AJP - Renal Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 288: F1023-F1031, 2005. First published December 14, 2004; doi:10.1152/ajprenal.00175.2004
0363-6127/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/5/F1023    most recent
00175.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hansen, F. H.
Right arrow Articles by Iversen, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hansen, F. H.
Right arrow Articles by Iversen, B. M.

Enhanced response to AVP in the interlobular artery from the spontaneously hypertensive rat

Frank H. Hansen, Øyvind B. Vågnes, and Bjarne M. Iversen

Renal Research Group, Institute of Medicine, University of Bergen, and Department of Medicine, Haukeland University Hospital, Bergen, Norway

Submitted 12 May 2004 ; accepted in final form 6 December 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Arginine vasopressin (AVP) induces exaggerated intracellular free calcium (Cai2+) responses in preglomerular smooth muscle cells from young spontaneously hypertensive rats (SHR) due to increased density of the AVP V1a receptor. The intention of the present paper was to examine the relative contribution of afferent arterioles (AA) and interlobular artery (ILA) in AVP- and norepinephrine-induced calcium signaling. The kidneys were perfused with agar solution in vivo, and thin cortical slices were enzyme digested to produce isolated agar-filled vascular fragments. Calcium responses were recorded in fura 2-loaded cells by Ca2+ imaging. Diameter changes were measured after AVP stimulation and mRNA for V1a was measured on isolated vessel fragments. SHR had a significantly higher baseline calcium ratio and lower resting diameter compared with normotensive Wistar-Kyoto rats (WKY). Stimulation with AVP (10–7 M) in ILA fragments from SHR induced a ratio increase of 0.49 ± 0.09, significantly higher than the ratio increase in AA from SHR (0.20 ± 0.03, P < 0.01) and in ILA from WKY (0.24 ± 0.03, P < 0.01). Stimulation with norepinephrine (10–7 M) induced responses homogeneously distributed between the segments and strains. Nifedipine treatment or removal of external calcium (Cao2+) reduced the norepinephrine-induced peak response. Both norepinephrine- and AVP-induced sustained responses were abolished after Cao2+ removal in SHR and WKY (P < 0.01). Measurements of V1a receptor mRNA on isolated segments showed a threefold increase in ILA from SHR. The present findings indicate that the exaggerated Ca2+ and contractile response to AVP in SHR is mainly mediated through ILA vasoconstriction.

hypertension; calcium signaling; afferent arteriole


AVP EXERTS IMPORTANT PHYSIOLOGICAL effects in the renal vascular bed by stimulation of the V1a receptors that elicitate contraction of smooth vascular muscle cells (VSMC) by Gq/11 coupling to phosphatidylinositol hydrolysis followed by an increase in intracellular calcium through mobilization of intracellular stores and entry mechanisms (2). These mechanisms have been demonstrated in freshly isolated preglomerular smooth muscle cells from normotensive animals, and the intracellular response to AVP is exaggerated in preglomerular VSMC from rats with genetic hypertension (11, 21). The enhanced response of AVP has also been demonstrated hemodynamically in spontaneously hypertensive rats (SHR) after injection of AVP into the renal artery; a response that in contrast to ANG II is unchanged after indomethacin treatment (12).

Using the iron oxide/sieving technique, we recently found increased density of V1a receptors and increased V1a mRNA levels in young SHR compared with age-matched Wistar-Kyoto rats (WKY) (38). The increased V1a receptor density in hypertensive compared with normotensive animals was seen only at the age of 5 to 10 wk, which is the period when SHR develop hypertension (39). This suggests that the density of V1a receptors in the renal vascular tree might be of importance for the development of hypertension in SHR.

Both afferent arterioles (AA) and interlobular artery (ILA) act as resistance vessels in the kidney, although the role of ILA has been debated. A prerequisite for a vessel to behave as a resistance vessel is a pressure drop along the artery. This has been shown by direct micropuncture of the ILA in rat (18), but no pressure drop has been found in dog (27). Results from our laboratory also indicate that ILA participates in autoregulation (29). Other studies demonstrated that only half of the preglomerular resistance is caused by the afferent arteriole (3, 23). In addition, experiments using vascular casts (9) and the split hydronephrotic kidney (14) have found that ILA contributes to preglomerular resistance. Based on the observations presented here, it is therefore of importance to examine the distribution of V1a receptors along the vascular tree and the role of ILA and AA in calcium signaling and contractile responses in genetic hypertension.

The aim of the present study was to examine AVP-mediated calcium signaling and vasoconstriction in AA and ILA from young SHR using normotensive WKY as controls. To demonstrate that the AVP-induced reaction pattern is not typical for all hormones, recordings were compared with identical experiments using norepinephrine. To obtain this, we used a method where parts of the preglomerular vascular tree were isolated by an agar perfusion/enzyme digestion technique developed by Loutzenhiser and Loutzenhiser (24). The isolated vessels consisted of an intact VSMC layer with endothelial cells lining the agarose cast of the arteriolar lumen. The preparation has been used for calcium signaling, and we found it suitable for studying diameter variations due to the hydrostatic effect of the agarose core of these vessels. In the present paper, our working hypothesis was that the expression of V1a receptors and AVP-induced Ca2+ signaling in the ILA of SHR are increased, indicating that this segment is of importance in the vasoregulation. We also wanted to examine the relative importance of intracellular mobilization and entry of external calcium ([Ca2+]o) to examine segmental differences in the recruitment for the calcium signal. Finally, we wanted to examine the vascular segmental distribution of the V1a receptor mRNA to explore its correlation with AVP-induced calcium signaling.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals. A total of 18 WKY rats and 19 SHR aged 6–8 wk were obtained from Harlan. Five animals were kept in each cage and fed ordinary rat chow containing 0.5% sodium, 0.6% potassium, 0.71% calcium, and 14.7% crude protein. The rats had free access to tap water. The experiments were performed with the approval of the Norwegian State Board for Biological Experiments with Living Animals.

Isolation of renal vessels. The animals were anesthetized with pentobarbital sodium (50–70 mg/kg). The left kidney was perfused with 5–10 ml warmed RPMI to remove blood from the vasculature, and thereafter 1 ml Seaprep agarose solution (2%) in RPMI (37°C) was infused into the kidney to establish a hydrostatic and elastic core to which the smooth muscle cells could contract, mimicking the effect of pressure in the vessel. The kidney was removed and chilled (4°C for 10 min) in RPMI for solidification of the agarose. About 100-µm-thick cortical slices were cut with a Thomas slicer and incubated for 30–60 min at 37°C in Ca2+-free RPMI with 246 U/ml collagenase (C5138, Sigma), 0.5 U/ml protease (P3417, Sigma), and 0.05 mg/ml trypsin inhibitor (T6522, Sigma) to dissociate the vessels. Trypsin inhibitor was used to counteract the cleavage of V1a receptor protein from clostripain contamination in the collagenase IV (26, 31). The vascular fragments were picked with a small pipette (diameter = 100 µm) and transferred to acid-washed (1 N HCl) coverslips in a perfusion chamber. The microvessels usually attached strongly to the cover glass. The arteriolar segments were loaded in 2.5 µmol/l fura 2 acetoxymethyl ester in RPMI at room temperature for 45 min. Thereafter, fura 2 was removed and the cells were incubated for 20 min (30°C) to ensure complete hydrolyzation of the fura 2 ester. The cells were kept at 30°C for up to 2 h before recording.

Perfusion of vessels in chamber. The microscope chamber had a volume of 400 µl and was gravity fed (2 ml/min) through a perfusion inline heater (Warner TC344-B), which maintained the temperature in the chamber at 36–37°C. All agents administered to the vessels were dissolved in reservoirs feeding the microscope perfusion chamber. The switching between these solutions was done automatically in a programmed sequence with a Valvebank8 (AutoMate Scientific). All vessels were perfused for 150 s before and after administration of agents with RPMI to obtain stable baselines in the start and end of the recordings. To study the AVP and norepinephrine responses, cells were perfused with these two hormones (10–7 M) for 150 s. To examine the importance of L-type voltage-operated calcium channels, the vessels were perfused with nifedipine (10–7 M) for 150 s, followed by AVP (10–7 M) or norepinephrine (10–7 M) and nifedipine for 150 s. Responses without external calcium were performed by perfusing the vessels in 2 mM EGTA (0 [Ca2+]o) for 150 s, followed by AVP (10–7 M) or norepinephrine (10–7 M) and EGTA for 150 s. The peak value was defined as the maximum Cai2+ concentration ([Ca2+]i) after 5 s of stimulation. The plateau value was defined as the [Ca2+]i recorded 30 s after the stimulation. The response values were calculated as the difference between baseline and peak or plateau Cai2+ ratio levels. Measurements were performed in six to eight animals with one or two recordings from each animal.

Measurement of intracellular fura-2 ratio. The fura 2 ratio was measured using an inverted Olympus IX-70 with a x40 UAPO objective. The cells were excited alternatively with lights of 340- and 380-nm wavelengths from a dual-excitation wavelength system (Delta-Ram) from Photon Technologies (PTI). After the signals passed through a barrier filter (510 nm), fluorescence images were recorded by an IC-200 intensified CCD camera and analyzed with ImageMaster 1.49 Software from PTI. To compare Ca2+ ratios with other findings, recordings were calibrated to free calcium concentration based on the ratio of 340/380 nm, as described earlier (16, 20). Vessels with a core of agarose as seen in Fig. 1 were used for the recordings. Regions of interest on the vessels were defined with the ImageMaster software to accurately collect the fura 2 fluorescence from the chosen arteriolar segments and at a minimum distance of 20 µm from the branching points between AA and ILA.



View larger version (129K):
[in this window]
[in a new window]
 
Fig. 1. Interlobular artery (ILA) with a branching afferent arteriole (AA). An agarose core is protruding from the vessel.

 
Measurement of arteriolar lumen diameter. Simultaneously with fura 2 measurements, diameter variation in response to AVP stimulation was recorded with a Vicon VC285–24C CCD camera connected to a VPH 7090 Thomson video recorder. Digital images (640 x 480 pixels) were later on grabbed from the videotapes with an Asus V8460 video card. Lumen area for a defined length of AA or ILA was measured in AnalySIS software at 5 s before and 5 s after stimulation, and mean baseline and peak diameters were calculated from the formula (mean lumen diameter) = (lumen area)/(lumen length).

Real-time PCR for V1a receptor on isolated AA and ILA. Quantization of V1a mRNA was done by real-time PCR and AA and ILA were collected from five WKY and five SHR. Vessels were isolated as described above and resuspended in Cells to Signal lysis buffer from Ambion. Each sample consisted of six to eight vascular segments and was resuspended in 50 µl buffer. First-strand cDNA was synthesized directly using chemicals from the Cells to Signal kit and primed by Pd (N)10 primers. Each cDNA synthesis was performed in a total volume of 60 µl. The reaction mix was then added 0.6 µl glycogen (20 mg/ml), 6 µl potassium acetate (3 M), and 150 µl ice-cold absolute ethanol. The reaction was precipitated at –20°C overnight and centrifuged at 15,000 g for 10 min at 4°C. The precipitated cDNA was resuspended in 16 µl water and used as template for the amplification. Primers for amplification of V1a were selected for a 114-bp fragment containing the splicing site of the two V1a exons. The forward primer was 5'-atgtggtcagtctgggatga-3'. The reverse primer was 5'-catgtatatccacgggttgc-3'. The Taqman probe was 5'-caatcacggcgttgctggct-3', marked with FAM and 3'-TAMRA. The amplified V1a cDNA was normalized against amplified 18S ribosomal RNA to compensate for any changes due to RNA degradation, reverse transcriptase efficiency, or amplification success. The primers were made for a 68-bp fragment. The forward primer was 5'-agtccctgccctttgtacaca-3'. The reverse primer was 5'-gatccgagggcctcactaaac-3'. The Taqman probe was 5'-cgcccgtcgctactaccgattgg-3', marked with 5'-Yakima Yellow and 3'-TAMRA.

The amounts of V1a and 18S were quantified using a standard curve for known quantities of V1a or 18S DNA. The V1a standard curve was made by amplifying a 1,125-bp region of the V1a cDNA with the primers ccgtggtggcctctaaccac (forward) and ctgtctttcggctcatgcta (reverse). For the 18S standard curve, a 396-bp region of the rat 18S RNA cDNA was amplified using primers ttcagccaccgagattgagc (forward) and cgcaggttcacctacggaaa (reverse). The amplification products were then cloned into pBAD TOPO TA vectors and transfected into TOP 10 Escherichia coli cells (Invitrogen). Plasmids containing the cloned material were then purified from bacterial cultures using a Qiagen Plasmid Purification Midi kit. The purified plasmids were diluted to concentrations appropriate for the standard curve: 1010, 108, 107, 106, and 105 molecules/µl for 18 S, and 106, 105, 104, and 103 molecules/µl for V1a. The primer and probe constructions were done using Primer Express software from Applied Biosystems. The quantification was done on an ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems) and with a qPCR Core Kit (Eurogentec). The primer concentrations were optimized before use in quantification. Forward primers for both V1a and 18S were used in a final concentration of 0.3 µM. Reverse primers for both V1a and 18S were used in a final concentration of 0.9 µM. For each sample, 1 µg of total RNA in 15 µl was used for the cDNA synthesis. In each amplification reaction, 1 µl cDNA solution was used as a template. All amplifications of both V1a and 18S RNA were done using two parallel amplification reactions under standard ABI conditions using a 19-µl reaction volume.

Chemicals. All chemicals used in this experiment were from Sigma, except fura 2 acetoxymethyl which came from Molecular Probes. The RPMI media contained (in g/l) 7.65 NaCl, 0.40 KCl, 0.203 MgCl2, 0.20 NaH2PO4, 1.34 HEPES, 1 glucose, 0 Na, 0.11 pyruvat, 0.35 CaHCO3, 0.22 CaCl2, RPMI vitamins (Sigma R7256), and amino acids (Sigma R7131); 20x SSC (in g/l): 175 NaCl, 88.2 Na citrate, adjusted to pH 7.0 with 10 N NaOH; malonic acid buffer: 11.6 malonic acid, 8.77 NaCl, adjusted to pH 7.5 with solid NaOH.

Statistics. Data were presented as means ± SE. Sets of data were tested by ANOVA. P values of ≤0.05 were considered statistically significant. Differences between means were calculated in SPSS 12.0.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Experiments were performed on preglomerular vascular fragments containing both AA and ILA segments. The VSMC in the wall of the isolated vessels could easily be identified with endothelial cells covering the inside of the vascular lumen. There was no connective tissue on the vasculature, and an agar core protruded from the vessels as shown in Fig. 1.

Measurements of intracellular cytosolic calcium showed no significant difference in baselines between the 24 combinations of strain (WKY or SHR), segment (ILA or AA), agonist (AVP or norepinephrine), or treatment (untreated, nifedipine treated, or 0 [Ca2+]o) (P > 0.3, n = 8–14 in each group). However, when the baseline values for each segment in WKY and SHR were pooled, a significant difference of baseline calcium ratio became evident. As shown in Fig. 2A, the baseline ratio in the AA segments was 0.82 ± 0.02 in WKY and 0.90 ± 0.02 in SHR (P < 0.005, n = 67 and 68, respectively). In the ILA segment, the baseline ratio was 0.81 ± 0.01 in WKY and 0.92 ± 0.02 in ILA (P < 0.001, n = 86 and 88, respectively). There were no significant differences between AA and ILA from the same strain (P > 0.6 for both WKY and SHR).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2. A: resting calcium ratio values in AA and ILA from Wistar-Kyoto rats (WKY) and spontaneously hypertensive rats (SHR). **P < 0.005 vs. corresponding vessels in WKY. B: resting diameters in AA and ILA from WKY and SHR. *P < 0.01 vs. corresponding vessel in WKY.

 
In both strains, the Cai2+ ratio increase to AVP showed a sharp initial peak followed by a stable plateau that normalized when the vessels were exposed to normal media. As indicated with representative tracings in Fig. 3, and averaged in Fig. 4, the ILA segment in SHR had a marked exaggerated response to AVP. The initial peak ratio increase was 0.21 ± 0.04 (n = 9) in AA from WKY and 0.20 ± 0.03 (n = 12) in AA from SHR (P > 0.7). In ILA, the ratio increase was 0.24 ± 0.03 (n = 14) in WKY and 0.49 ± 0.09 (n = 14) in SHR (P < 0.01). There was no significant difference between AA and ILA in WKY (P > 0.6), but the calcium response was more than two times higher in ILA compared with AA in SHR (P < 0.01). The increased response to AVP in ILA from SHR is demonstrated in Fig. 5, where two representative Ca2+ ratio recordings were selected to illustrate the difference between the AVP Ca2+ response in ILA and AA in WKY and SHR.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Representative calcium ratio tracings from AA and ILA fragments during stimulation with AVP. The ILA fragment in ILA has larger responses compared with the other vessels both with and without nifedipine treatment. [Ca2+]o, external calcium.

 


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4. Averaged responses to AVP (n = 8–14). *P < 0.05 vs. AA in SHR and corresponding vessel in WKY. {dagger}P < 0.05 vs. corresponding untreated vessels. {ddagger}P < 0.01 vs. corresponding nifedipine-treated and -untreated vessels.

 


View larger version (136K):
[in this window]
[in a new window]
 
Fig. 5. Two representative ratio image series from WKY and SHR showing an ILA with a branching AA before and after stimulation with 10–7 M AVP. The white draw lines are marking the regions of interest where the fluorescence signals were collected. In the WKY fragment, the ratio change is similar in AA and ILA, but in SHR the ratio increase is much greater in the ILA segment compared with AA and ILA in WKY. Rainbow color map, Poenie-Tsien raw ratio (36, 0), ratio range 0.4–2.4.

 
In all recordings, the sustained Ca2+ ratio increase was lower than the initial ratio increase in both WKY and SHR (P < 0.0001). The number of recordings is given only after the initial peak value in each group and not after the plateau value because they were the same. The sustained ratio increase was 0.10 ± 0.06 in AA from WKY and 0.11 ± 0.04 in AA from SHR (P > 0.6). In ILA, the sustained ratio increase was 0.13 ± 0.03 in WKY and 0.18 ± 0.03 in SHR (P > 0.06).

As shown with representative tracings in Fig. 3, and averaged in Fig. 4, vessels pretreated with nifedipine before AVP stimulation showed a peak response almost unchanged from the untreated vessels (P > 0.5). The ILA fragments from SHR showed an exaggerated calcium ratio increase to AVP also after nifedipine pretreatment. The initial peak ratio increase was 0.22 ± 0.05 (n = 10) in AA from WKY and 0.17 ± 0.03 (n = 8) in AA from SHR (P > 0.5). In ILA, the initial ratio increase was 0.22 ± 0.05 (n = 10) in WKY and 0.60 ± 0.14 (n = 13) in SHR (P < 0.05). No difference between AA and ILA was seen in WKY (P > 0.5), but in SHR a more than a threefold difference was found (P < 0.05).

The sustained ratio increase in AA was 0.03 ± 0.01 in WKY and 0.04 ± 0.02 in SHR (P > 0.8). In ILA, the sustained ratio increase was 0.08 ± 0.03 in WKY and 0.12 ± 0.02 in SHR (P < 0.01). The sustained response in nifedipine-treated vessels was significantly smaller than in untreated vessels (P < 0.05), except in AA in WKY (P > 0.2).

As shown in representative tracings in Fig. 3, and averaged in Fig. 4, vessels stimulated with AVP in calcium-free media (2 mM EGTA) had a reduced peak response in WKY and SHR compared with vessels stimulated in normal media. The differences in ratio increase observed in normal media between ILA from WKY and SHR were absent in calcium-free media. The peak ratio increase was 0.14 ± 0.05 (n = 8) in AA from WKY and 0.15 ± 0.03 (n = 14) in AA from SHR (P > 0.8). In ILA, the peak response was 0.20 ± 0.03 (n = 8) in WKY and 0.24 ± 0.05 (n = 14) in SHR (P > 0.5). The peak values in both segments and strains were similar (P > 0.1). The ILA segment in SHR was reduced compared with both untreated and nifedipine-treated ILA peak responses in SHR (P < 0.05). The sustained Cai2+ response in EGTA-treated vessels was not significantly different from zero in either WKY or SHR (P > 0.3).

To compare calcium signaling obtained with AVP in AA and ILA from both strains, vessels were stimulated with norepinephrine (10–7 M) under the same conditions as with AVP. As shown with representative tracings in Fig. 6, and averaged in Fig. 7, the basic norepinephrine ratio response was 0.66 ± 0.03 (n = 13) in AA from WKY and 0.58 ± 0.11 (n = 8) in AA from SHR (P > 0.1). The response was 0.80 ± 0.08 (n = 14) in ILA from WKY and 0.71 ± 0.07 (n = 8) in ILA from SHR (P > 0.1).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6. Representative calcium ratio tracings of AA and ILA during stimulation with norepinephrine (Nor). The responses in normal medium are similar between strains and segments.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 7. Averaged responses to AVP (n = 8–14). *P < 0.05 vs. corresponding untreated vessels. {dagger}P < 0.05 vs. corresponding nifedipine-treated and untreated vessels.

 
The sustained basic norepinephrine response was 0.50 ± 0.04 in AA from WKY and 0.42 ± 0.13 in AA from SHR (P > 0.2). The response was 0.60 ± 0.07 in ILA from WKY and 0.41 ± 0.12 in ILA from SHR (P > 0.2).

In vessels treated with nifedipine (10–7 M), the initial calcium response to norepinephrine was 0.29 ± 0.02 (n = 8) in AA from WKY and 0.43 ± 0.07 (n = 11) from SHR (P > 0.13). The response was 0.28 ± 0.06 (n = 8) in ILA from WKY and 0.38 ± 0.05 (n = 14) in ILA from SHR (P > 0.32). There were no differences between AA and ILA in each strain (P > 0.1). However, in all segments, the peak values were reduced compared with the untreated responses (P < 0.05).

The sustained ratio increases in nifedipine-treated vessels were 0.07 ± 0.02 in AA from WKY and 0.12 ± 0.05 in AA from SHR (P > 0.37). The response was 0.04 ± 0.02 in ILA from WKY and 0.14 ± 0.03 in ILA from SHR (P = 0.07). There were no differences between AA and ILA within each strain (P = 0.08). However, as with the initial responses, all sustained responses were reduced compared with untreated plateau values (P < 0.05).

In vessels treated with EGTA (2 mM), the calcium ratio response to norepinephrine was 0.28 ± 0.04 (n = 8) in AA from WKY and 0.33 ± 0.11 (n = 8) in AA from SHR (P > 0.7). The ratio increase was 0.28 ± 0.04 in ILA from WKY and 0.39 ± 0.12 in ILA from SHR (P > 0.3). There were no differences between AA and ILA in each strain (P > 0.3). The peak values were unchanged compared with nifedipine-treated values (P > 0.7) but reduced compared with untreated peak responses (P < 0.05).

The sustained ratio increase in zero calcium was not different from zero and reduced compared with untreated and nifedipine-treated vessels (P < 0.05) except in AA from SHR (P = 0.08).

Simultaneous with fura 2 recordings, the diameters of the vessels were measured 5 s before and 5 s after the stimulation with AVP to study the relationship between calcium response and diameter change. As seen in Fig. 2B, the mean afferent arteriolar resting diameter in WKY was 21.6 ± 0.5 µm in AA and 37.8 ± 2.1 µm in ILA. In SHR, the afferent arteriolar resting diameter was 14.4 ± 1.2 µm in AA and 30.4 ± 2.4 µm in ILA. The resting diameters in SHR and WKY were significantly different in the AA segment (P < 0.01) but not in ILA (P > 0.2).

In WKY, the diameter was reduced to 78 ± 5% of the resting diameter in AA and to 82 ± 5% of the resting diameter in ILA during AVP stimulation (P > 0.5; Fig. 8). In SHR, the diameter was reduced to 87 ± 4% of the resting diameter in AA and to 61 ± 3% of the resting diameter in ILA (P < 0.001). In AA, the change in diameter was not different between the strains (P > 0.2), but in ILA there was a significant difference in diameter change during AVP stimulation between the two strains (P < 0.001).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 8. Contractile responses to AVP (10–7 M) in WKY and SHR. *P < 0.01 compared with AA and corresponding segment in WKY.

 
To further explore any segmental heterogeneity, V1a mRNA levels in AA and ILA from WKY and SHR were analyzed using real-time RT-PCR on isolated vessels. As shown in Fig. 9, the V1a mRNA level from SHR was significantly higher in the ILA segment (342 ± 9 V1a mRNA/105 18S RNA) compared with the AA segment (84 ± 5 V1a mRNA/105 18S RNA; P < 0.001). The corresponding values in ILA and AA from WKY were 76 ± 11 V1a mRNA/105 18S RNA and 68 ± 9 V1a mRNA/105 18S RNA, respectively (P > 0.5). There was no difference in mRNA V1a level between AA from WKY and SHR.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 9. Real-time RT-PCR analysis of V1a mRNA. *P < 0.0001 compared with AA in SHR and AA and ILA in WKY.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The main new finding in the present study is the large difference in the Cai2+ response between AA and ILA segments after stimulation with AVP in genetic hypertensive rats. The AVP-induced Cai2+ response in the ILA segment from SHR was more than twice as large compared with AA in the same strain and AA and ILA from normotensive animals. This new observation was supported by a significantly greater contraction of ILA in SHR after exposure to AVP. The calcium response in ILA from SHR remained different from the other segments also after nifedipine treatment, but this difference disappeared after calcium removal, indicating that this ratio increase is mainly mobilization dependent. A further support of our findings is the three times higher level of V1a mRNA in ILA from SHR in vessels isolated with the agar perfusion/enzyme digestion technique. To test the uniqueness of this exaggerated segment-specific response pattern in SHR, the AVP recordings were compared with similar measurements after norepinephrine stimulation. The norepinephrine-induced responses were similar in both WKY and SHR and had the same magnitude in AA and ILA from both strains. Collectively, our data indicate that the AVP response in ILA of SHR is considerably different from norepinephrine.

Previous studies demonstrated that AVP injection into the renal artery produces exaggerated renal vasoconstriction in young SHR compared with normotensive WKY (13). The Cai2+ response to AVP has also been shown to be enhanced in SHR compared with the normotensive control (21). This is most likely due to the increased density of V1a receptors in preglomerular vessels, which has been shown by Vagnes et al. (38) using ligand-binding technique and measurements of mRNA.

Hormonal heterogeneity in different vascular segments of the kidney has been found in the hydronephrotic kidney preparation (35) and in the juxtamedullary perfused model (17). In the hydronephrotic kidney preparation, the effect of AVP seems to be increased in ILA compared with AA. In the juxtamedullary perfused model, the effect of AVP was significantly lower in ILA compared with the distal part of AA using low concentrations (10–9-10–8 M) of AVP, but at higher concentrations (10–7-10–6 M) the contractile responses were similar. These contradictory findings may be due to use of different experimental models. Calcium signaling with AVP and measurements of V1a mRNA have until now only been performed on samples produced with the iron oxide/sieving technique, where the relative contribution of VSMC from AA and ILA segments is not known.

It is well known that there are substantial differences in Ca2+ signaling pathways and hormone responses between afferent and efferent segments (6, 24). There are also several other examples of segmental heterogeneity in hormonal responses to different vasoactive hormones (7, 17, 35). Earlier studies showed an exaggerated Cai2+ response to AVP or V1a agonists in SHR using the iron oxide/sieving technique or similar techniques, which produces a mixture of smooth muscle cells from both AA and ILA (10, 21). This method has also been used for receptor protein and mRNA measurement for the V1a receptor (38). Based on the possibilities obtained by the agar perfusion/enzyme digestion technique for isolation of preglomerular vessels, we have been able to explore differences between preglomerular segments to a greater extent than before.

In a recent paper, we observed greater variations in the Cai2+ response in isolated preglomerular fragments from young SHR compared with age-matched WKY, and we decided to explore this observation further (39). In the present study, we found a nearly twofold increased calcium response in ILA compared with AA in SHR. In the normotensive controls, no differences between calcium signaling in AA and ILA were found, and the response in these two segments was not different from what was seen in AA from SHR. Similar to other findings (34), stimulation with norepinephrine did not show any difference in peak response between the two segments in WKY and SHR, indicating that the AVP-induced signaling in ILA from SHR is different from norepinephrine. We propose that the previously observed exaggerated calcium response to AVP in preglomerular segments from SHR results mostly from increased reactivity in the ILA segment.

Earlier studies showed that calcium entry via voltage-gated operated channels is the predominant mechanism for cytosolic calcium increase in preglomerular vessels (5, 8), but several later studies also demonstrated that calcium mobilization from intracellular stores is taking place in preglomerular vessels (10, 12, 24, 32, 33). Flow studies after injection of AVP showed that the contribution of IP3-mediated mobilization of internal Ca2+ stores constituted two-thirds of the Ca2+ response in both SHR and WKY (12). Further support for the role of mobilization of internal Ca2+ stores in preglomerular vessels is given in the present study, as nifedipine treatment did not affect the AVP-induced peak response. The sustained response was reduced in both WKY and SHR, as predicted due to the blocking effect nifedipine has on L-type Ca2+ channels. However, pretreatment with nifedipine on norepinephrine-stimulated vessels gave a significant reduction in both peak and plateau values, similar to what was found by Salomonsson and Arendshorst (34) in microdissected AA from WKY and SHR. This observation is supported by findings of Bauer and Parekh (1), who found that nifedipine influenced the vasoconstrictive effect of AVP and norepinephrine differently. These authors found that to reduce renal blood flow by 25%, coinfusion with nifedipine required the norepinephrine dosage to be increased fourfold, whereas the AVP dosage only needed to be increased twofold. In our study, the AVP-induced peak responses were only reduced in ILA from SHR during removal of external calcium, whereas the peak response after norepinephrine stimulation was also reduced after nefidipine treatment. These findings indicate that the norepinephrine-induced Ca2+ response is more dependent on entry mechanisms in the initial phase than AVP.

In our experiments, the sustained responses after norepinephrine and AVP stimulation were reduced after nifedipine treatment and abolished after removal of external calcium in both strains. The incomplete ability of nifedipine to abolish the plateau response supports the presence of a second calcium entry pathway in addition to L-type voltage-regulated Ca2+ channels, as earlier suggested by Salomonsson and Arendshorst (33, 34). Also, the fact that removal of external calcium completely abolishes the sustained response suggests a major dependence on entry mechanisms both after norepinephrine and AVP stimulation.

In the present study, we measured the basic diameters and the contractile effect of AVP in AA and ILA. The resting diameters obtained by the methods used in the present study were similar to what we and others reported earlier in young SHR and WKY using the microsphere method (19, 22). The diameter of the ILA cannot be measured by the use of microspheres, but in casts the diameter has been measured to be within the limits of 25 to 60 µm (15, 30). The contractile response to AVP was significantly greater in ILA from SHR compared with the AA and the corresponding segment in WKY. Similar to our results, stimulation with AVP in the hydronephrotic kidney model (7), and the perfused juxtamedullary nephron preparation (17), has indicated considerable contractile responses in the ILA segment. In accordance with our data from WKY, Harrison-Bernard and Carmines (17) found a diameter change in ILA from Sprague-Dawley rats that was similar to the distal and central part of AA, when using the same concentration of AVP that was used in the present study (10–7 M). Similar to our data, Touyz et al. (36) found an increased contractile response to AVP in third-order branches of arteries from the mesenteric bed in 17-wk-old SHR compared with WKY and Wistar rats.

In contrast to baseline calcium values obtained from the renal vasculature using the iron oxide/sieving technique (11, 21), and also when other isolation techniques have been used (28, 34), the baseline Cai2+ level in this study was higher in the hypertensive strain. However, similar to our results, Brown et al. (4) found that cardiac myocytes had increased Ca2+ resting levels in SHR compared with WKY. Touyz and Schiffrin (37) found that the basal [Ca2+]i in mesenteric arteries from 17-wk-old SHR was 134 ± 8 nM, significantly higher than the baselines found in WKY (98 ± 12 nM) and in Wistar rats (99 ± 10 nM). These changes were already seen in 5-wk-old rats and are similar to our data when our results are converted to Ca2+ concentration from ratio values. Touyz and Schiffrin used pressurized arterioles, which are mimicked by the agarose core in our vessels. Pressurizing and the use of intact vasculature are most likely important factors in physiological conditions, and this might explain why the results in the present paper differ from recordings done of single cells (11, 21) or unpressurized arterioles (28, 34). Preglomerular arterioles have been shown to be constricted at a young age in SHR (19, 22), and based on the data presented in the present study, it is not unlikely that increased vascular tone in the SHR renal vasculature is linked to a higher steady-state level of [Ca2+]i.

The ligand-binding method used earlier in our laboratory (38) is not suitable to test isolated segments of the vascular bed because of the large amounts of protein needed. Using the agar perfusion/enzyme digestion method, preglomerular segments were isolated and the V1a mRNA levels were measured with real-time RT-PCR. The results showed a threefold higher level of V1a in ILA from SHR, and this finding is consistent with the increased calcium signaling and vasoconstriction induced by AVP in this segment.

Some methodological reservations should be made in the interpretation of data from the present study. The preparation consists of two different cell types, VSMC and endothelial cells. Consequently, there are two possible sources of calcium transients, and the measured [Ca2+]i are averaged values derived from the two cell layers. As a consequence, we presented our Ca2+ recordings as ratio values and used converted [Ca2+]i values only for comparison with other studies. It is well established that the endothelium is an important modulator for vascular responses. Therefore, we argue that arterioles with the endothelial cell layer intact most likely exhibit physiological responses representative of vessels in vivo, especially because differences in endothelium-derived relaxing factors are reported to differ between the two strains used in this study (25, 40).

In conclusion, Ca2+ signaling, contractile responses, and V1a mRNA levels demonstrate that the exaggerated responsiveness to AVP is localized to the ILA segment in SHR. This condition could reduce blood flow to the glomeruli and thereby lower the glomerular filtration rate and induce salt and water retention, which is regarded as one of the possible mechanisms of hypertension in SHR.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The present study was supported by the Norwegian Council of Cardiovascular Disease and the strategic research program from Haukeland University Hospital.


    ACKNOWLEDGMENTS
 
We thank the FF-Common Research Centre, University of Bergen, for providing facilities and equipment used in this study. We also thank B. Lampe at Department of Clinical Engineering, Haukeland University Hospital, for providing the pressurized pipette used for picking vessels in this study.


    FOOTNOTES
 

Address for reprint requests and other correspondence: F. H. Hansen, Renal Research Group, N-5021 Haukeland Sykehus, Bergen, Norway (E-mail: Frank.Hansen{at}med.uib.no)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bauer J and Parekh N. Variations in cell signaling pathways for different vasoconstrictor agonists in renal circulation of the rat. Kidney Int 63: 2178–2186, 2003.[CrossRef][Web of Science][Medline]
  2. Birnbaumer M. Vasopressin receptors. Trends Endocrinol Metab 11: 406–410, 2000.[CrossRef][Web of Science][Medline]
  3. Boknam L, Ericson AC, Aberg B, and Ulfendahl HR. Flow resistance of the interlobular artery in the rat kidney. Acta Physiol Scand 111: 159–163, 1981.[Web of Science][Medline]
  4. Brown RA, Jefferson L, Sudan N, Lloyd TC, and Ren J. Acetaldehyde depresses myocardial contraction and cardiac myocyte shortening in spontaneously hypertensive rats: role of intracellular Ca2+. Cell Mol Biol (Noisy-le-grand) 45: 453–465, 1999.[Medline]
  5. Carmines PK. Segment-specific effect of chloride channel blockade on rat renal arteriolar contractile responses to angiotensin II. Am J Hypertens 8: 90–94, 1995.[CrossRef][Web of Science][Medline]
  6. Carmines PK and Navar LG. Disparate effects of Ca channel blockade on afferent and efferent arteriolar responses to ANG II. Am J Physiol Renal Fluid Electrolyte Physiol 256: F1015–F1020, 1989.[Abstract/Free Full Text]
  7. Cavarape A, Bauer J, Bartoli E, Endlich K, and Parekh N. Effects of angiotensin II, arginine vasopressin and tromboxane A2 in renal vascular bed: role of rho-kinase. Nephrol Dial Transplant 18: 1764–1769, 2003.[Abstract/Free Full Text]
  8. Conger JD and Falk SA. KCl and angiotensin responses in isolated rat renal arterioles: effects of diltiazem and low-calcium medium. Am J Physiol Renal Fluid Electrolyte Physiol 264: F134–F140, 1993.[Abstract/Free Full Text]
  9. Endlich K, Kuhn R, and Steinhausen M. Visualization of serotonin effects on renal vessels of rats. Kidney Int 43: 314–323, 1993.[Web of Science][Medline]
  10. Fellner SK and Arendshorst WJ. Capacitative calcium entry in smooth muscle cells from preglomerular vessels. Am J Physiol Renal Physiol 277: F533–F542, 1999.[Abstract/Free Full Text]
  11. Fellner SK and Arendshorst WJ. Store-operated Ca2+ entry is exaggerated in fresh preglomerular vascular smooth muscle cells of SHR. Kidney Int 61: 2132–2141, 2002.[CrossRef][Web of Science][Medline]
  12. Feng JJ and Arendshorst WJ. Calcium signaling mechanisms in renal vascular responses to vasopressin in genetic hypertension. Hypertension 30: 1223–1231, 1997.[Abstract/Free Full Text]
  13. Feng JJ and Arendshorst WJ. Enhanced renal vasoconstriction induced by vasopressin in SHR is mediated by V1 receptors. Am J Physiol Renal Fluid Electrolyte Physiol 271: F304–F313, 1996.[Abstract/Free Full Text]
  14. Fretschner M, Endlich K, Fester C, Parekh N, and Steinhausen M. A narrow segment of the efferent arteriole controls efferent resistance in the hydronephrotic rat kidney. Kidney Int 37: 1227–1239, 1990.[Web of Science][Medline]
  15. Gattone VH II, Evan AP, Willis LR, and Luft FC. Renal afferent arteriole in the spontaneously hypertensive rat. Hypertension 5: 8–16, 1983.[Abstract/Free Full Text]
  16. Grynkiewicz G, Poenie M, and Tsien RY. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260: 3440–3450, 1985.[Abstract/Free Full Text]
  17. Harrison-Bernard LM and Carmines PK. Juxtamedullary microvascular responses to arginine vasopressin in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 267: F249–F256, 1994.[Abstract/Free Full Text]
  18. Heyeraas KJ and Aukland K. Interlobular arterial resistance: influence of renal arterial pressure and angiotensin II. Kidney Int 31: 1291–1298, 1987.[Web of Science][Medline]
  19. Hsu CH and Slavicek JM. The effect of renal perfusion pressure on renal vascular resistance in the spontaneously hypertensive rat. Pflügers Arch 393: 340–343, 1982.[CrossRef][Web of Science][Medline]
  20. Iversen BM and Arendshorst WJ. ANG II and vasopressin stimulate calcium entry in dispersed smooth muscle cells of preglomerular arterioles. Am J Physiol Renal Physiol 274: F498–F508, 1998.[Abstract/Free Full Text]
  21. Iversen BM and Arendshorst WJ. Exaggerated Ca2+ signaling in preglomerular arteriolar smooth muscle cells of genetically hypertensive rats. Am J Physiol Renal Physiol 276: F260–F270, 1999.[Abstract/Free Full Text]
  22. Iversen BM, Kvam FI, Morkrid L, Sekse I, and Ofstad J. Effect of cyclooxygenase inhibition on renal blood flow autoregulation in SHR. Am J Physiol Renal Fluid Electrolyte Physiol 263: F534–F539, 1992.[Abstract/Free Full Text]
  23. Kallskog O, Lindbrom LO, Ulfendahl HR, and Wolgast M. Hydrostatic pressures within the vascular structures of the rat kidney. Pflügers Arch 363: 205–210, 1976.[CrossRef][Web of Science][Medline]
  24. Loutzenhiser K and Loutzenhiser R. Angiotensin II-induced Ca2+ influx in renal afferent and efferent arterioles: differing roles of voltage-gated and store-operated Ca2+ entry. Circ Res 87: 551–557, 2000.[Abstract/Free Full Text]
  25. Luscher TF and Vanhoutte PM. Endothelium-dependent contractions to acetylcholine in the aorta of the spontaneously hypertensive rat. Hypertension 8: 344–348, 1986.[Abstract/Free Full Text]
  26. Morel A, O'Carroll AM, Brownstein MJ, and Lolait SJ. Molecular cloning and expression of a rat V1a arginine vasopressin receptor. Nature 356: 523–526, 1992.[CrossRef][Medline]
  27. Navar LG, Inscho EW, Majid SA, Imig JD, Harrison-Bernard LM, and Mitchell KD. Paracrine regulation of the renal microcirculation. Physiol Rev 76: 425–536, 1996.[Abstract/Free Full Text]
  28. Nelson LD, Mashburn NA, and Bell PD. Altered sodium-calcium exchange in afferent arterioles of the spontaneously hypertensive rat. Kidney Int 50: 1889–1896, 1996.[Web of Science][Medline]
  29. Ofstad J, Iversen BM, Morkrid L, and Sekse I. Autoregulation of renal blood flow (RBF) with and without participation of afferent arterioles. Acta Physiol Scand 130: 25–32, 1987.[Web of Science][Medline]
  30. Ofstad J, Morkrid L, and Willassen Y. Diameter of the afferent arteriole in the dog kidney estimated by the microsphere method. Scand J Clin Lab Invest 35: 767–774, 1975.[Web of Science][Medline]
  31. Phalipou S, Cotte N, Carnazzi E, Seyer R, Mahe E, Jard S, Barberis C, and Mouillac B. Mapping peptide-binding domains of the human V1a vasopressin receptor with a photoactivatable linear peptide antagonist. J Biol Chem 272: 26536–26544, 1997.[Abstract/Free Full Text]
  32. Ruan X and Arendshorst WJ. Calcium entry and mobilization signaling pathways in ANG II-induced renal vasoconstriction in vivo. Am J Physiol Renal Fluid Electrolyte Physiol 270: F398–F405, 1996.[Abstract/Free Full Text]
  33. Salomonsson M and Arendshorst WJ. Calcium recruitment in renal vasculature: NE effects on blood flow and cytosolic calcium concentration. Am J Physiol Renal Physiol 276: F700–F710, 1999.[Abstract/Free Full Text]
  34. Salomonsson M and Arendshorst WJ. Norepinephrine-induced calcium signaling pathways in afferent arterioles of genetically hypertensive rats. Am J Physiol Renal Physiol 281: F264–F272, 2001.[Abstract/Free Full Text]
  35. Steinhausen M and Endlich K. Controversies on glomerular filtration from Ludwig to the present. Pflügers Arch 432: R73–R81, 1996.[Web of Science][Medline]
  36. Touyz RM, Deng LY, Li JS, and Schiffrin EL. Differential effects of vasopressin and endothelin-1 on vascular contractile and calcium responses in pressurized small arteries from spontaneously hypertensive rats. J Hypertens 14: 983–991, 1996.[Web of Science][Medline]
  37. Touyz RM and Schiffrin EL. Insulin-induced Ca2+ transport is altered in vascular smooth muscle cells of spontaneously hypertensive rats. Hypertension 23: 931–935, 1994.[Abstract/Free Full Text]
  38. Vågnes O, Feng JJ, Iversen BM, and Arendshorst WJ. Upregulation of V1 receptors in renal resistance vessels of rats developing genetic hypertension. Am J Physiol Renal Physiol 278: F940–F948, 2000.[Abstract/Free Full Text]
  39. Vågnes OB, Hansen FH, Christiansen RE, Gjerstad C, and Iversen BM. Age-dependent regulation of vasopressin V1a receptors in preglomerular vessels from the spontaneously hypertensive rat. Am J Physiol Renal Physiol 286: F997–F1003, 2004.[Abstract/Free Full Text]
  40. Van de Voorde J and Leusen I. Endothelium-dependent and independent relaxation of aortic rings from hypertensive rats. Am J Physiol Heart Circ Physiol 250: H711–H717, 1986.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. Ponnuchamy and R. A. Khalil
Cellular mediators of renal vascular dysfunction in hypertension
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2009; 296(4): R1001 - R1018.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
F. Helle, O. B. Vagnes, and B. M. Iversen
Angiotensin II-induced calcium signaling in the afferent arteriole from rats with two-kidney, one-clip hypertension
Am J Physiol Renal Physiol, July 1, 2006; 291(1): F140 - F147.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/5/F1023    most recent
00175.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hansen, F. H.
Right arrow Articles by Iversen, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hansen, F. H.
Right arrow Articles by Iversen, B. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.