|
|
||||||||
2Department of Physiology, University of Maryland School of Medicine, Baltimore, Maryland; and 1Department of Physiology, University of California, San Francisco, California
Submitted 25 June 2004 ; accepted in final form 6 October 2004
| ABSTRACT |
|---|
|
|
|---|
polarity; epithelial; basolateral membrane; apical membrane; CASK; synapse-associated protein-97
90 amino acid protein-interaction modules (13) that bind short protein motifs generally (31), but not always (11, 12), found at the extreme COOH terminus of target proteins. Proteins containing PDZ domains usually possess multiple protein-protein interaction domains, allowing them to orchestrate mutlimeric complex formation on specific membrane domains (10). The molecular scaffolding function is also well suited for polarized sorting and retention operations of target proteins. Lin-7 provides a prototypical example. Early evidence of a PDZ protein that can coordinate the polarized targeting of its interacting protein partners evolved from the identification of Lin-7 and two other PDZ-protein genes, Lin-2 and Lin-10, in Caenorhabditus elegans (15). The products of these genes form a protein complex that coordinates the expression of a receptor tyrosine kinase, Let-23, on the basolateral membrane of vulva progenitor cells (VPC). Null mutations in Lin-7, Lin-2, or Lin-10 cause the Let-23 receptor to become mislocalized to the apical membrane and disrupt VPC development. Studies to deduce the mechanism revealed that Lin-7 serves the primary role in localizing Let-23. This small protein is composed of an NH2-terminal L27 interaction module (7, 8) and a COOH-terminal PDZ domain, allowing it to interact directly with the receptor through a canonical type 1 PDZ interaction and simultaneously bind to Lin-2 via an L27 interaction (15, 30). Lin-2 (26), a member of the membrane-associated guanylate kinase (MAGUK) family (1), recruits Lin-10 to the complex via a separate interaction domain (2). Because Lin-10 can interact with microtubule motors (28) and Munc-18 docking machinery (4) in other systems, this component is generally believed to provide a basolateral membrane targeting and fusion function to intracellular vesicles containing the Lin-7/Lin-2/Lin-10 complex. Once docked, Lin-2 can interact with extracellular matrix receptors and the cytoskeleton (5). Consequently, the complex has the capacity to anchor Lin-7 interacting proteins, like Let-23, on the basolateral membrane.
Orthologous gene products (Lin-7 = Veli/MALS; Lin-2 = CASK; Lin-10 = Mint-1/X11) in mammalian systems form multimeric protein complexes that are similar to those initially identified in C. elegans. (2, 4). In the kidney, several Lin-7/Veli/MALS interacting proteins have been identified (20, 23, 24) and shown to depend on their PDZ binding motifs and/or CASK interaction (20, 32) for efficient basolateral membrane localization. While consistent with an evolutionary conserved polarization mechanism, there are some divergence and added complexity in mammalian renal epithelia. First, the closest mammalian Lin-10 ortholog, Mint-1, is not expressed in the mammalian kidney (2, 22), indicating that the Mint module is dispensable for polarized targeting in renal epithelia (23). Second, a group of CASK-like MAGUK proteins, all containing L27 heterodimerizaton domains, have been identified as potential partners of Lin-7/Veli/MALS (16, 35). Further increasing the potential for complexity, Lin-7 is actually represented by three different isoforms, encoded by separate genes. In mammalian systems, these are called Lin-7A/B/C or Veli 1, 2, 3 [vertebrate Lin-7 (4) or MALS 1, 2, 3 (for mammalian Lin seven) (14)]. Because there is a clear concordance between the names of MALS and Veli isoforms (MALS 1, 2, 3 = Veli 1, 2, 3) in mice, rats, and humans, we refer to the mammalian Lin-7 orthologs using the MALS/Veli nomenclature.
As a first step to more fully understand the function of the MALS/Veli isoforms in the mammalian kidney, the present studies were undertaken to determine where they are expressed as has been done for a number of other PDZ proteins in the kidney (3, 9, 34, 36), expanding an earlier study (33). Interestingly, we find that each MALS/Veli protein is differently localized along the length of the nephron. Furthermore, these proteins display distinct subcellular distribution patterns, depending on the isoform and the cell type. Collectively, these results suggest that MALS/Veli isoforms may perform different cellular tasks.
| METHODS |
|---|
|
|
|---|
Fixation of male 129/SvEv mouse and Sprague-Dawley rat kidneys was achieved by perfusion via the heart or abdominal aorta, respectively. Kidneys were perfused with PBS for 2 min to flush blood before fixation with paraformaldehyde (2%, 5- to 30-min perfusion) and cryoprotection (10% EDTA in 0.1 M Tris, 2-min perfusion). The use of animals followed the American Physiological Societys Guiding Principles in the Care and Use of Laboratory Animals and procedures approved by the Institutional Animal Care and Use Committee. Kidney sections (12 µm) were cut using a cryostat, placed on coverslips that were coated with HistoGrip (Zymed), and stored at 80°C. To perform immunolocalization, sections were first rehydrated with PBS and then treated with 6 M guanadine·HCl to unmask protein epitopes. Kidney sections were then washed three times in a high-salt buffer (PBS containing 1% BSA and 385 mM NaCl), blocked (PBS containing 1% BSA and 50 mM glycine), and incubated overnight with primary antibodies (10 µg/µl) at 4°C in PBS supplemented with 0.1% BSA and 0.02% NaN3. Sections were then washed at room temperature with the high-salt buffer (5x at 5-min intervals, one time for 15 min, and once for 30 min) to remove nonspecific binding. Alexa 488- and 568-conjugated secondary antibodies (1:100) were incubated for 2 h at 4°C in PBS containing with 0.1% BSA and 0.02% NaN3. Sections were then washed as described above, mounted onto slides in VectaShield, and sealed with nail polish.
To determine cellular localization of proteins, cells were visualized using the Zeiss 410 confocal laser-scanning microscope (Carl Zeiss) under a x63 oil-immersion lens.
Antibodies
Isoform-specific anti-MALS/Veli antibodies were raised against MALS/Veli isoform-specific sequences in rabbits as described previously (21). Polyclonal antibodies to the aquaporin-2 (AQP2) water channel (LC54) and the Na-K-2Cl cotransporter (LC20) were raised in chickens. The antibody to the Na-Cl cotransporter (NCC) was raised in guinea pigs (GP16). LC54 was previously described (36), and LC20 was raised in chickens to the same NH2-terminal peptide as an antibody raised in rabbits (L320) and previously described (17). GP16 was previously described (6). The Na-K-ATPase
-subunit antibody was purchased from Upstate Biotechnology.
RT-PCR
Mouse kidney RNA (
5 µg) was reversed transcribed using oligo dT (15 mer) and SuperScript III RT (Invitrogen) according to the manufacturers recommendations. PCR was carried out using the first-strand mouse kidney cDNA (RT+) or RNA (RT) as a template and primers corresponding to MALS isoform-specific sequences (MALS/Veli 1 forward primer, ATTGACAGTGGTCCAGCCGCTTAC, MALS/Veli 1 reverse primer TGTTGCTGCTGCTGAATGAGC); MALS/Veli 2 forward COS cells were grown at 37°C in 5% CO2 in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10 mM HEPES. Cells were transfected with the pCDNA vector containing either the MALS/Veli 1, MALS/Veli 2, or MALS/Veli 3 cDNAs using the Lipofectamine-Plus protocol according to the manufacturers recommendations. Forty-eight hours posttransfection, cells were washed once with ice-cold PBS, harvested, pelleted (2,000 g for 5 min), and resuspended (
5x the cell pellet volume) in PBS containing 1% Triton X-100 and a protease inhibitor cocktail (10 µg/ml antipain, 10 µg/ml leupeptin, 1 mM phenylmethylsulfonyl fluoride, and 10 µg/ml pepstatin A). Proteins were separated on a 10% SDS polyacrylamide gel and transferred to nitrocellulose (Amersham). For Western blotting, membranes were blocked in 3% BSA and then incubated with either the MALS/Veli 1, 2 (0.5 µg/ml), or MALS/Veli 3 antibodies (1:2,000) in 3% BSA followed by incubation with an horseradish peroxidase-conjugated anti-rabbit secondary system (Amersham).
| RESULTS |
|---|
|
|
|---|
To determine which MALS/Veli isoforms are expressed in the kidney, reverse transcription and PCR were performed with mouse kidney mRNA and MALS/Veli isoform-specific primers. As resolved by agarose gel electrophoresis and visualized by ethidium-bromide staining, reaction products of predicted size (615 bp for MALS/Veli 1, 482 bp for MALS/Veli 2, and 461 bp for MALS/Veli 3) were readily amplified from first-strand kidney cDNA using each of the MALS/Veli isoform-specific primers (Fig. 1A). No amplification products were detected when mRNA rather than cDNA was used as a template (RT), ruling out spurious genomic amplification. Restriction enzyme digestion produced expected size fragments for each of the MALS/Veli PCR amplicons (MALS/Veli 1+BsoBI 270, 345 bp; MALS/Veli 2+BsoBI 243, 239 bp; MALS/Veli 3+BseRI, 198, 263 bp), providing further evidence of MALS/Veli isoform identity (Fig. 1B). Thus each of the three MALS/Veli isoforms is expressed in the kidney.
|
MALS/Veli antibodies were raised against unique COOH-terminal amino acid sequences found in each MALS/Veli isoform as described previously (21). To validate antibody specificity, COS cells were transiently transfected with expression vectors containing MALS/Veli 1, MALS/Veli 2, or MALS/Veli 3 cDNAs. Proteins from COS cell lysates were resolved by SDS-PAGE and then analyzed by immunoblotting with each of the different MALS/Veli antibodies. As shown in Fig. 2A, each of the MALS/Veli antibodies specifically recognizes the cognate MALS/Veli protein without detecting the other MALS/Veli isoforms. Thus the MALS/Veli antibodies are isoform specific. Consistent with this notion, each of the antibodies exclusively detects an appropriately sized protein in the native kidney (Fig. 2B).
|
To determine the cellular localization of MALS/Veli proteins in the kidney, immunohistochemical analysis of rat and mouse kidney sections was performed using the MALS/Veli isoform-specific antibodies described above in combination with antibodies to identify particular renal epithelial cells. Because similar localization patterns were seen in mouse and rat kidney, we present our observations in the rat kidney for consistency.
MALS/Veli 1. We found that MALS/Veli 1 is expressed along the length of the nephron, but labeling is particularly strong in the glomerulus (Fig. 3A), thick ascending limb (TAL; Fig. 3C, green), and distal convoluted tubules (DCT; Fig. 3D, green). A peptide absorption control demonstrates that an excess of peptide blocks labeling by the anti-MALS/Veli 1 antibody (Fig. 3B). The labeling pattern in the glomerulus is consistent with localization in glomerular epithelial cells. Strong expression of MALS/Veli 1 in cells containing the NKCC2 transporter (Fig. 3C, red) verifies localization within the TAL. In this segment, the MALS/Veli 1 antibody predominately decorates an infolded structure opposite the apical membrane, consistent with preponderant expression along the basolateral membrane. Indeed, while some cytoplasmic localization cannot be entirely ruled out, MALS/Veli 1 antibody labeling largely tracks with the Na-K-ATPase (Fig. 3, D and E). As evidenced by colocalization in cells expressing NCC (Fig. 3F, red), MALS/Veli 1 is also expressed in the DCT. Similar to the TAL, the MALS/Veli 1 antibody primarily labels the basolateral membrane in the DCT (Fig. 3F, green). Relative to the TAL and DCT, the cortical and medullary collecting duct principal cells (AQP2-positive cells, Fig. 3G, red) are weakly labeled with the anti-MALS/Veli I antibody (Fig. 3G, green; Fig. 3H, white), similar to the weak basolateral membrane labeling in the proximal tubule (not shown). On the other hand, labeling of the intercalated cells of the outer (Fig. 3G, green; Fig. 3H, white, AQP2-negative cells) and inner (Fig. 4, green) medullary collecting duct is more intense. Interestingly, MALS/Veli 1 is found diffusely throughout the cytosol of intercalated cells in contrast to the basolateral location in other nephron segments.
|
|
|
|
The diagram in Fig. 7 summarizes the distribution of MALS/Veli proteins in rat and mouse kidney; cross-hatching represents regions of bright labeling, and stripes represent areas of weaker labeling. In the diagram for MALS/Veli 1 expression, dark circles in the collecting duct represent intense labeling in intercalated cells.
|
| DISCUSSION |
|---|
|
|
|---|
Recent biochemical and cell biological studies in renal epithelial culture models indicate that the MALS/Veli family of proteins function to coordinate the expression of specific target proteins on the basolateral membrane. According to our present understanding, L27 and PDZ protein-protein interaction modules in MALS/Veli proteins provide the mechanism. The MALS L27 domain is required for basolateral localization and interaction with CASK, the mammalian ortholog of Lin-2 (33). CASK associates with the basolateral membrane through a web of interactions, forming a mutimeric complex that has the capacity to act as a stable basolateral membrane anchor. Indeed, multiple protein-protein interaction sites allow CASK to simultaneously bind to MALS/Veli, extracellular matrix receptors (5), adhesion molecules (4), the actin cytoskeleton (5, 18), and another MAGUK protein termed SAP97 (18). Consequently, MALS/Veli proteins appear to recruit and stabilize PDZ target proteins at the basolateral membrane proteins by simultaneously interacting with CASK.
Available evidence is consistent with such a mechanism for proteins that interact with the PDZ domain of MALS/Veli in MDCK cells, including the epithelial GABA transporter BGT-1 (24), inward rectifer potassium channels Kir 2.3 (23) and Kir 2.2 (20), as well as ErbB receptor tyrosine kinases (29). Indeed, Perego et al. (24) found that removing the PDZ ligand in BGT-1 disrupted MALS/Veli association and dramatically increased the internalization of the transporter from the plasmalemma, consistent with a PDZ-dependent retention mechanism. Similarly, mutant Kir 2.3 channels, lacking the PDZ binding motif, are largely directed to an endosomal compartment (23) rather than the basolateral membrane (19). A similar missorting phenotype is observed with Kir 2.2 when MALS/Veli interaction with CASK is disrupted (20). Interestingly, removing the PDZ binding site from a chimeric LET-23/ nerve growth factor receptor protein (32) produces an apical-missorting phenotype. In this case, MALS-Veli interaction appears to stabilize the receptor on the basolateral membrane or limit postendocytic trafficking in such a way that it prevents transcytosis to the apical membrane.
The results of the present study strongly suggest that the MALS/Veli-dependent basolateral membrane targeting mechanism may be more significant in the TAL and distal segments than in the proximal tubule, corroborating previous observations (33). Certainly, we found that MALS/Veli 1 is predominately expressed in the TAL and DCT, whereas MALS/Veli 3 is largely expressed in the DCT and collecting duct. Of note, MALS 3 is chiefly located on the basal membrane of the collecting duct, contrasting the more uniform basolateral location of MALS/Veli 3 in the DCT and MALS/Veli 1 in the TAL and DCT. Importantly, the collective expression pattern of all MALS/Veli isoforms, reported here, generally agrees with observations of Straight et al. (33). Using an antibody that was raised against the whole mLin-7 protein, which presumably detects all MALS/Veli forms, this group of investigators showed that MALS/Veli proteins colocalize with CASK on the basolateral membrane of the TAL, distal tubule, and collecting duct as well as the glomerulus.
In contrast to previous observations with the pan-specific antibody (33), we also found intense labeling of MALS/Veli 1 and MALS/Veli 3 antibodies within the intercalated cell, a cell type well known to mediate acid-base transport (27). Because methodological aspects of both immunolocalization studies are identical, it is likely that differences in labeling are a consequence of differences in epitope recognition and accessibility rather than procedural differences. While future studies are required to precisely define the interaction partners and functions of the MALS/Veli isoforms in intercalated cells, the differential localization of MALS/Veli 1 and MALS/Veli 3 in these cells raises the possibility that the different MALS/Veli isoforms may play disparate roles in acid-base balance. Significantly, MALS/Veli 1 is expressed throughout the cytoplasm in inner medullary collecting duct intercalated cells, dramatically different from the prevailing basolateral localization in other cell types.
The different subcellular localization patterns of MALS/Veli proteins may arise from cell-specific expression of different MALS/Veli binding partners, isoform-specific binding preferences, or, more likely, a combination of the two. Although it is not known whether different MALS/Veli isoforms have distinct functions, the divergence in primary structure provides some clues. The MALS/Veli PDZ domains are very similar, exhibiting 91% amino acid sequence identity among the three isoforms. In fact, residues predicted to form a type I PDZ binding pocket (31) are absolutely conserved. Other regions, including the extreme NH2 and COOH termini, are much more different. Most importantly, perhaps, the L27 interaction modules exhibit only 57% amino acid identify between isoforms, raising the possibility that different isoforms preferentially bind to different L27 domain proteins. A group of CASK-like MUGAK proteins, all containing L27 heterodimerizaton domains, have been identified as potential partners of Lin-7 (PALS) (16, 35). The observation provides reason to suspect that different PALS might substitute for CASK under certain circumstances, forming MALS/Veli complexes with different subcellular locations and disparate functions. For instance, Pals1 might target Lin-7 to the tight junction (25), in contrast to the basolateral membrane location of the CASK/Lin-7 complex (33).
In conclusion, we have found that MALS/Veli isoforms are differentially localized along the length of the nephron. The observation provides reason to suggest that different MALS/Veli isoforms carry out cell-type specific functions. Based on the localization, the TAL and distal segments appear to have the most significant capacity for a basolateral membrane-targeting mechanism, involving different MALS/Veli isoforms.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
1 subunit of the H+ ATPase is a PDZ domain-binding protein. Colocalization with NHE-RF in renal B-intercalated cells. J Biol Chem 275: 1821918224, 2000.This article has been cited by other articles:
![]() |
L. Lozovatsky, N. Abayasekara, S. Piawah, and Z. Walther CASK Deletion in Intestinal Epithelia Causes Mislocalization of LIN7C and the DLG1/Scrib Polarity Complex without Affecting Cell Polarity Mol. Biol. Cell, November 1, 2009; 20(21): 4489 - 4499. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yang, J. Zou, D. R. Hyde, L. A. Davidson, and X. Wei Stepwise Maturation of Apicobasal Polarity of the Neuroepithelium Is Essential for Vertebrate Neurulation J. Neurosci., September 16, 2009; 29(37): 11426 - 11440. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Bulgakova and E. Knust The Crumbs complex: from epithelial-cell polarity to retinal degeneration J. Cell Sci., August 1, 2009; 122(15): 2587 - 2596. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sindic, C. Huang, A.-P. Chen, Y. Ding, W. A. Miller-Little, D. Che, M. F. Romero, and R. T. Miller MUPP1 complexes renal K+ channels to alter cell surface expression and whole cell currents Am J Physiol Renal Physiol, July 1, 2009; 297(1): F36 - F45. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Srinivasan, J. Roosa, O. Olsen, S.-H. Lee, D. S. Bredt, and S. K. McConnell MALS-3 regulates polarity and early neurogenesis in the developing cerebral cortex Development, May 15, 2008; 135(10): 1781 - 1790. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alewine, B.-y. Kim, V. Hegde, and P. A. Welling Lin-7 targets the Kir 2.3 channel on the basolateral membrane via a L27 domain interaction with CASK Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1733 - C1741. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Olsen, L. Funke, J.-f. Long, M. Fukata, T. Kazuta, J. C. Trinidad, K. A. Moore, H. Misawa, P. A. Welling, A. L. Burlingame, et al. Renal defects associated with improper polarization of the CRB and DLG polarity complexes in MALS-3 knockout mice J. Cell Biol., October 8, 2007; 179(1): 151 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alewine, O. Olsen, J. B. Wade, and P. A. Welling TIP-1 Has PDZ Scaffold Antagonist Activity Mol. Biol. Cell, October 1, 2006; 17(10): 4200 - 4211. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |