|
|
||||||||
Renal Research Group, Institute of Medicine, University of Bergen, and Department of Medicine, Haukeland University Hospital, Bergen, Norway
Submitted 12 May 2004 ; accepted in final form 6 December 2004
| ABSTRACT |
|---|
|
|
|---|
hypertension; calcium signaling; afferent arteriole
Using the iron oxide/sieving technique, we recently found increased density of V1a receptors and increased V1a mRNA levels in young SHR compared with age-matched Wistar-Kyoto rats (WKY) (38). The increased V1a receptor density in hypertensive compared with normotensive animals was seen only at the age of 5 to 10 wk, which is the period when SHR develop hypertension (39). This suggests that the density of V1a receptors in the renal vascular tree might be of importance for the development of hypertension in SHR.
Both afferent arterioles (AA) and interlobular artery (ILA) act as resistance vessels in the kidney, although the role of ILA has been debated. A prerequisite for a vessel to behave as a resistance vessel is a pressure drop along the artery. This has been shown by direct micropuncture of the ILA in rat (18), but no pressure drop has been found in dog (27). Results from our laboratory also indicate that ILA participates in autoregulation (29). Other studies demonstrated that only half of the preglomerular resistance is caused by the afferent arteriole (3, 23). In addition, experiments using vascular casts (9) and the split hydronephrotic kidney (14) have found that ILA contributes to preglomerular resistance. Based on the observations presented here, it is therefore of importance to examine the distribution of V1a receptors along the vascular tree and the role of ILA and AA in calcium signaling and contractile responses in genetic hypertension.
The aim of the present study was to examine AVP-mediated calcium signaling and vasoconstriction in AA and ILA from young SHR using normotensive WKY as controls. To demonstrate that the AVP-induced reaction pattern is not typical for all hormones, recordings were compared with identical experiments using norepinephrine. To obtain this, we used a method where parts of the preglomerular vascular tree were isolated by an agar perfusion/enzyme digestion technique developed by Loutzenhiser and Loutzenhiser (24). The isolated vessels consisted of an intact VSMC layer with endothelial cells lining the agarose cast of the arteriolar lumen. The preparation has been used for calcium signaling, and we found it suitable for studying diameter variations due to the hydrostatic effect of the agarose core of these vessels. In the present paper, our working hypothesis was that the expression of V1a receptors and AVP-induced Ca2+ signaling in the ILA of SHR are increased, indicating that this segment is of importance in the vasoregulation. We also wanted to examine the relative importance of intracellular mobilization and entry of external calcium ([Ca2+]o) to examine segmental differences in the recruitment for the calcium signal. Finally, we wanted to examine the vascular segmental distribution of the V1a receptor mRNA to explore its correlation with AVP-induced calcium signaling.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of renal vessels. The animals were anesthetized with pentobarbital sodium (5070 mg/kg). The left kidney was perfused with 510 ml warmed RPMI to remove blood from the vasculature, and thereafter 1 ml Seaprep agarose solution (2%) in RPMI (37°C) was infused into the kidney to establish a hydrostatic and elastic core to which the smooth muscle cells could contract, mimicking the effect of pressure in the vessel. The kidney was removed and chilled (4°C for 10 min) in RPMI for solidification of the agarose. About 100-µm-thick cortical slices were cut with a Thomas slicer and incubated for 3060 min at 37°C in Ca2+-free RPMI with 246 U/ml collagenase (C5138, Sigma), 0.5 U/ml protease (P3417, Sigma), and 0.05 mg/ml trypsin inhibitor (T6522, Sigma) to dissociate the vessels. Trypsin inhibitor was used to counteract the cleavage of V1a receptor protein from clostripain contamination in the collagenase IV (26, 31). The vascular fragments were picked with a small pipette (diameter = 100 µm) and transferred to acid-washed (1 N HCl) coverslips in a perfusion chamber. The microvessels usually attached strongly to the cover glass. The arteriolar segments were loaded in 2.5 µmol/l fura 2 acetoxymethyl ester in RPMI at room temperature for 45 min. Thereafter, fura 2 was removed and the cells were incubated for 20 min (30°C) to ensure complete hydrolyzation of the fura 2 ester. The cells were kept at 30°C for up to 2 h before recording.
Perfusion of vessels in chamber. The microscope chamber had a volume of 400 µl and was gravity fed (2 ml/min) through a perfusion inline heater (Warner TC344-B), which maintained the temperature in the chamber at 3637°C. All agents administered to the vessels were dissolved in reservoirs feeding the microscope perfusion chamber. The switching between these solutions was done automatically in a programmed sequence with a Valvebank8 (AutoMate Scientific). All vessels were perfused for 150 s before and after administration of agents with RPMI to obtain stable baselines in the start and end of the recordings. To study the AVP and norepinephrine responses, cells were perfused with these two hormones (107 M) for 150 s. To examine the importance of L-type voltage-operated calcium channels, the vessels were perfused with nifedipine (107 M) for 150 s, followed by AVP (107 M) or norepinephrine (107 M) and nifedipine for 150 s. Responses without external calcium were performed by perfusing the vessels in 2 mM EGTA (0 [Ca2+]o) for 150 s, followed by AVP (107 M) or norepinephrine (107 M) and EGTA for 150 s. The peak value was defined as the maximum Cai2+ concentration ([Ca2+]i) after 5 s of stimulation. The plateau value was defined as the [Ca2+]i recorded 30 s after the stimulation. The response values were calculated as the difference between baseline and peak or plateau Cai2+ ratio levels. Measurements were performed in six to eight animals with one or two recordings from each animal.
Measurement of intracellular fura-2 ratio. The fura 2 ratio was measured using an inverted Olympus IX-70 with a x40 UAPO objective. The cells were excited alternatively with lights of 340- and 380-nm wavelengths from a dual-excitation wavelength system (Delta-Ram) from Photon Technologies (PTI). After the signals passed through a barrier filter (510 nm), fluorescence images were recorded by an IC-200 intensified CCD camera and analyzed with ImageMaster 1.49 Software from PTI. To compare Ca2+ ratios with other findings, recordings were calibrated to free calcium concentration based on the ratio of 340/380 nm, as described earlier (16, 20). Vessels with a core of agarose as seen in Fig. 1 were used for the recordings. Regions of interest on the vessels were defined with the ImageMaster software to accurately collect the fura 2 fluorescence from the chosen arteriolar segments and at a minimum distance of 20 µm from the branching points between AA and ILA.
|
Real-time PCR for V1a receptor on isolated AA and ILA. Quantization of V1a mRNA was done by real-time PCR and AA and ILA were collected from five WKY and five SHR. Vessels were isolated as described above and resuspended in Cells to Signal lysis buffer from Ambion. Each sample consisted of six to eight vascular segments and was resuspended in 50 µl buffer. First-strand cDNA was synthesized directly using chemicals from the Cells to Signal kit and primed by Pd (N)10 primers. Each cDNA synthesis was performed in a total volume of 60 µl. The reaction mix was then added 0.6 µl glycogen (20 mg/ml), 6 µl potassium acetate (3 M), and 150 µl ice-cold absolute ethanol. The reaction was precipitated at 20°C overnight and centrifuged at 15,000 g for 10 min at 4°C. The precipitated cDNA was resuspended in 16 µl water and used as template for the amplification. Primers for amplification of V1a were selected for a 114-bp fragment containing the splicing site of the two V1a exons. The forward primer was 5'-atgtggtcagtctgggatga-3'. The reverse primer was 5'-catgtatatccacgggttgc-3'. The Taqman probe was 5'-caatcacggcgttgctggct-3', marked with FAM and 3'-TAMRA. The amplified V1a cDNA was normalized against amplified 18S ribosomal RNA to compensate for any changes due to RNA degradation, reverse transcriptase efficiency, or amplification success. The primers were made for a 68-bp fragment. The forward primer was 5'-agtccctgccctttgtacaca-3'. The reverse primer was 5'-gatccgagggcctcactaaac-3'. The Taqman probe was 5'-cgcccgtcgctactaccgattgg-3', marked with 5'-Yakima Yellow and 3'-TAMRA.
The amounts of V1a and 18S were quantified using a standard curve for known quantities of V1a or 18S DNA. The V1a standard curve was made by amplifying a 1,125-bp region of the V1a cDNA with the primers ccgtggtggcctctaaccac (forward) and ctgtctttcggctcatgcta (reverse). For the 18S standard curve, a 396-bp region of the rat 18S RNA cDNA was amplified using primers ttcagccaccgagattgagc (forward) and cgcaggttcacctacggaaa (reverse). The amplification products were then cloned into pBAD TOPO TA vectors and transfected into TOP 10 Escherichia coli cells (Invitrogen). Plasmids containing the cloned material were then purified from bacterial cultures using a Qiagen Plasmid Purification Midi kit. The purified plasmids were diluted to concentrations appropriate for the standard curve: 1010, 108, 107, 106, and 105 molecules/µl for 18 S, and 106, 105, 104, and 103 molecules/µl for V1a. The primer and probe constructions were done using Primer Express software from Applied Biosystems. The quantification was done on an ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems) and with a qPCR Core Kit (Eurogentec). The primer concentrations were optimized before use in quantification. Forward primers for both V1a and 18S were used in a final concentration of 0.3 µM. Reverse primers for both V1a and 18S were used in a final concentration of 0.9 µM. For each sample, 1 µg of total RNA in 15 µl was used for the cDNA synthesis. In each amplification reaction, 1 µl cDNA solution was used as a template. All amplifications of both V1a and 18S RNA were done using two parallel amplification reactions under standard ABI conditions using a 19-µl reaction volume.
Chemicals. All chemicals used in this experiment were from Sigma, except fura 2 acetoxymethyl which came from Molecular Probes. The RPMI media contained (in g/l) 7.65 NaCl, 0.40 KCl, 0.203 MgCl2, 0.20 NaH2PO4, 1.34 HEPES, 1 glucose, 0 Na, 0.11 pyruvat, 0.35 CaHCO3, 0.22 CaCl2, RPMI vitamins (Sigma R7256), and amino acids (Sigma R7131); 20x SSC (in g/l): 175 NaCl, 88.2 Na citrate, adjusted to pH 7.0 with 10 N NaOH; malonic acid buffer: 11.6 malonic acid, 8.77 NaCl, adjusted to pH 7.5 with solid NaOH.
Statistics.
Data were presented as means ± SE. Sets of data were tested by ANOVA. P values of
0.05 were considered statistically significant. Differences between means were calculated in SPSS 12.0.
| RESULTS |
|---|
|
|
|---|
Measurements of intracellular cytosolic calcium showed no significant difference in baselines between the 24 combinations of strain (WKY or SHR), segment (ILA or AA), agonist (AVP or norepinephrine), or treatment (untreated, nifedipine treated, or 0 [Ca2+]o) (P > 0.3, n = 814 in each group). However, when the baseline values for each segment in WKY and SHR were pooled, a significant difference of baseline calcium ratio became evident. As shown in Fig. 2A, the baseline ratio in the AA segments was 0.82 ± 0.02 in WKY and 0.90 ± 0.02 in SHR (P < 0.005, n = 67 and 68, respectively). In the ILA segment, the baseline ratio was 0.81 ± 0.01 in WKY and 0.92 ± 0.02 in ILA (P < 0.001, n = 86 and 88, respectively). There were no significant differences between AA and ILA from the same strain (P > 0.6 for both WKY and SHR).
|
|
|
|
As shown with representative tracings in Fig. 3, and averaged in Fig. 4, vessels pretreated with nifedipine before AVP stimulation showed a peak response almost unchanged from the untreated vessels (P > 0.5). The ILA fragments from SHR showed an exaggerated calcium ratio increase to AVP also after nifedipine pretreatment. The initial peak ratio increase was 0.22 ± 0.05 (n = 10) in AA from WKY and 0.17 ± 0.03 (n = 8) in AA from SHR (P > 0.5). In ILA, the initial ratio increase was 0.22 ± 0.05 (n = 10) in WKY and 0.60 ± 0.14 (n = 13) in SHR (P < 0.05). No difference between AA and ILA was seen in WKY (P > 0.5), but in SHR a more than a threefold difference was found (P < 0.05).
The sustained ratio increase in AA was 0.03 ± 0.01 in WKY and 0.04 ± 0.02 in SHR (P > 0.8). In ILA, the sustained ratio increase was 0.08 ± 0.03 in WKY and 0.12 ± 0.02 in SHR (P < 0.01). The sustained response in nifedipine-treated vessels was significantly smaller than in untreated vessels (P < 0.05), except in AA in WKY (P > 0.2).
As shown in representative tracings in Fig. 3, and averaged in Fig. 4, vessels stimulated with AVP in calcium-free media (2 mM EGTA) had a reduced peak response in WKY and SHR compared with vessels stimulated in normal media. The differences in ratio increase observed in normal media between ILA from WKY and SHR were absent in calcium-free media. The peak ratio increase was 0.14 ± 0.05 (n = 8) in AA from WKY and 0.15 ± 0.03 (n = 14) in AA from SHR (P > 0.8). In ILA, the peak response was 0.20 ± 0.03 (n = 8) in WKY and 0.24 ± 0.05 (n = 14) in SHR (P > 0.5). The peak values in both segments and strains were similar (P > 0.1). The ILA segment in SHR was reduced compared with both untreated and nifedipine-treated ILA peak responses in SHR (P < 0.05). The sustained Cai2+ response in EGTA-treated vessels was not significantly different from zero in either WKY or SHR (P > 0.3).
To compare calcium signaling obtained with AVP in AA and ILA from both strains, vessels were stimulated with norepinephrine (107 M) under the same conditions as with AVP. As shown with representative tracings in Fig. 6, and averaged in Fig. 7, the basic norepinephrine ratio response was 0.66 ± 0.03 (n = 13) in AA from WKY and 0.58 ± 0.11 (n = 8) in AA from SHR (P > 0.1). The response was 0.80 ± 0.08 (n = 14) in ILA from WKY and 0.71 ± 0.07 (n = 8) in ILA from SHR (P > 0.1).
|
|
In vessels treated with nifedipine (107 M), the initial calcium response to norepinephrine was 0.29 ± 0.02 (n = 8) in AA from WKY and 0.43 ± 0.07 (n = 11) from SHR (P > 0.13). The response was 0.28 ± 0.06 (n = 8) in ILA from WKY and 0.38 ± 0.05 (n = 14) in ILA from SHR (P > 0.32). There were no differences between AA and ILA in each strain (P > 0.1). However, in all segments, the peak values were reduced compared with the untreated responses (P < 0.05).
The sustained ratio increases in nifedipine-treated vessels were 0.07 ± 0.02 in AA from WKY and 0.12 ± 0.05 in AA from SHR (P > 0.37). The response was 0.04 ± 0.02 in ILA from WKY and 0.14 ± 0.03 in ILA from SHR (P = 0.07). There were no differences between AA and ILA within each strain (P = 0.08). However, as with the initial responses, all sustained responses were reduced compared with untreated plateau values (P < 0.05).
In vessels treated with EGTA (2 mM), the calcium ratio response to norepinephrine was 0.28 ± 0.04 (n = 8) in AA from WKY and 0.33 ± 0.11 (n = 8) in AA from SHR (P > 0.7). The ratio increase was 0.28 ± 0.04 in ILA from WKY and 0.39 ± 0.12 in ILA from SHR (P > 0.3). There were no differences between AA and ILA in each strain (P > 0.3). The peak values were unchanged compared with nifedipine-treated values (P > 0.7) but reduced compared with untreated peak responses (P < 0.05).
The sustained ratio increase in zero calcium was not different from zero and reduced compared with untreated and nifedipine-treated vessels (P < 0.05) except in AA from SHR (P = 0.08).
Simultaneous with fura 2 recordings, the diameters of the vessels were measured 5 s before and 5 s after the stimulation with AVP to study the relationship between calcium response and diameter change. As seen in Fig. 2B, the mean afferent arteriolar resting diameter in WKY was 21.6 ± 0.5 µm in AA and 37.8 ± 2.1 µm in ILA. In SHR, the afferent arteriolar resting diameter was 14.4 ± 1.2 µm in AA and 30.4 ± 2.4 µm in ILA. The resting diameters in SHR and WKY were significantly different in the AA segment (P < 0.01) but not in ILA (P > 0.2).
In WKY, the diameter was reduced to 78 ± 5% of the resting diameter in AA and to 82 ± 5% of the resting diameter in ILA during AVP stimulation (P > 0.5; Fig. 8). In SHR, the diameter was reduced to 87 ± 4% of the resting diameter in AA and to 61 ± 3% of the resting diameter in ILA (P < 0.001). In AA, the change in diameter was not different between the strains (P > 0.2), but in ILA there was a significant difference in diameter change during AVP stimulation between the two strains (P < 0.001).
|
|
| DISCUSSION |
|---|
|
|
|---|
Previous studies demonstrated that AVP injection into the renal artery produces exaggerated renal vasoconstriction in young SHR compared with normotensive WKY (13). The Cai2+ response to AVP has also been shown to be enhanced in SHR compared with the normotensive control (21). This is most likely due to the increased density of V1a receptors in preglomerular vessels, which has been shown by Vagnes et al. (38) using ligand-binding technique and measurements of mRNA.
Hormonal heterogeneity in different vascular segments of the kidney has been found in the hydronephrotic kidney preparation (35) and in the juxtamedullary perfused model (17). In the hydronephrotic kidney preparation, the effect of AVP seems to be increased in ILA compared with AA. In the juxtamedullary perfused model, the effect of AVP was significantly lower in ILA compared with the distal part of AA using low concentrations (109-108 M) of AVP, but at higher concentrations (107-106 M) the contractile responses were similar. These contradictory findings may be due to use of different experimental models. Calcium signaling with AVP and measurements of V1a mRNA have until now only been performed on samples produced with the iron oxide/sieving technique, where the relative contribution of VSMC from AA and ILA segments is not known.
It is well known that there are substantial differences in Ca2+ signaling pathways and hormone responses between afferent and efferent segments (6, 24). There are also several other examples of segmental heterogeneity in hormonal responses to different vasoactive hormones (7, 17, 35). Earlier studies showed an exaggerated Cai2+ response to AVP or V1a agonists in SHR using the iron oxide/sieving technique or similar techniques, which produces a mixture of smooth muscle cells from both AA and ILA (10, 21). This method has also been used for receptor protein and mRNA measurement for the V1a receptor (38). Based on the possibilities obtained by the agar perfusion/enzyme digestion technique for isolation of preglomerular vessels, we have been able to explore differences between preglomerular segments to a greater extent than before.
In a recent paper, we observed greater variations in the Cai2+ response in isolated preglomerular fragments from young SHR compared with age-matched WKY, and we decided to explore this observation further (39). In the present study, we found a nearly twofold increased calcium response in ILA compared with AA in SHR. In the normotensive controls, no differences between calcium signaling in AA and ILA were found, and the response in these two segments was not different from what was seen in AA from SHR. Similar to other findings (34), stimulation with norepinephrine did not show any difference in peak response between the two segments in WKY and SHR, indicating that the AVP-induced signaling in ILA from SHR is different from norepinephrine. We propose that the previously observed exaggerated calcium response to AVP in preglomerular segments from SHR results mostly from increased reactivity in the ILA segment.
Earlier studies showed that calcium entry via voltage-gated operated channels is the predominant mechanism for cytosolic calcium increase in preglomerular vessels (5, 8), but several later studies also demonstrated that calcium mobilization from intracellular stores is taking place in preglomerular vessels (10, 12, 24, 32, 33). Flow studies after injection of AVP showed that the contribution of IP3-mediated mobilization of internal Ca2+ stores constituted two-thirds of the Ca2+ response in both SHR and WKY (12). Further support for the role of mobilization of internal Ca2+ stores in preglomerular vessels is given in the present study, as nifedipine treatment did not affect the AVP-induced peak response. The sustained response was reduced in both WKY and SHR, as predicted due to the blocking effect nifedipine has on L-type Ca2+ channels. However, pretreatment with nifedipine on norepinephrine-stimulated vessels gave a significant reduction in both peak and plateau values, similar to what was found by Salomonsson and Arendshorst (34) in microdissected AA from WKY and SHR. This observation is supported by findings of Bauer and Parekh (1), who found that nifedipine influenced the vasoconstrictive effect of AVP and norepinephrine differently. These authors found that to reduce renal blood flow by 25%, coinfusion with nifedipine required the norepinephrine dosage to be increased fourfold, whereas the AVP dosage only needed to be increased twofold. In our study, the AVP-induced peak responses were only reduced in ILA from SHR during removal of external calcium, whereas the peak response after norepinephrine stimulation was also reduced after nefidipine treatment. These findings indicate that the norepinephrine-induced Ca2+ response is more dependent on entry mechanisms in the initial phase than AVP.
In our experiments, the sustained responses after norepinephrine and AVP stimulation were reduced after nifedipine treatment and abolished after removal of external calcium in both strains. The incomplete ability of nifedipine to abolish the plateau response supports the presence of a second calcium entry pathway in addition to L-type voltage-regulated Ca2+ channels, as earlier suggested by Salomonsson and Arendshorst (33, 34). Also, the fact that removal of external calcium completely abolishes the sustained response suggests a major dependence on entry mechanisms both after norepinephrine and AVP stimulation.
In the present study, we measured the basic diameters and the contractile effect of AVP in AA and ILA. The resting diameters obtained by the methods used in the present study were similar to what we and others reported earlier in young SHR and WKY using the microsphere method (19, 22). The diameter of the ILA cannot be measured by the use of microspheres, but in casts the diameter has been measured to be within the limits of 25 to 60 µm (15, 30). The contractile response to AVP was significantly greater in ILA from SHR compared with the AA and the corresponding segment in WKY. Similar to our results, stimulation with AVP in the hydronephrotic kidney model (7), and the perfused juxtamedullary nephron preparation (17), has indicated considerable contractile responses in the ILA segment. In accordance with our data from WKY, Harrison-Bernard and Carmines (17) found a diameter change in ILA from Sprague-Dawley rats that was similar to the distal and central part of AA, when using the same concentration of AVP that was used in the present study (107 M). Similar to our data, Touyz et al. (36) found an increased contractile response to AVP in third-order branches of arteries from the mesenteric bed in 17-wk-old SHR compared with WKY and Wistar rats.
In contrast to baseline calcium values obtained from the renal vasculature using the iron oxide/sieving technique (11, 21), and also when other isolation techniques have been used (28, 34), the baseline Cai2+ level in this study was higher in the hypertensive strain. However, similar to our results, Brown et al. (4) found that cardiac myocytes had increased Ca2+ resting levels in SHR compared with WKY. Touyz and Schiffrin (37) found that the basal [Ca2+]i in mesenteric arteries from 17-wk-old SHR was 134 ± 8 nM, significantly higher than the baselines found in WKY (98 ± 12 nM) and in Wistar rats (99 ± 10 nM). These changes were already seen in 5-wk-old rats and are similar to our data when our results are converted to Ca2+ concentration from ratio values. Touyz and Schiffrin used pressurized arterioles, which are mimicked by the agarose core in our vessels. Pressurizing and the use of intact vasculature are most likely important factors in physiological conditions, and this might explain why the results in the present paper differ from recordings done of single cells (11, 21) or unpressurized arterioles (28, 34). Preglomerular arterioles have been shown to be constricted at a young age in SHR (19, 22), and based on the data presented in the present study, it is not unlikely that increased vascular tone in the SHR renal vasculature is linked to a higher steady-state level of [Ca2+]i.
The ligand-binding method used earlier in our laboratory (38) is not suitable to test isolated segments of the vascular bed because of the large amounts of protein needed. Using the agar perfusion/enzyme digestion method, preglomerular segments were isolated and the V1a mRNA levels were measured with real-time RT-PCR. The results showed a threefold higher level of V1a in ILA from SHR, and this finding is consistent with the increased calcium signaling and vasoconstriction induced by AVP in this segment.
Some methodological reservations should be made in the interpretation of data from the present study. The preparation consists of two different cell types, VSMC and endothelial cells. Consequently, there are two possible sources of calcium transients, and the measured [Ca2+]i are averaged values derived from the two cell layers. As a consequence, we presented our Ca2+ recordings as ratio values and used converted [Ca2+]i values only for comparison with other studies. It is well established that the endothelium is an important modulator for vascular responses. Therefore, we argue that arterioles with the endothelial cell layer intact most likely exhibit physiological responses representative of vessels in vivo, especially because differences in endothelium-derived relaxing factors are reported to differ between the two strains used in this study (25, 40).
In conclusion, Ca2+ signaling, contractile responses, and V1a mRNA levels demonstrate that the exaggerated responsiveness to AVP is localized to the ILA segment in SHR. This condition could reduce blood flow to the glomeruli and thereby lower the glomerular filtration rate and induce salt and water retention, which is regarded as one of the possible mechanisms of hypertension in SHR.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
B. Ponnuchamy and R. A. Khalil Cellular mediators of renal vascular dysfunction in hypertension Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2009; 296(4): R1001 - R1018. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Helle, O. B. Vagnes, and B. M. Iversen Angiotensin II-induced calcium signaling in the afferent arteriole from rats with two-kidney, one-clip hypertension Am J Physiol Renal Physiol, July 1, 2006; 291(1): F140 - F147. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |