AJP - Renal Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 288: F345-F352, 2005. First published October 19, 2004; doi:10.1152/ajprenal.00235.2004
0363-6127/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/F345    most recent
00235.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Olsen, O.
Right arrow Articles by Welling, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Olsen, O.
Right arrow Articles by Welling, P. A.

Differential localization of mammalian Lin-7 (MALS/Veli) PDZ proteins in the kidney

Olav Olsen,1,2 James B. Wade,1 Nick Morin,1 David S. Bredt,2 and Paul A. Welling1,2

2Department of Physiology, University of Maryland School of Medicine, Baltimore, Maryland; and 1Department of Physiology, University of California, San Francisco, California

Submitted 25 June 2004 ; accepted in final form 6 October 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Lin-7 PDZ proteins, also called MALS or Velis, have been shown to coordinate basolateral membrane expression of various target proteins in renal epithelial cell models. Three different Lin-7/MALS/Veli isoforms, encoded by separate genes, have been identified. Here, we show that each Lin-7/MALS/Veli isoform is expressed in the kidney. Using MALS isoform-specific antibodies in combination with cell-specific marker antibodies, we found the products of the three mammalian Lin-7/MALS/Veli genes are differentially expressed along the length of the nephron. MALS/Veli 1 is predominately expressed in the glomerulus, thick ascending limb of Henle’s loop (TAL), and the distal convoluted tubule (DCT). MALS/Veli 2 is exclusively expressed in the vasa recta. MALS/Veli 3 is largely located in the DCT and collecting duct. The subcellular localization of MALS/Veli proteins can vary, depending on the isoform and the cell type. In contrast to the predominate basolateral location of MALS/Veli 1 in the TAL and DCT and MALS/Veli 3 in the DCT, MALS/Veli 1 is found diffusely throughout the cytosol of intercalated cells. In the collecting duct, MALS/Veli 3 is chiefly located on the basal membrane. Collectively, these results suggest that different MALS/Veli isoforms may carry out cell type-specific functions. The TAL and distal segments appear to have the most significant capacity for a basolateral membrane-targeting mechanism involving different MALS/Veli isoforms.

polarity; epithelial; basolateral membrane; apical membrane; CASK; synapse-associated protein-97


PDZ-DOMAIN PROTEINS PLAY IMPORTANT roles in establishing and maintaining an asymmetric distribution of membrane proteins in polarized epithelial cells. Named after the homologous group of proteins in which they were originally identified [PSD 95, a postsynaptic density protein; Dlg (Drosophila Disc large); and ZO-1], PDZ domains are ~90 amino acid protein-interaction modules (13) that bind short protein motifs generally (31), but not always (11, 12), found at the extreme COOH terminus of target proteins. Proteins containing PDZ domains usually possess multiple protein-protein interaction domains, allowing them to orchestrate mutlimeric complex formation on specific membrane domains (10). The molecular scaffolding function is also well suited for polarized sorting and retention operations of target proteins. Lin-7 provides a prototypical example.

Early evidence of a PDZ protein that can coordinate the polarized targeting of its interacting protein partners evolved from the identification of Lin-7 and two other PDZ-protein genes, Lin-2 and Lin-10, in Caenorhabditus elegans (15). The products of these genes form a protein complex that coordinates the expression of a receptor tyrosine kinase, Let-23, on the basolateral membrane of vulva progenitor cells (VPC). Null mutations in Lin-7, Lin-2, or Lin-10 cause the Let-23 receptor to become mislocalized to the apical membrane and disrupt VPC development. Studies to deduce the mechanism revealed that Lin-7 serves the primary role in localizing Let-23. This small protein is composed of an NH2-terminal L27 interaction module (7, 8) and a COOH-terminal PDZ domain, allowing it to interact directly with the receptor through a canonical type 1 PDZ interaction and simultaneously bind to Lin-2 via an L27 interaction (15, 30). Lin-2 (26), a member of the membrane-associated guanylate kinase (MAGUK) family (1), recruits Lin-10 to the complex via a separate interaction domain (2). Because Lin-10 can interact with microtubule motors (28) and Munc-18 docking machinery (4) in other systems, this component is generally believed to provide a basolateral membrane targeting and fusion function to intracellular vesicles containing the Lin-7/Lin-2/Lin-10 complex. Once docked, Lin-2 can interact with extracellular matrix receptors and the cytoskeleton (5). Consequently, the complex has the capacity to anchor Lin-7 interacting proteins, like Let-23, on the basolateral membrane.

Orthologous gene products (Lin-7 = Veli/MALS; Lin-2 = CASK; Lin-10 = Mint-1/X11) in mammalian systems form multimeric protein complexes that are similar to those initially identified in C. elegans. (2, 4). In the kidney, several Lin-7/Veli/MALS interacting proteins have been identified (20, 23, 24) and shown to depend on their PDZ binding motifs and/or CASK interaction (20, 32) for efficient basolateral membrane localization. While consistent with an evolutionary conserved polarization mechanism, there are some divergence and added complexity in mammalian renal epithelia. First, the closest mammalian Lin-10 ortholog, Mint-1, is not expressed in the mammalian kidney (2, 22), indicating that the Mint module is dispensable for polarized targeting in renal epithelia (23). Second, a group of CASK-like MAGUK proteins, all containing L27 heterodimerizaton domains, have been identified as potential partners of Lin-7/Veli/MALS (16, 35). Further increasing the potential for complexity, Lin-7 is actually represented by three different isoforms, encoded by separate genes. In mammalian systems, these are called Lin-7A/B/C or Veli 1, 2, 3 [vertebrate Lin-7 (4) or MALS 1, 2, 3 (for mammalian Lin seven) (14)]. Because there is a clear concordance between the names of MALS and Veli isoforms (MALS 1, 2, 3 = Veli 1, 2, 3) in mice, rats, and humans, we refer to the mammalian Lin-7 orthologs using the MALS/Veli nomenclature.

As a first step to more fully understand the function of the MALS/Veli isoforms in the mammalian kidney, the present studies were undertaken to determine where they are expressed as has been done for a number of other PDZ proteins in the kidney (3, 9, 34, 36), expanding an earlier study (33). Interestingly, we find that each MALS/Veli protein is differently localized along the length of the nephron. Furthermore, these proteins display distinct subcellular distribution patterns, depending on the isoform and the cell type. Collectively, these results suggest that MALS/Veli isoforms may perform different cellular tasks.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Immunofluorescence and Confocal Microscopy

Fixation of male 129/SvEv mouse and Sprague-Dawley rat kidneys was achieved by perfusion via the heart or abdominal aorta, respectively. Kidneys were perfused with PBS for 2 min to flush blood before fixation with paraformaldehyde (2%, 5- to 30-min perfusion) and cryoprotection (10% EDTA in 0.1 M Tris, 2-min perfusion). The use of animals followed the American Physiological Society’s Guiding Principles in the Care and Use of Laboratory Animals and procedures approved by the Institutional Animal Care and Use Committee. Kidney sections (12 µm) were cut using a cryostat, placed on coverslips that were coated with HistoGrip (Zymed), and stored at –80°C. To perform immunolocalization, sections were first rehydrated with PBS and then treated with 6 M guanadine·HCl to unmask protein epitopes. Kidney sections were then washed three times in a high-salt buffer (PBS containing 1% BSA and 385 mM NaCl), blocked (PBS containing 1% BSA and 50 mM glycine), and incubated overnight with primary antibodies (10 µg/µl) at 4°C in PBS supplemented with 0.1% BSA and 0.02% NaN3. Sections were then washed at room temperature with the high-salt buffer (5x at 5-min intervals, one time for 15 min, and once for 30 min) to remove nonspecific binding. Alexa 488- and 568-conjugated secondary antibodies (1:100) were incubated for 2 h at 4°C in PBS containing with 0.1% BSA and 0.02% NaN3. Sections were then washed as described above, mounted onto slides in VectaShield, and sealed with nail polish.

To determine cellular localization of proteins, cells were visualized using the Zeiss 410 confocal laser-scanning microscope (Carl Zeiss) under a x63 oil-immersion lens.

Antibodies

Isoform-specific anti-MALS/Veli antibodies were raised against MALS/Veli isoform-specific sequences in rabbits as described previously (21). Polyclonal antibodies to the aquaporin-2 (AQP2) water channel (LC54) and the Na-K-2Cl cotransporter (LC20) were raised in chickens. The antibody to the Na-Cl cotransporter (NCC) was raised in guinea pigs (GP16). LC54 was previously described (36), and LC20 was raised in chickens to the same NH2-terminal peptide as an antibody raised in rabbits (L320) and previously described (17). GP16 was previously described (6). The Na-K-ATPase {alpha}-subunit antibody was purchased from Upstate Biotechnology.

RT-PCR

Mouse kidney RNA (~5 µg) was reversed transcribed using oligo dT (15 mer) and SuperScript III RT (Invitrogen) according to the manufacturer’s recommendations. PCR was carried out using the first-strand mouse kidney cDNA (RT+) or RNA (RT–) as a template and primers corresponding to MALS isoform-specific sequences (MALS/Veli 1 forward primer, ATTGACAGTGGTCCAGCCGCTTAC, MALS/Veli 1 reverse primer TGTTGCTGCTGCTGAATGAGC); MALS/Veli 2 forward COS cells were grown at 37°C in 5% CO2 in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10 mM HEPES. Cells were transfected with the pCDNA vector containing either the MALS/Veli 1, MALS/Veli 2, or MALS/Veli 3 cDNAs using the Lipofectamine-Plus protocol according to the manufacturer’s recommendations. Forty-eight hours posttransfection, cells were washed once with ice-cold PBS, harvested, pelleted (2,000 g for 5 min), and resuspended (~5x the cell pellet volume) in PBS containing 1% Triton X-100 and a protease inhibitor cocktail (10 µg/ml antipain, 10 µg/ml leupeptin, 1 mM phenylmethylsulfonyl fluoride, and 10 µg/ml pepstatin A). Proteins were separated on a 10% SDS polyacrylamide gel and transferred to nitrocellulose (Amersham). For Western blotting, membranes were blocked in 3% BSA and then incubated with either the MALS/Veli 1, 2 (0.5 µg/ml), or MALS/Veli 3 antibodies (1:2,000) in 3% BSA followed by incubation with an horseradish peroxidase-conjugated anti-rabbit secondary system (Amersham).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Expression of MALS/Veli Isoforms in the Kidney

To determine which MALS/Veli isoforms are expressed in the kidney, reverse transcription and PCR were performed with mouse kidney mRNA and MALS/Veli isoform-specific primers. As resolved by agarose gel electrophoresis and visualized by ethidium-bromide staining, reaction products of predicted size (615 bp for MALS/Veli 1, 482 bp for MALS/Veli 2, and 461 bp for MALS/Veli 3) were readily amplified from first-strand kidney cDNA using each of the MALS/Veli isoform-specific primers (Fig. 1A). No amplification products were detected when mRNA rather than cDNA was used as a template (RT), ruling out spurious genomic amplification. Restriction enzyme digestion produced expected size fragments for each of the MALS/Veli PCR amplicons (MALS/Veli 1+BsoBI 270, 345 bp; MALS/Veli 2+BsoBI 243, 239 bp; MALS/Veli 3+BseRI, 198, 263 bp), providing further evidence of MALS/Veli isoform identity (Fig. 1B). Thus each of the three MALS/Veli isoforms is expressed in the kidney.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1. Detection of transcripts encoding each MALS/Veli isoform in the kidney. A: PCR products of predicted size, resolved by agarose gel electrophoresis and visualized by ethidium bromide staining, were produced with MALS/Veli 1-, MALS/Veli 2-, or MALS/Veli 3-specific primers and reverse- transcribed (RT+) mouse kidney mRNA. As a negative control, reactions were conducted on kidney RNA without reverse transcription (RT–). B: restriction enzyme fragment analysis of the MALS/Veli 1 (BsoBI), MALS/Veli 2 (BsoBI), and MALS/Veli 3 (BseRI) amplicons. Predicted-size fragments were resolved by agarose gel electrophoresis and visualized by ethidium bromide staining.

 
Characterization of MALS/Veli Isoform-Specific Antibodies

MALS/Veli antibodies were raised against unique COOH-terminal amino acid sequences found in each MALS/Veli isoform as described previously (21). To validate antibody specificity, COS cells were transiently transfected with expression vectors containing MALS/Veli 1, MALS/Veli 2, or MALS/Veli 3 cDNAs. Proteins from COS cell lysates were resolved by SDS-PAGE and then analyzed by immunoblotting with each of the different MALS/Veli antibodies. As shown in Fig. 2A, each of the MALS/Veli antibodies specifically recognizes the cognate MALS/Veli protein without detecting the other MALS/Veli isoforms. Thus the MALS/Veli antibodies are isoform specific. Consistent with this notion, each of the antibodies exclusively detects an appropriately sized protein in the native kidney (Fig. 2B).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2. Characterization of MALS isoform-specific antibodies. A: Western blot analysis of protein lysates from wild-type COS cells (lane 1) transfected with either MALS/Veli 1 (lane 2), MALS/Veli 2 (lane 3), or MALS/Veli 3 (lane 4) cDNAs and independently probed with one of the MALS/Veli-specific antibodies (anti-MALS/Veli 1, 2, 3). B: Western blot analysis of protein lysates from the kidney with each of the MALS/Veli-specific antibodies (anti-MALS/Veli 1, 2, 3).

 
Immunolocalization of MALS Isoforms in the Kidney

To determine the cellular localization of MALS/Veli proteins in the kidney, immunohistochemical analysis of rat and mouse kidney sections was performed using the MALS/Veli isoform-specific antibodies described above in combination with antibodies to identify particular renal epithelial cells. Because similar localization patterns were seen in mouse and rat kidney, we present our observations in the rat kidney for consistency.

MALS/Veli 1. We found that MALS/Veli 1 is expressed along the length of the nephron, but labeling is particularly strong in the glomerulus (Fig. 3A), thick ascending limb (TAL; Fig. 3C, green), and distal convoluted tubules (DCT; Fig. 3D, green). A peptide absorption control demonstrates that an excess of peptide blocks labeling by the anti-MALS/Veli 1 antibody (Fig. 3B). The labeling pattern in the glomerulus is consistent with localization in glomerular epithelial cells. Strong expression of MALS/Veli 1 in cells containing the NKCC2 transporter (Fig. 3C, red) verifies localization within the TAL. In this segment, the MALS/Veli 1 antibody predominately decorates an infolded structure opposite the apical membrane, consistent with preponderant expression along the basolateral membrane. Indeed, while some cytoplasmic localization cannot be entirely ruled out, MALS/Veli 1 antibody labeling largely tracks with the Na-K-ATPase (Fig. 3, D and E). As evidenced by colocalization in cells expressing NCC (Fig. 3F, red), MALS/Veli 1 is also expressed in the DCT. Similar to the TAL, the MALS/Veli 1 antibody primarily labels the basolateral membrane in the DCT (Fig. 3F, green). Relative to the TAL and DCT, the cortical and medullary collecting duct principal cells (AQP2-positive cells, Fig. 3G, red) are weakly labeled with the anti-MALS/Veli I antibody (Fig. 3G, green; Fig. 3H, white), similar to the weak basolateral membrane labeling in the proximal tubule (not shown). On the other hand, labeling of the intercalated cells of the outer (Fig. 3G, green; Fig. 3H, white, AQP2-negative cells) and inner (Fig. 4, green) medullary collecting duct is more intense. Interestingly, MALS/Veli 1 is found diffusely throughout the cytosol of intercalated cells in contrast to the basolateral location in other nephron segments.



View larger version (82K):
[in this window]
[in a new window]
 
Fig. 3. Immunofluorescence localization of MALS1 in rat cortex and outer medulla. A: anti-MALS/Veli 1 antibody brightly labels glomeruli in the cortex of rat kidney sections. B: a peptide absorption control demonstrates that an excess of peptide blocks labeling by the anti-MALS/Veli 1 antibody. Scale bar = 25 µm (A and B). C: kidney sections stained for MALS1 (green) and the Na-K-2Cl cotransporter (NKCC2; red). CD, collecting duct (scale bar = 25 µm; inset = 6 µm). D: thick ascending limb labeled with the anti-MALS/Veli 1 antibody or with an anti-Na-K-ATPase-{alpha} antibody (E). Scale bar = 6 µm. F: anti-Na-Cl cotransporter (NCC) antibody labels the apical membrane (red) of distal convoluted tubule cells (DCT), whereas the basolateral membrane is intensely labeled by the MALS/Veli 1 antibody (green). Scale bar = 6 µm. G: sections of the outer medulla stained with an anti-aquaporin-2 (AQP2) antibody (LC54) that labels the apical membrane of collecting principal cells (red). In contrast to weak labeling of the AQP2-positive principal cells, the basolateral membrane of cells in the thick ascending limb (TAL) are brightly labeled by the MALS/Veli 1 antibody (green). H: black-and-white image of the one shown in G demonstrating differences in MALS/Veli 1 antibody labeling in the TAL and CD. Arrowheads point to intercalated cells. Scale bar = 25 µm (G and H).

 


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 4. Immunofluorescence localization of MALS1 in the inner medullary collecting duct. Colocalization of the MALS/Veli 1 (green) with a marker for the basolateral membrane (Na-K-ATPase-{alpha}, red) is shown. Cytoplasmic labeling of minority intercalated cells with MALS/Veli 1. Scale bar = 25 µm.

 
MALS/Veli 2. Having established the distribution of MALS/Veli 1 in the kidney, we next investigated renal expression of MALS/Veli 2. In contrast to MALS/Veli 1, the MALS/Veli 2 antibody shows little to no labeling of the nephron. Instead, MALS/Veli 2 is predominately expressed in the vasa recta. A typical example is provided in Fig. 5, showing an outer medullary kidney section stained with antibodies against MALS/Veli 2 and the NKCC2 cotransporter. The anti-NKCC2 cotransporter antibody sharply labels the apical membrane of cells in the TAL (Fig. 5A, red). In contrast, MALS/Veli 3 antibodies only label the adjacent thin-walled structures of the vascular bundles (VB) in the outer medulla (Fig. 5A, green). No labeling is detected on antibody absorption with the cognate MALS/Veli 2 peptide (Fig. 5B).



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 5. Immunolocalization of MALS/Veli 2 the in rat kidney. A: an antibody specifically directed against MALS/Veli 2 predominately labels vessels in the vascular bundles (VB) of the outer medulla (green). Sections are costained with an anti-NKCC2 cotransporter antibody, labeling the apical membrane of cells in the TAL. B: incubation of MALS/Veli 2 antibody with an excess of peptide blocks labeling. Scale bar = 25 µm.

 
MALS 3. Finally, the anti-MALS/Veli 3-specific antibody was used to examine the distribution of MALS3 in the kidney. Figure 6A shows colabeling of MALS/Veli 3 and AQP2 in the outer medulla. In contrast to the predominant expression of MALS/Veli 1 in collecting duct intercalated cells, the anti-MALS/Veli 3 antibody brightly labels the basolateral membrane of both principal and intercalated cells in the outer medullary collecting duct (green). A similar pattern is seen in the cortical collecting duct. In both cortical and medullary collecting ducts, MALS/Veli 3 labeling is particularly striking along the basal membrane. MALS/Veli 3 appears to be similarly expressed in principal cells (AQP2-positive cells, red) and intercalated cells in the collecting duct.



View larger version (117K):
[in this window]
[in a new window]
 
Fig. 6. Immunolocalization of MALS/Veli 3 in rat kidney. An antibody specifically directed against MALS 3 predominately labels the basal membrane in the CD and the basolateral membrane in the DCT. A: strong labeling of MALS/Veli 3 (green)- and AQP2-positive cells (red) in the CD (arrows). Intercalated cells are identified by arrowheads. B: relative to the CD, adjacent TAL exhibit much weaker MALS/Veli 3 staining. C: basolateral membrane expression of MALS/Veli 3 (green) in the NCC-positive (red) DCT. Note the predominate basal membrane staining in the neighboring CD. D: peptide absorption control demonstrates that an excess of peptide blocks labeling by the anti-MALS/Veli 3 antibody. Scale bar = 25 µm.

 
The MALS/Veli 3 antibody also brightly labels cells coexpressing the NCC (Fig. 6C, red), consistent with MALS/Veli 3 expression in DCT cells (Fig. 6C, green). In this segment, MALS/Veli 3 is expressed uniformly along the basolateral membrane. Compared with the intense labeling in the collecting duct and DCT, the basolateral membrane of the TAL is only weakly labeled with the MALS/Veli 3 antibody (Fig. 6B).

The diagram in Fig. 7 summarizes the distribution of MALS/Veli proteins in rat and mouse kidney; cross-hatching represents regions of bright labeling, and stripes represent areas of weaker labeling. In the diagram for MALS/Veli 1 expression, dark circles in the collecting duct represent intense labeling in intercalated cells.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7. Summary of the distribution of MALS/Veli proteins in rat kidney. Cross-hatched areas represent regions of bright labeling, and stripes represent areas of weaker labeling. In the diagram for MALS/Veli expression (A), dark circles in the CD represent intense labeling in intercalated cells. C, cortex; OS, outer stripe; IS, inner stripe; IM, inner medulla.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The major finding of this study is that the products of the three mLin-7/MALS/Veli genes are differentially expressed along the length of the nephron. These observations are reminiscent of the distribution of MALS/Veli in the brain, where individual isoforms discreetly localize within specific neuronal populations (21). In addition to the heterogeneous expression of MALS/Veli in the kidney, we also found that the subcellular localization of MALS/Veli proteins can vary with their expression in different renal epithelial cell types. Collectively, these results suggest that different MALS/Veli isoforms may carry out cell type-specific functions in the kidney.

Recent biochemical and cell biological studies in renal epithelial culture models indicate that the MALS/Veli family of proteins function to coordinate the expression of specific target proteins on the basolateral membrane. According to our present understanding, L27 and PDZ protein-protein interaction modules in MALS/Veli proteins provide the mechanism. The MALS L27 domain is required for basolateral localization and interaction with CASK, the mammalian ortholog of Lin-2 (33). CASK associates with the basolateral membrane through a web of interactions, forming a mutimeric complex that has the capacity to act as a stable basolateral membrane anchor. Indeed, multiple protein-protein interaction sites allow CASK to simultaneously bind to MALS/Veli, extracellular matrix receptors (5), adhesion molecules (4), the actin cytoskeleton (5, 18), and another MAGUK protein termed SAP97 (18). Consequently, MALS/Veli proteins appear to recruit and stabilize PDZ target proteins at the basolateral membrane proteins by simultaneously interacting with CASK.

Available evidence is consistent with such a mechanism for proteins that interact with the PDZ domain of MALS/Veli in MDCK cells, including the epithelial GABA transporter BGT-1 (24), inward rectifer potassium channels Kir 2.3 (23) and Kir 2.2 (20), as well as ErbB receptor tyrosine kinases (29). Indeed, Perego et al. (24) found that removing the PDZ ligand in BGT-1 disrupted MALS/Veli association and dramatically increased the internalization of the transporter from the plasmalemma, consistent with a PDZ-dependent retention mechanism. Similarly, mutant Kir 2.3 channels, lacking the PDZ binding motif, are largely directed to an endosomal compartment (23) rather than the basolateral membrane (19). A similar missorting phenotype is observed with Kir 2.2 when MALS/Veli interaction with CASK is disrupted (20). Interestingly, removing the PDZ binding site from a chimeric LET-23/ nerve growth factor receptor protein (32) produces an apical-missorting phenotype. In this case, MALS-Veli interaction appears to stabilize the receptor on the basolateral membrane or limit postendocytic trafficking in such a way that it prevents transcytosis to the apical membrane.

The results of the present study strongly suggest that the MALS/Veli-dependent basolateral membrane targeting mechanism may be more significant in the TAL and distal segments than in the proximal tubule, corroborating previous observations (33). Certainly, we found that MALS/Veli 1 is predominately expressed in the TAL and DCT, whereas MALS/Veli 3 is largely expressed in the DCT and collecting duct. Of note, MALS 3 is chiefly located on the basal membrane of the collecting duct, contrasting the more uniform basolateral location of MALS/Veli 3 in the DCT and MALS/Veli 1 in the TAL and DCT. Importantly, the collective expression pattern of all MALS/Veli isoforms, reported here, generally agrees with observations of Straight et al. (33). Using an antibody that was raised against the whole mLin-7 protein, which presumably detects all MALS/Veli forms, this group of investigators showed that MALS/Veli proteins colocalize with CASK on the basolateral membrane of the TAL, distal tubule, and collecting duct as well as the glomerulus.

In contrast to previous observations with the pan-specific antibody (33), we also found intense labeling of MALS/Veli 1 and MALS/Veli 3 antibodies within the intercalated cell, a cell type well known to mediate acid-base transport (27). Because methodological aspects of both immunolocalization studies are identical, it is likely that differences in labeling are a consequence of differences in epitope recognition and accessibility rather than procedural differences. While future studies are required to precisely define the interaction partners and functions of the MALS/Veli isoforms in intercalated cells, the differential localization of MALS/Veli 1 and MALS/Veli 3 in these cells raises the possibility that the different MALS/Veli isoforms may play disparate roles in acid-base balance. Significantly, MALS/Veli 1 is expressed throughout the cytoplasm in inner medullary collecting duct intercalated cells, dramatically different from the prevailing basolateral localization in other cell types.

The different subcellular localization patterns of MALS/Veli proteins may arise from cell-specific expression of different MALS/Veli binding partners, isoform-specific binding preferences, or, more likely, a combination of the two. Although it is not known whether different MALS/Veli isoforms have distinct functions, the divergence in primary structure provides some clues. The MALS/Veli PDZ domains are very similar, exhibiting 91% amino acid sequence identity among the three isoforms. In fact, residues predicted to form a type I PDZ binding pocket (31) are absolutely conserved. Other regions, including the extreme NH2 and COOH termini, are much more different. Most importantly, perhaps, the L27 interaction modules exhibit only 57% amino acid identify between isoforms, raising the possibility that different isoforms preferentially bind to different L27 domain proteins. A group of CASK-like MUGAK proteins, all containing L27 heterodimerizaton domains, have been identified as potential partners of Lin-7 (PALS) (16, 35). The observation provides reason to suspect that different PALS might substitute for CASK under certain circumstances, forming MALS/Veli complexes with different subcellular locations and disparate functions. For instance, Pals1 might target Lin-7 to the tight junction (25), in contrast to the basolateral membrane location of the CASK/Lin-7 complex (33).

In conclusion, we have found that MALS/Veli isoforms are differentially localized along the length of the nephron. The observation provides reason to suggest that different MALS/Veli isoforms carry out cell-type specific functions. Based on the localization, the TAL and distal segments appear to have the most significant capacity for a basolateral membrane-targeting mechanism, involving different MALS/Veli isoforms.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported in part by funds from the National Institute of Diabetes and Digestive and Kidney Diseases (DK-54231 and DK-63049 to P. A. Welling and DK-32839 to J. B. Wade).


    ACKNOWLEDGMENTS
 
We especially thank Jie Liu for expert technical assistance.


    FOOTNOTES
 

Address for reprint requests and other correspondence: P. A. Welling, Dept. of Physiology, Univ. of Maryland School of Medicine, 655 W. Baltimore St., Balimore, MD 21201 (E-mail: pwelling{at}umaryland.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Anderson JM. Cell signalling: MAGUK magic. Curr Biol 6: 382–384, 1996.[CrossRef][Web of Science][Medline]
  2. Borg JP, Straight SW, Kaech SM, de Taddeo-Borg M, Kroon DE, Karnak D, Turner RS, Kim SK, and Margolis B. Identification of an evolutionarily conserved heterotrimeric protein complex involved in protein targeting. J Biol Chem 273: 31633–31636, 1998.[Abstract/Free Full Text]
  3. Breton S, Wiederhold T, Marshansky V, Nsumu NN, Ramesh V, and Brown D. The {beta}1 subunit of the H+ ATPase is a PDZ domain-binding protein. Colocalization with NHE-RF in renal B-intercalated cells. J Biol Chem 275: 18219–18224, 2000.[Abstract/Free Full Text]
  4. Butz S, Okamoto M, and Sudhof TC. A tripartite protein complex with the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Cell 94: 773–782, 1998.[CrossRef][Web of Science][Medline]
  5. Cohen AR, Woods DF, Marfatia SM, Walther Z, Chishti AH, Anderson JM, and Wood DFW. Human CASK/LIN-2 binds syndecan-2 and protein 4.1 and localizes to the basolateral membrane of epithelial cells. J Cell Biol 142: 129–138, 1998.[Abstract/Free Full Text]
  6. Coleman RA, Wu DC, Liu J, and Wade JB. Expression of aquaporins in the renal connecting tubule. Am J Physiol Renal Physiol 279: F874–F883, 2000.[Abstract/Free Full Text]
  7. Doerks T, Bork P, Kamberov E, Makarova O, Muecke S, and Margolis B. L27, a novel heterodimerization domain in receptor targeting proteins Lin-2 and Lin-7. Trends Biochem Sci 25: 317–318, 2000.[CrossRef][Web of Science][Medline]
  8. Feng W, Long JF, Fan JS, Suetake T, and Zhang M. The tetrameric L27 domain complex as an organization platform for supramolecular assemblies. Nat Struct Mol Biol 11: 475–480, 2004.[CrossRef][Web of Science][Medline]
  9. Gisler SM, Pribanic S, Bacic D, Forrer P, Gantenbein A, Sabourin LA, Tsuji A, Zhao ZS, Manser E, Biber J, and Murer H. PDZK1. I. A major scaffolder in brush borders of proximal tubular cells. Kidney Int 64: 1733–1745, 2003.[CrossRef][Web of Science][Medline]
  10. Gomperts SN. Clustering membrane proteins: it’s all coming together with the PSD-95/SAP90 protein family. Cell 84: 659–662, 1996.[CrossRef][Web of Science][Medline]
  11. Harris BZ, Hillier BJ, and Lim WA. Energetic determinants of internal motif recognition by PDZ domains. Biochim Biophys Acta 40: 5921–5930, 2001.
  12. Hillier BJ, Christopherson KS, Prehoda KE, Bredt DS, and Lim WA. Unexpected modes of PDZ domain scaffolding revealed by structure of nNOS syntrophin complex. Science 284: 812–815, 1999.[Abstract/Free Full Text]
  13. Hunt CA, Schenker LJ, and Kennedy MB. PSD-95 is associated with the postsynaptic density and not with the presynaptic membrane at forebrain synapses. J Neurosci 16: 1380–1388, 1996.[Abstract/Free Full Text]
  14. Jo K, Derin R, Li M, and Bredt DS. Characterization of MALS/Velis-1, -2, and 3: a family of mammalian LIN-7 homologs enriched at brain synapses in association with the postsynaptic density-95/NMDA receptor postsynaptic complex. J Neurosci 19: 4189–4199, 1999.[Abstract/Free Full Text]
  15. Kaech SM, Whitfield CW, and Kim SK. The LIN-2/LIN-7/LIN-10 complex mediates basolateral membrane localization of the C. elegans EGF receptor LET-23 in vulval epithelial cells. Cell 94: 761–771, 1998.[CrossRef][Web of Science][Medline]
  16. Kamberov E, Makarova O, Roh M, Liu A, Karnak D, Straight S, and Margolis B. Molecular cloning and characterization of Pals, proteins associated with mLin7. J Biol Chem 275: 11425–11431, 2000.[Abstract/Free Full Text]
  17. Kim GH, Ecelbarger CA, Mitchell C, Packer RK, Wade JB, and Knepper MA. Vasopressin increases Na-K-2Cl cotransporter expression in thick ascending limb of Henle’s loop. Am J Physiol Renal Physiol 276: F96–F103, 1999.[Abstract/Free Full Text]
  18. Lee S, Fan S, Makarova O, Straight S, and Margolis B. A novel and conserved protein-protein interaction domain of mammalian Lin-2/CASK binds and recruits SAP97 to the lateral surface of epithelia. Mol Cell Biol 22: 1778–1791, 2002.[Abstract/Free Full Text]
  19. Le Maout S, Welling PA, Brejon M, Olsen O, and Merot J. Basolateral membrane expression of a K+ channel, Kir 2.3, is directed by a cytoplasmic COOH-terminal domain. Proc Natl Acad Sci USA 98: 10475–10480, 2001.[Abstract/Free Full Text]
  20. Leonoudakis D, Conti LR, Radeke CM, McGuire LM, and Vandenberg CA. A multiprotein trafficking complex composed of SAP97, CASK, Veli, and Mint1 is associated with inward rectifier Kir2 potassium channels. J Biol Chem 279: 19051–19063, 2004.[Abstract/Free Full Text]
  21. Misawa H, Kawasaki Y, Mellor J, Sweeney N, Jo K, Nicoll RA, and Bredt DS. Contrasting localizations of MALS/LIN-7 PDZ proteins in brain and molecular compensation in knockout mice. J Biol Chem 276: 9264–9272, 2001.[Abstract/Free Full Text]
  22. Okamoto M and Sudhof TC. Mints, Munc18-interacting proteins in synaptic vesicle exocytosis. J Biol Chem 272: 31459–31464, 1997.[Abstract/Free Full Text]
  23. Olsen O, Liu H, Wade JB, Merot J, and Welling PA. Basolateral membrane expression of the Kir 2.3 channel is coordinated by PDZ interaction with Lin-7/CASK complex. Am J Physiol Cell Physiol 282: C183–C195, 2002.[Abstract/Free Full Text]
  24. Perego C, Vanoni C, Villa A, Longhi R, Kaech SM, Frohli E, Hajnal A, Kim SK, and Pietrini G. PDZ-mediated interactions retain the epithelial GABA transporter on the basolateral surface of polarized epithelial cells. EMBO J 18: 2384–2393, 1999.[CrossRef][Web of Science][Medline]
  25. Roh MH, Makarova O, Liu CJ, Shin K, Lee S, Laurinec S, Goyal M, Wiggins R, and Margolis B. The Maguk protein, Pals1, functions as an adapter, linking mammalian homologues of Crumbs and Discs Lost. J Cell Biol 157: 161–172, 2002.[Abstract/Free Full Text]
  26. Rongo C, Whitfield CW, Rodal A, Kim SK, and Kaplan JM. LIN-10 is a shared component of the polarized protein localization pathways in neurons and epithelia. Cell 94: 751–759, 1998.[CrossRef][Web of Science][Medline]
  27. Schuster VL. Function and regulation of collecting duct intercalated cells. Annu Rev Physiol 55: 267–288, 1993.[CrossRef][Web of Science][Medline]
  28. Setou M, Nakagawa T, Seog DH, and Hirokawa N. Kinesin superfamily motor protein KIF17 and mLin-10 in NMDA receptor-containing vesicle transport. Science 288: 1796–1802, 2000.[Abstract/Free Full Text]
  29. Shelly M, Mosesson Y, Citri A, Lavi S, Zwang Y, Melamed-Book N, Aroeti B, and Yarden Y. Polar expression of ErbB-2/HER2 in epithelia. Bimodal regulation by Lin-7. Dev Cell 5: 475–486, 2003.[CrossRef][Web of Science][Medline]
  30. Simske JS, Kaech SM, Harp SA, and Kim SK. LET-23 receptor localization by the cell junction protein LIN-7 during C. elegans vulval induction. Cell 85: 195–204, 1996.[CrossRef][Web of Science][Medline]
  31. Songyang Z, Fanning AS, Fu C, Xu J, Marfatia SM, hishti AH, Chan AC, Anderson JM, and Cantley LC. Recognition of unique carboxyl-terminal motifs by distinct PDZ domains. Science 275: 73–77, 1997.[Abstract/Free Full Text]
  32. Straight SW, Chen L, Karnak D, and Margolis B. Interaction with mLin-7 alters the targeting of endocytosed transmembrane proteins in mammalian epithelial cells. Mol Biol Cell 12: 1329–1340, 2001.[Abstract/Free Full Text]
  33. Straight SW, Karnak D, Borg JP, Kamberov E, Dare H, Margolis B, and Wade JB. mLin-7 is localized to the basolateral surface of renal epithelia via its NH2 terminus. Am J Physiol Renal Physiol 278: F464–F475, 2000.[Abstract/Free Full Text]
  34. Tojo A, Bredt DS, and Wilcox CS. Distribution of postsynaptic density proteins in rat kidney: relationship to neuronal nitric oxide synthase. Kidney Int 55: 1384–1394, 1999.[CrossRef][Web of Science][Medline]
  35. Tseng TC, Marfatia SM, Bryant PJ, Pack S, Zhuang Z, O’Brien JE, Lin L, Hanada T, and Chishti AH. VAM-1: a new member of the MAGUK family binds to human Veli-1 through a conserved domain. Biochim Biophys Acta 1518: 249–259, 2001.[Medline]
  36. Wade JB, Welling PA, Donowitz M, Shenolikar S, and Weinman EJ. Differential renal distribution of NHERF isoforms and their colocalization with NHE3, ezrin, and ROMK. Am J Physiol Cell Physiol 280: C192–C198, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Sindic, C. Huang, A.-P. Chen, Y. Ding, W. A. Miller-Little, D. Che, M. F. Romero, and R. T. Miller
MUPP1 complexes renal K+ channels to alter cell surface expression and whole cell currents
Am J Physiol Renal Physiol, July 1, 2009; 297(1): F36 - F45.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Srinivasan, J. Roosa, O. Olsen, S.-H. Lee, D. S. Bredt, and S. K. McConnell
MALS-3 regulates polarity and early neurogenesis in the developing cerebral cortex
Development, May 15, 2008; 135(10): 1781 - 1790.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Alewine, B.-y. Kim, V. Hegde, and P. A. Welling
Lin-7 targets the Kir 2.3 channel on the basolateral membrane via a L27 domain interaction with CASK
Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1733 - C1741.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
O. Olsen, L. Funke, J.-f. Long, M. Fukata, T. Kazuta, J. C. Trinidad, K. A. Moore, H. Misawa, P. A. Welling, A. L. Burlingame, et al.
Renal defects associated with improper polarization of the CRB and DLG polarity complexes in MALS-3 knockout mice
J. Cell Biol., October 8, 2007; 179(1): 151 - 164.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. Alewine, O. Olsen, J. B. Wade, and P. A. Welling
TIP-1 Has PDZ Scaffold Antagonist Activity
Mol. Biol. Cell, October 1, 2006; 17(10): 4200 - 4211.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/F345    most recent
00235.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Olsen, O.
Right arrow Articles by Welling, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Olsen, O.
Right arrow Articles by Welling, P. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.