Fig. 5, A and B). We evaluated the functional consequences of these mutations on p53-mediated repression of the E-cadherin promoter in H1299 cells. Figure 6C shows that increasing amounts of p53 repressed the E-cadherin promoter in a dose-dependent manner. The mutant E-cadherin promoter tended to have a higher basal promoter activity than the wild-type promoter, although the difference did not reach statistical significance. In addition, the mutant promoter was less amenable to repression at a 50-ng p53 dose than the wild-type promoter (70 vs. 35%, P < 0.05) (Fig. 6C). Importantly, a mutant of p53 (p53E258K), which is unable to bind DNA, failed to repress the E-cadherin promoter despite equal cellular expression (Fig. 6, B and C). These results indicate that DNA binding is required for p53-mediated repression of the E-cadherin promoter and that the p53-binding site at nucleotide position +50 in the E-cadherin promoter is required, although not sufficient for p53-mediated repression.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 6. Mutagenesis of the p53-binding site attenuates p53-mediated repression of the E-cadherin promoter. A: schematic of the 1.3-kb E-cadherin promoter-reporter construct. Underlined bases represent the introduced mutations. B: Western blot (20 µg protein/lane) probed for p53 or a loading control, {beta}-actin, of cell lysates from H1299 cells cotransfected with p53 or mutant p53 (p53E258K) expression vectors and the E-cadherin promoter-reporter construct. C: results of luciferase activity in lysates from transfected H1299 cells. Values are means ± SE of at least 3 experiments performed in duplicate. *, #: P < 0.05 vs. respective control (0 ng p53). CMV, cytomegalovirus.

 
p53-Mediated repression of endogenous E-cadherin gene expression in response to DNA damage. To assess the contribution of endogenous p53 to E-cadherin gene regulation, we compared E-cadherin gene expression in {gamma}-irradiated (IR) HCT116 p53+/+ and p53–/– cells by RT-PCR. As expected, IR induced Ser20 phosphorylation of p53 in HCT116 p53+/+ cells (Fig. 7A). In contrast, IR suppressed E-cadherin mRNA levels (factored for GAPDH) in p53+/+ by as much as 70% compared with 5–10% in p53–/– cells (Fig. 7B). These findings imply that repression of endogenous E-cadherin gene expression in response to DNA damage is p53 dependent.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 7. Regulation of the endogenous E-cadherin gene by p53. Isogenic HCT116 p53+/+ and p53–/– cells were subjected to {gamma}-irradiation (IR), and total cellular protein and RNA were harvested at 0, 2, and 6 h after IR for Western blot analysis using a Ser20-p-p53 antibody (A) or RT-PCR using E-cadherin-specific primers (B), as described in METHODS. GAPDH was used as an internal control. The PCR products were electrophoresed on 1.0% agarose gel in the presence of ethidium bromide. The sizes of the products are 341 bp for E-cadherin and 515 bp for GAPDH.

 
p53-Mediated repression of E-cadherin is trichostatin sensitive. p53 Represses gene transcription via multiple mechanisms, including recruitment of histone deacetylase (HDAC) complexes to the target promoter (28, 37). To test this possibility, H1299 cells were treated with the selective HDAC inhibitor TSA 18 h before transfection with the p53 expression vector and E-cadherin-luciferase constructs. TSA increased basal E-cadherin promoter activity (Fig. 8A), suggesting that HDACs participate in the physiological repression of the E-cadherin promoter. Importantly, TSA attenuated p53-mediated repression in all test constructs (Fig. 8A), suggesting that p53 represses the E-cadherin promoter, at least partly, via HDAC-dependent mechanisms.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 8. E-cadherin promoter is trichostatin A (TSA) sensitive. A: H1299 cells were treated with TSA (100 ng/ml) or vehicle (DMSO) 2 h after plating and were transfected the following day with the indicated p53 expression plasmid and E-cadherin promoter constructs. Cell extracts were harvested 24 h later and assayed for luciferase activity. B: chromatin immunoprecipitation assay. H1299 cells were treated with TSA (100 ng/ml) or vehicle (DMSO) 2 h after plating and were transfected the following day with pCMV-p53 plasmid DNA (100 ng) or were mock transfected. Twenty-four hours after transfection, cells were treated with a 1% formaldehyde solution for chromatin cross-linking, for 10 min at 37°C. Reaction was quenched by addition of 0.125 M glycine. DNA was sheared by sonication and diluted 10-fold in chromatin immunoprecipitation (ChIP) dilution buffer. Immunoprecipitation was performed with anti-acetylated histone H4 antibody (1:150 dilution) overnight at 4°C. DNA-protein-antibody complexes were captured on protein A-conjugated agarose beads, and DNA-protein cross-links were reversed at 65°C overnight. Immunoprecipitated DNA was ethanol precipitated after proteins were removed by phenol-chloroform-isoamyl alcohol extraction following proteinase K treatment and then used for PCR. The amplicon size is 241 bp. The reverse primer is complementary to the luciferase gene to amplify DNA from the transfected E-cadherin promoter-luciferase construct. Controls input = PCR performed on one-tenth the amount of input DNA before immunoprecipitation. No PCR product is observed in the absence of anti-Ac-H4 antibody.

 
To correlate the magnitude of histone acetylation in the E-cadherin promoter with the observed transcriptional responses, we performed ChIP analysis in p53-transfected H1299 cells in the presence or absence of TSA treatment. The results revealed that p53 decreased basal E-cadherin promoter H4 acetylation (Fig. 8B), whereas TSA treatment restored promoter-acetylated H4 levels to control levels. Control input DNA samples showed no differences between the treatment groups. In addition, control samples processed with omission of the immunoprecipitation step did not reveal an amplification product (Fig. 8B). These findings are consistent with the functional transcriptional responses whereby TSA restored E-cadherin promoter activity (Fig. 8A).


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The present study explores the factors underlying aberrant gene regulation and morphogenesis in a gene-environment interaction model of renal dysgenesis. Two lines of independent evidence support the conclusion that p53 mediates repression of E-cadherin gene expression in vivo. First, DNA damage induced by IR is associated with reductions in endogenous E-cadherin mRNA levels in p53+/+ but not p53–/– cells. Second, genetic crosses between B2R–/– and p53+/– resulting in reduced p53 gene dosage restore kidney E-cadherin gene expression. In addition to E-cadherin, the dysplastic kidneys expressed lower levels of other epithelial differentiation genes, including Dlg, HNF-1, and cullin-2. Interestingly, mutations of these genes cause dedifferentiation and cancer (39, 43, 56), which may explain, at least in part, the susceptibility of salt-stressed B2R-null mice to tumorigenesis with aging (23). The mechanisms leading to the downregulation of these tumor suppressors in dysplastic B2R–/– kidneys will be the subject of future investigations.

E-cadherin is a calcium-dependent cell adhesion molecule, which forms a molecular complex with {beta}-catenin, plakoglobin, and p120ctn. Through this complex, E-cadherin is connected to the actin cytoskeleton (32, 51, 57). The E-cadherin-catenin adhesion complex is essential for early embryonic development, since E-cadherin-deficient embryos die at the blastocyst stage (29, 44). In addition, E-cadherin has tumor suppressor functions, and mutations affecting its synthesis or transcription occur in many human tumors (4, 7, 10). There is also evidence that E-cadherin functions as a survival factor during terminal epithelial differentiation, since knockdown of E-cadherin expression in the lactating mammary gland induces epithelial cell apoptosis (6). Collectively, the available data suggest that cellular E-cadherin levels must be finely tuned to achieve optimal epithelial sheet adhesion, migration, polarization, and cytoskeleton integrity (40, 55).

p53 Has dual roles as a transcriptional activator or repressor. The consensus p53-response element consists of two copies of the inverted repeats (RRRCA/TT/AGYYY), separated by 0–13 bp (8, 17, 27, 54). The mechanisms of p53-mediated transcriptional repression are far less well understood than those of activation. Recruitment of HDACs, displacement of activators, or interactions with the basal transcription machinery are potential mechanisms of p53-mediated repression (18, 26, 30, 33, 34). The results of this study suggest that direct binding of p53 to the E-cadherin promoter is required, although not sufficient for p53-mediated repression since 1) a mutant p53 that cannot bind DNA did not repress the E-cadherin promoter and 2) mutation of the p53-binding site attenuated but did not eliminate p53-induced repression. It is possible that p53 represses E-cadherin transcription partly by interacting with and squelching transcriptional activators (18). Another mechanism by which p53 could influence E-cadherin expression is through binding with Smad2 (11). Smad2 represses E-cadherin expression, leading to epithelial-mesenchymal transition (31).

Acetylation of histone NH2 termini by histone acetylases (e.g., CBP/p300) alters chromatin conformation, allowing transcriptional regulators better access to DNA-regulatory elements (2). The balance between histone acetylase and HDAC activity is an important determinant of gene transcription. Previous studies have demonstrated that p53 represses certain genes via recruitment of HDAC-containing repressor complexes (36). Experiments that utilized TSA to inhibit endogenous HDAC activity revealed increased baseline E-cadherin promoter activity and attenuation of p53-mediated repression. In addition, ChIP assays revealed that TSA treatment of p53-transfected cells restores histone H4 acetylation in the E-cadherin core promoter region. One of our future goals is to adapt the ChIP technique to embryonic tissues to map occupancy of p53-HDAC complexes on the endogenous E-cadherin gene. Reestablishing expression of E-cadherin (and other differentiation genes) by HDAC inhibitors may offer a therapeutic strategy in experimental renal dysgenesis, similar to what has been described in cancer (35, 52).

The mechanisms leading to activated p53 in this model of renal dysgenesis are not completely clear. Our proteomic screen has shown that although Chk1 is upregulated 19.5- fold, P-Ser20-p53 is only increased 2.5-fold in dysplastic B2R–/– kidneys. The difference may represent differential antibody sensitivity or, more likely, the fact that full p53 stabilization requires additional posttranslational modifications including NH2-terminal phosphoprylation and COOH-terminal acetylation (38). IR-induced Ser20 phosphorylation is mediated via Chk1 activation (48). At first glance, these data suggest that the pathogenesis of renal dysgenesis mimics that of genotoxic stress. However, DNA damage-induced Chk1 activation results from phosphorylation by upstream kinases (e.g., ATM/ATR) rather than increased protein levels, as is observed in dysplastic kidneys. Moreover, p53 is known to repress transcription of the human Chk1 gene (13). These findings suggest that DNA damage as well as other pathways leading to the activation of p53 may be involved in the susceptibility of B2R-null mice to renal dysgenesis. It is unknown yet whether maternal high salt crosses the placenta to reach the fetal circulation. Studies conducted in cultured inner medullary collecting duct cells have shown that high salt induces DNA strand breaks and activates p53 (15).

The full biological significance of p53-mediated repression of E-cadherin gene expression is likely to be context dependent. Since E-cadherin function is required for cell survival (3, 6, 14), it is conceivable that p53-mediated repression of E-cadherin is a mechanism to promote cell death (19). Preliminary studies in our laboratory indicate that B2R-null dysplastic kidneys exhibit widespread apoptosis and that rescue of renal dysgenesis by reduction of p53 gene dosage (shown in the current study) is accompanied by restriction of cell death (Fan H and El-Dahr SS, unpublished observations). In addition, downregulation of E-cadherin by p53 can promote epithelial-mesenchymal transition (49), which may explain expansion of the mesenchymal stroma typically observed in dysplastic kidneys.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
These studies were supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-56264 and DK-62250, the Tulane Renal and Hypertension Center of Excellence, and the American Heart Association, Southeast Affiliate.


    ACKNOWLEDGMENTS
 
We thank Drs. Eric Fearon and Bert Vogelstein for providing the E-cadherin promoter constructs and HCT116 cells, respectively.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. S. El-Dahr, Dept. of Pediatrics, SL-37, Tulane Univ. Health Sciences Ctr., 1430 Tulane Ave., New Orleans, LA 70112 (E-mail: seldahr{at}tulane.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Ashcroft M, Kubbutat MH, and Vousden KH. Regulation of p53 function and stability by phosphorylation. Mol Cell Biol 19: 1751–1758, 1999.[Abstract/Free Full Text]
  2. Berger SL. Histone modifications in transcriptional regulation. Curr Opin Genet Dev 12: 142–148, 2002.[CrossRef][Web of Science][Medline]
  3. Bergin E, Levine JS, Koh JS, and Lieberthal W. Mouse proximal tubular cell-cell adhesion inhibits apoptosis by a cadherin-dependent mechanism. Am J Physiol Renal Physiol 278: F758–F768, 2000.[Abstract/Free Full Text]
  4. Birchmeier W and Behrens J. Cadherin expression in carcinomas: role in the formation of cell junctions and the prevention of invasiveness. Biochim Biophys Acta 1198: 11–26, 1994.[Medline]
  5. Borkowski JA, Ransom RW, Seabrook GR, Trumbauer M, Chen H, Hill RG, Strader CD, and Hess JF. Targeted disruption of a B2 bradykinin receptor gene in mice eliminates bradykinin action in smooth muscle and neurons. J Biol Chem 270: 13706–13710, 1995.[Abstract/Free Full Text]
  6. Boussadia O, Kutsch S, Hierholzer A, Delmas V, and Kemler R. E-cadherin is a survival factor for the lactating mouse mammary gland. Mech Dev 115: 53–62, 2002.[CrossRef][Web of Science][Medline]
  7. Bussemakers MJ, Giroldi LA, van Bokhoven A, and Schalken JA. Transcriptional regulation of the human E-cadherin gene in human prostate cancer cell lines: characterization of the human E-cadherin gene promoter. Biochem Biophys Res Commun 203: 1284–1290, 1994.[CrossRef][Web of Science][Medline]
  8. Cadwell C and Zambetti GP. Regulators and mediators of the p53 tumor suppressor. J Cell Biochem Suppl 30–31: 43–49, 1998.
  9. Cervenka L, Harrison-Bernard LM, Dipp S, Primrose G, Imig JD, and El-Dahr SS. Early onset salt-sensitive hypertension in bradykinin B2 receptor null mice. Hypertension 34: 176–180, 1999.[Abstract/Free Full Text]
  10. Conacci-Sorrell M, Zhurinsky J, and Ben-Ze'ev A. The cadherin-catenin adhesion system in signaling and cancer. J Clin Invest 109: 987–991, 2002.[CrossRef][Web of Science][Medline]
  11. Cordenonsi M, Dupont S, Maretto S, Insinga A, Imbriano C, and Piccolo S. Links between tumor suppressors: p53 is required for TGF-{beta} gene responses by cooperating with Smads. Cell 113: 301–314, 2003.[CrossRef][Web of Science][Medline]
  12. Dahl U, Sjodin A, Larue L, Radice GL, Cajander S, Takeichi M, Kemler R, and Semb H. Genetic dissection of cadherin function during nephrogenesis. Mol Cell Biol 22: 1474–1487, 2002.[Abstract/Free Full Text]
  13. Damia G, Sanchez Y, Erba E, and Broggini M. DNA damage induces p53-dependent down-regulation of hCHK1. J Biol Chem 276: 10641–10645, 2001.[Abstract/Free Full Text]
  14. Day ML, Zhao X, Vallorosi CJ, Putzi M, Powell CT, Lin C, and Day KC. E-cadherin mediates aggregation-dependent survival of prostate and mammary epithelial cells through the retinoblastoma cell cycle control pathway. J Biol Chem 274: 9656–9664, 1999.[Abstract/Free Full Text]
  15. Dmitrieva NI, Cai Q, and Burg MB. Cells adapted to high NaCl have many DNA breaks and impaired DNA repair both in cell culture and in vivo. Proc Natl Acad Sci USA 101: 2317–2322, 2004.[Abstract/Free Full Text]
  16. El-Dahr SS, Harrison-Bernard LM, Dipp S, Yosipiv IV, and Meleg-Smith S. Bradykinin B2 null mice are prone to renal dysplasia: gene-environment interactions in kidney development. Physiol Genomics 3: 121–131, 2000.[Abstract/Free Full Text]
  17. El-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, and Vogelstein B. Definition of a consensus binding site for p53. Nat Genet 1: 45–49, 1992.[CrossRef][Web of Science][Medline]
  18. Farmer G, Friedlander P, Colgan J, Manley JL, and Prives C. Transcriptional repression by p53 involves molecular interactions distinct from those with the TATA box binding protein. Nucleic Acids Res 24: 4281–4288, 1996.[Abstract/Free Full Text]
  19. Fricke E, Keller G, Becker I, Rosivatz E, Schott C, Plaschke S, Rudelius M, Hermannstadter C, Busch R, Hofler H, Becker KF, and Luber B. Relationship between E-cadherin gene mutation and p53 gene mutation, p53 accumulation, Bcl-2 expression and Ki-67 staining in diffuse-type gastric carcinoma. Int J Cancer 104: 60–65, 2003.[CrossRef][Web of Science][Medline]
  20. Fuchs SY, Adler V, Pincus MR, and Ronai Z. MEKK1/JNK signaling stabilizes and activates p53. Proc Natl Acad Sci USA 95: 10541–10546, 1998.[Abstract/Free Full Text]
  21. Furnari B, Rhind N, and Russell P. Cdc25 mitotic inducer targeted by chk1 DNA damage checkpoint kinase. Science 277: 1495–1497, 1997.[Abstract/Free Full Text]
  22. Hajra KM, Ji X, and Fearon ER. Extinction of E-cadherin expression in breast cancer via a dominant repression pathway acting on proximal promoter elements. Oncogene 18: 7274–7279, 1999.[CrossRef][Web of Science][Medline]
  23. Harrison-Bernard LM, Dipp S, and El-Dahr SS. Renal and blood pressure phenotype in 18-mo-old bradykinin B2R(–/–)CRD mice. Am J Physiol Regul Integr Comp Physiol 285: R782–R790, 2003.[Abstract/Free Full Text]
  24. Jamal S and Schneider RJ. UV-induction of keratinocyte endothelin-1 downregulates E-cadherin in melanocytes and melanoma cells. J Clin Invest 110: 443–452, 2002.[CrossRef][Web of Science][Medline]
  25. Ji X, Woodard AS, Rimm DL, and Fearon ER. Transcriptional defects underlie loss of E-cadherin expression in breast cancer. Cell Growth Differ 8: 773–778, 1997.[Abstract]
  26. Johnson RA, Ince TA, and Scotto KW. Transcriptional repression by p53 through direct binding to a novel DNA element. J Biol Chem 276: 27716–27720, 2001.[Abstract/Free Full Text]
  27. Ko LJ and Prives C. p53: Puzzle and paradigm. Genes Dev 10: 1054–1072, 1996.[Free Full Text]
  28. Lagger G, Doetzlhofer A, Schuettengruber B, Haidweger E, Simboeck E, Tischler J, Chiocca S, Suske G, Rotheneder H, Wintersberger E, and Seiser C. The tumor suppressor p53 and histone deacetylase 1 are antagonistic regulators of the cyclin-dependent kinase inhibitor p21/WAF1/CIP1 gene. Mol Cell Biol 23: 2669–2679, 2003.[Abstract/Free Full Text]
  29. Larue L, Ohsugi M, Hirchenhain J, and Kemler R. E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc Natl Acad Sci USA 91: 8263–8267, 1994.[Abstract/Free Full Text]
  30. Lee KC, Crowe AJ, and Barton MC. p53-Mediated repression of alpha-fetoprotein gene expression by specific DNA binding. Mol Cell Biol 19: 1279–1288, 1999.[Abstract/Free Full Text]
  31. Li JH, Zhu HJ, Huang XR, Lai KN, Johnson RJ, and Lan HY. Smad7 inhibits fibrotic effect of TGF-{beta} on renal tubular epithelial cells by blocking Smad2 activation. J Am Soc Nephrol 13: 1464–1472, 2002.[Abstract/Free Full Text]
  32. Lilien J, Balsamo J, Arregui C, and Xu G. Turn-off, drop-out: functional state switching of cadherins. Dev Dyn 224: 18–29, 2002.[CrossRef][Web of Science][Medline]
  33. Mack DH, Vartikar J, Pipas JM, and Laimins LA. Specific repression of TATA-mediated but not initiator-mediated transcription by wild-type p53. Nature 363: 281–283, 1993.[CrossRef][Medline]
  34. Marks J, Saifudeen Z, Dipp S, and El-Dahr SS. Two functionally divergent p53-responsive elements in the rat bradykinin B2 receptor promoter. J Biol Chem 278: 34158–34166, 2003.[Abstract/Free Full Text]
  35. Mishra N, Reilly CM, Brown DR, Ruiz P, and Gilkeson GS. Histone deacetylase inhibitors modulate renal disease in the MRL-lpr/lpr mouse. J Clin Invest 111: 539–552, 2003.[CrossRef][Web of Science][Medline]
  36. Murphy M, Ahn J, Walker KK, Hoffman WH, Evans RM, Levine AJ, and George DL. Transcriptional repression by wild-type p53 utilizes histone deacetylases, mediated by interaction with mSin3a. Genes Dev 13: 2490–2501, 1999.[Abstract/Free Full Text]
  37. Ogden SK, Lee KC, Wernke-Dollries K, Stratton SA, Aronow B, and Barton MC. p53 Targets chromatin structure alteration to repress {alpha}-fetoprotein gene expression. J Biol Chem 276: 42057–42062, 2001.[Abstract/Free Full Text]
  38. Oren M, Damalas A, Gottlieb T, Michael D, Taplick J, Leal JF, Maya R, Moas M, Seger R, Taya Y, and Ben-Ze'ev A. Regulation of p53: intricate loops and delicate balances. Biochem Pharmacol 64: 865–871, 2002.[CrossRef][Web of Science][Medline]
  39. Pause A, Lee S, Worrell RA, Chen DY, Burgess WH, Linehan WM, and Klausner RD. The von Hippel-Lindau tumor-suppressor gene product forms a stable complex with human CUL-2, a member of the Cdc53 family of proteins. Proc Natl Acad Sci USA 94: 2156–2161, 1997.[Abstract/Free Full Text]
  40. Perez-Moreno M, Jamora C, and Fuchs E. Sticky business: orchestrating cellular signals at adherens junctions. Cell 112: 535–548, 2003.[CrossRef][Web of Science][Medline]
  41. Phelps DE and Dressler GR. Identification of novel Pax-2 binding sites by chromatin precipitation. J Biol Chem 271: 7978–7985, 1996.[Abstract/Free Full Text]
  42. Piscione TD and Rosenblum ND. The malformed kidney: disruption of glomerular and tubular development. Clin Genet 56: 341–356, 1999.[Web of Science][Medline]
  43. Pontoglio M, Barra J, Hadchouel M, Doyen A, Kress C, Bach JP, Babinet C, and Yaniv M. Hepatocyte nuclear factor 1 inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome. Cell 84: 575–585, 1996.[CrossRef][Web of Science][Medline]
  44. Riethmacher D, Brinkmann V, and Birchmeier C. A targeted mutation in the mouse E-cadherin gene results in defective preimplantation development. Proc Natl Acad Sci USA 92: 855–859, 1995.[Abstract/Free Full Text]
  45. Sablina AA, Chumakov PM, and Kopnin BP. Tumor suppressor p53 and its homologue p73{alpha} affect cell migration. J Biol Chem 278: 27362–27371, 2003.[Abstract/Free Full Text]
  46. Saifudeen Z, Dipp S, and El-Dahr SS. A role for p53 in terminal epithelial cell differentiation. J Clin Invest 109: 1021–1030, 2002.[CrossRef][Web of Science][Medline]
  47. Saifudeen Z, Du H, Dipp S, and El-Dahr SS. The bradykinin type 2 receptor is a target for p53-mediated transcriptional activation. J Biol Chem 275: 15557–15562, 2000.[Abstract/Free Full Text]
  48. Shieh SY, Ahn J, Tamai K, Taya Y, and Prives C. The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes Dev 14: 289–300, 2000.[Abstract/Free Full Text]
  49. Shook D and Keller R. Mechanisms, mechanics and function of epithelial-mesenchymal transitions in early development. Mech Dev 120: 1351–1383, 2003.[CrossRef][Web of Science][Medline]
  50. Steinhusen U, Weiske J, Badock V, Tauber R, Bommert K, and Huber O. Cleavage and shedding of E-cadherin after induction of apoptosis. J Biol Chem 276: 4972–4980, 2001.[Abstract/Free Full Text]
  51. Takeichi M. Cadherin cell adhesion receptors as a morphogenetic regulator. Science 251: 1451–1455, 1991.[Abstract/Free Full Text]
  52. Timmermann S, Lehrmann H, Polesskaya A, and Harel-Bellan A. Histone acetylation and disease. Cell Mol Life Sci 58: 728–736, 2001.[CrossRef][Web of Science][Medline]
  53. Vestweber D, Kemler R, and Ekblom P. Cell-adhesion molecule uvomorulin during kidney development. Dev Biol 112: 213–221, 1985.[CrossRef][Web of Science][Medline]
  54. Vousden KH and Woude GF. The ins and outs of p53. Nat Cell Biol 2: E178–180, 2000.[CrossRef][Web of Science][Medline]
  55. Wheelock MJ and Johnson KR. Cadherins as modulators of cellular phenotype. Annu Rev Cell Dev Biol 19: 207–235, 2003.[CrossRef][Web of Science][Medline]
  56. Woods DF, Hough C, Peel D, Callaini G, and Bryant PJ. Dlg protein is required for junction structure, cell polarity, and proliferation control in Drosophila epithelia. J Cell Biol 134: 1469–1482, 1996.[Abstract/Free Full Text]
  57. Yap AS and Kovacs EM. Direct cadherin-activated cell signaling: a view from the plasma membrane. J Cell Biol 160: 11–16, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
S. S. El-Dahr, K. Aboudehen, and S. Dipp
Bradykinin B2 receptor null mice harboring a Ser23-to-Ala substitution in the p53 gene are protected from renal dysgenesis
Am J Physiol Renal Physiol, November 1, 2008; 295(5): F1404 - F1413.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Fan, J. Stefkova, and S. S. El-Dahr
Susceptibility to metanephric apoptosis in bradykinin B2 receptor null mice via the p53-Bax pathway
Am J Physiol Renal Physiol, September 1, 2006; 291(3): F670 - F682.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Zamorano, S. Suchindran, and J. V. Gainer
3'-Untranslated region of the type 2 bradykinin receptor is a potent regulator of gene expression
Am J Physiol Renal Physiol, February 1, 2006; 290(2): F456 - F464.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. M. Bates
Transcriptional control of renal collecting duct development
Am J Physiol Renal Physiol, May 1, 2005; 288(5): F897 - F898.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/1/F98    most recent
00246.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fan, H.
Right arrow Articles by El-Dahr, S. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fan, H.
Right arrow Articles by El-Dahr, S. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.