|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1Department of Physiology and 2Renal Division, Emory University, Atlanta, Georgia
Submitted 9 May 2002 ; accepted in final form 1 March 2005
| ABSTRACT |
|---|
|
|
|---|
,
, and
). In Madin-Darby canine kidney (MDCK) cells and Xenopus laevis oocytes transfected with all three ENaC subunits, neural precursor cell-expressed developmentally downregulated protein (Nedd4-2) promotes ubiquitin conjugation of ENaC. For native proteins in some cells, ubiquitin conjugation is a signal for their degradation by the ubiquitin-proteasome pathway, whereas in other cell types ubiquitin conjugation is a signal for endocytosis and lysosomal protein degradation. When ENaC are transfected into MDCK cells, ubiquitin conjugation leads to lysosomal degradation. In this paper, we characterize the involvement of the ubiquitin-proteasome proteolytic pathway in the regulation of functional ENaC in untransfected renal A6 cells expressing native ENaC subunits. In contrast to transfected cells, we show that total cellular
-,
-, and
-ENaC subunits are polyubiquitinated and that ubiquitin conjugation of subunits increases when the cells are treated with a proteasome inhibitor. We show that Nedd4-2 is associated with
- and
-subunits and is associated with the apical membrane. We also show the Nedd4-2 can regulate the number of functional ENaC subunits in the apical membrane. The results reported here suggest that the ubiquitin-proteasome proteolytic pathway is an important determinant of ENaC function in untransfected renal cells expressing endogenous ENaC. amiloride-sensitive epithelial sodium channel; ubiquitination; Nedd4; membrane-spanning protein
,
, and
. Each subunit consists of one large extracellular domain with several putative N-linked glycosylation sites and small COOH- and NH2-terminal domains (4, 20). ENaC plays an essential role in maintaining total body fluid and electrolyte homeostasis by determining the amount of Na+ reabsorption from the distal nephron and colon. ENaC also plays a role in fluid clearance from the lung alveolar spaces by regulating Na+ transport in alveolar type II cells (16). Proper regulation of ENaC function is crucial because any abnormality in ENaC function can lead to problems with total body sodium balance with consequent abnormal blood pressure [as typified by the genetic disorders Liddle's syndrome (5, 8, 9, 19) and pseudohypoaldosteronism type I (26)]. In these diseases, ENaC function is changed either by altering the activity of single sodium channel proteins or by altering the total number of functional channels in the plasma membrane. In general, the number of channels in the plasma membrane represents a balance between the rate at which new channels are inserted in the membrane and the rate at which they are removed. Therefore, changes in the number of channels in the plasma membrane can either result from changes in the degradation rate or the synthesis and insertion rate of ENaC protein molecules. We previously showed in cells expressing endogenous ENaC that one way to modulate the number of functional channels in untransfected renal cells is to alter the rate of ubiquitin-dependent proteasomal proteolysis (15). Here, we sought to determine the role of one isoform of neural precursor cell-expressed developmentally downregulated protein (Nedd4-2) and ubiquitination of wild-type ENaC in an untransfected distal nephron cell line (A6) derived from Xenopus laevis kidney. We conclude that membrane-associated ENaC molecules are ubiquitinated by Nedd4-2 before their degradation by the proteasome and hence Nedd4-2 regulates the number of functional membrane-associated ENaC in these A6 cells.
Ubiquitin coupling can be of two different types, mono- and polyubiquitination (also referred to as multi-). Monoubiquitination occurs when one ubiquitin molecule is coupled to one or more lysine residues on a target protein so that the final stoichiometry is one ubiquitin per lysine; for polyubiquitination, a chain of ubiquitin is coupled to one lysine on a target protein with a final stoichiometry of four or more ubiquitins per lysine. Monoubiquitinated proteins are degraded in lysosomes, whereas polyubiquitinated proteins are recognized by and subsequently degraded by the 26S proteasome (11).
There are several steps in ubiquitin-dependent protein degradation by the proteasome, but the initial event is ubiquitin conjugation of a target protein, which is the same for both mono- and polyubiquitination. Ubiquitin conjugation is ATP dependent and occurs as a result of the formation of an isopeptidic covalent linkage between the terminal glycine of ubiquitin and the
-amino group of a lysine residue on the target protein. For polyubiquitination, the next ubiquitin is linked between lysine at amino acid 48 of a ubiquitin and the terminal glycine of another ubiquitin protein. In general, three types of enzymatic activities are necessary to catalyze this process: a ubiquitin-activating enzyme, E1, a ubiquitin conjugating enzyme, E2, and a ubiquitin ligase, E3 (11). There appear to be different E3 ligases that promote ubiquitin conjugation to specific target proteins, although there may be specific E1 and E2 enzymes as well.
Nedd4-2 appears to be an ENaC-specific ubiquitin ligase. Nedd4-2 contains an E6-AP COOH terminus (Hect) domain that is homologous to other ubiquitin ligases, three or four WW domains (depending on the species) that interact with the ENaC subunit PPxY domain (24) and a calcium/lipid binding domain (CaLB/C2) . In Madin-Darby canine kidney (MDCK) cells transfected with high levels of the ENaC subunits, the NH2 termini of
- and
-ENaC subunits are ubiquitin conjugated (22). Therefore, Nedd4-2 can at least act as the E3 enzyme in the ubiquitin conjugation of proteins that are subsequently degraded by some proteolytic pathways. Immunohistochemical experiments show that Nedd4-2 is colocalized with ENaC in the rat lung and kidney cells (25). A mutation or deletion of the PPxY region of the
- and
-subunits to which Nedd4-2 binds produces an increase in ENaC activity and results in Liddle's syndrome (8, 9, 19). In X. laeivs oocytes expressing
-,
-, and
-ENaC subunits, Nedd4-2 decreases the whole cell current and decreases the number of ENaC molecules in the plasma membrane (23). Together, these results suggest, but do not prove, that Nedd4-2 when cotransfected with ENaC brings about ubiquitin conjugation of ENaC subunits and regulates the number of functional ENaC molecules. However, it appears that in these transfected systems, the ubiquitinated ENaC molecules are degraded by lysosomes, because, in MDCK cells transfected with all three ENaC subunits, inhibition of lysosomes causes an increase in total cellular ENaC subunit protein levels. However, in our previous work, we showed that in untransfected renal cells expressing endogenous ENaC, in contrast to transfected cells, inhibition of lysosomes did not cause an increase in ENaC subunit protein levels. However, in these untransfected cells inhibition of proteasome activity led to an increase in the amount of cellular ENaC protein and the number of functional ENaC molecules in the plasma membrane. Furthermore, in patch-clamp experiments, an increase in channel density was observed in untransfected renal cells treated with proteasomal inhibitors (15). These results suggest that functional ENaC molecules are degraded by ubiquitin-proteasome proteolysis, and, consequently, that proteasome degradation might be an important regulator of the ENaC in untransfected, native epithelial cells. To further characterize the role of ubiquitin-proteasome proteolysis and ubiquitin conjugation, we studied the role of ubiquitination of wild-type ENaC in untransfected A6 cells. Additionally, because Nedd4-2 is assumed, but not proven, to be a ubiquitin ligase in transfected cell systems, we also characterized the role of Nedd4-2 as a ubiquitin ligase in untransfected cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell surface biotinylation.
The apical surface of confluent A6 cells grown on permeable supports were biotin labeled as previously described (15). To determine the half-life of membrane-associated ENaC, proteasome inhibitor-treated and untreated cells were immediately labeled. Biotin-labeled cells were returned to the incubator for 2, 4, 6, 16, or 24 h, and then cells were harvested at 4°C by scraping them into PBS buffer containing protease inhibitor cocktail A (100 µM leupeptin, 100 µM antipain, 1 mM PMSF, 100 µM N-
-p-tosyl-L-lysine chloromethyl ketone, and 100 µM N-tosyl-L-phenylalanine chloromethyl ketone).
Immunoprecipitation and precipitation of biotinylated ENaC. A6 cells were lysed in RIPA buffer (PBS with 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate) containing the protease inhibitor cocktail A described above. However, for Nedd4-2 associated with ENaC or apical membrane proteins, cells were lysed by homogenization in gentle lysis buffer (50 mM Tris, 76 mM NaCl, 10% glycerol, 2 mM EGTA, and 1% wt/vol NaPO4). Cellular debris was removed by centrifugation (1,200 g, 5 min). The biotin-labeled proteins were precipitated by incubating with prewashed streptavidin-coated agarose beads for 18 h with gentle agitation at 4°C. These beads were washed five times with RIPA (PBS with 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate), and the biotin-streptavidin complex was lysed by boiling in buffer containing 100 mM DDT and 5% SDS. The apical biotin-labeled proteins were subsequently analyzed by Western blotting using rabbit anti-ENaC subunit-specific polyclonal antibodies. These subunit-specific antibodies were raised in rabbits against synthetic peptide sequences corresponding to the ENaC subunits and purified as previously described (15). For immunoprecipitation experiments, A6 cell lysate was incubated with rabbit anti-ENaC subunit-specific antibodies, rabbit anti-Nedd4-2, or goat anti-ubiquitin antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at a dilution of 1:50 or 1:20 (for anti-ubiquitin antibody) for 18 h at 4° C. The Nedd4-2 antibody was generated in rabbits against the synthetic peptide corresponding to the Nedd4-2 amino acid sequence (ESEQAWDVVDSNDSSSPHQQ). The antigen-antibody complex was immunoprecipitated with prewashed protein A-coated agarose, washed five times with either RIPA or gentle lysis buffer containing protease inhibitor cocktail A and then eluted as mentioned before, and the immunoprecipitate was analyzed by Western blotting using mouse anti-ubiquitin (1:1,000) or rabbit anti-ENaC subunit-specific antibodies (1:500) (15).
Immunoblotting. The precipitated proteins were separated on either linear 7.5% or gradient 420% SDS-PAGE and transferred to nitrocellulose. The nitrocellulose was blocked in TBS buffer containing 5% milk and 0.1% Tween 20 and then probed with mouse anti-ubiquitin FK1 antibody (Biomol) at 1:1,000 dilution, FK2 antibody (Covance) at 1:1,000 dilution, Nedd4-2, or ENaC subunit-specific antibodies at 1:500 dilution. Nedd4-2 and ENaC subunit-specific antibodies were purified from serum using an antigenic peptide affinity column as described previously (15). In experiments involving peptide competition, the primary antibody was incubated with the antigenic peptide (0.1 mg/ml) for at least 1 h at room temperature before the antibody to probe the nitrocellulose was used. The secondary antibodies used were at 1:10,000 dilution and were goat anti-rabbit IgG, anti-mouse IgG, anti-mouse-IgM coupled to alkaline phosphatase (Kirkegaard and Perry Laboratories), and the antigen antibody complex was detected using a chemiluminescence detection system CDP-star (Tropix) and Kodak 2000M camera system (Eastman Kodak, Rochester, NY).
Preparation and use of antisense oligonucleotides and small-interference RNA. Nedd4-2-specific phosphorothioate oligonucleotides were produced by the Emory University Microchemical Facility (antisense: TCAGCCGCCATGGGGAGAGT and sense: CTCTCCCCATGGCGGCTGA). Antisense oligonucleotide was complimentary to and spanned the translation start codon of Nedd4-2 mRNA, whereas sense oligonucleotide was identical to the coding strand. In a BLAST search of GenBank, neither the sense or antisense oligonucleotide showed any similarity to other known sequences. Cultured A6 cells were exposed to medium containing 10 µM oligonucleotide overnight (1618 h). Our previous experiments have shown that A6 cells grown on permeable supports take up oligonucleotides without the need for agents to enhance the uptake. We show in Western blots (see Fig. 7) that the antisense oligonucleotide does reduce Nedd4-2 protein level and that the sense oligonucleotide used as a control does not affect protein levels.
|
| RESULTS |
|---|
|
|
|---|
Proteasome inhibition increases ubiquitin-conjugated ENaC.
Before we investigated the mode of ubiquitination associated with ENaC degradation, we examined whether ENaC subunits were indeed coupled to ubiquitin in vivo in untransfected renal cells. We immunoprecipitated all ubiquitin-coupled proteins in the A6 cell lysate using polyclonal antibody raised against complete ubiquitin protein and probed for ENaC subunits using anti-subunit-specific antibodies. We observed bands of
90, 110, and 150 kDa for the
-subunit, of
110 kDa for the
-subunit, and of 150 kDa for the
-subunit (Fig. 1). The molecular mass of non-ubiquitin-coupled
is
86 kDa. Ubiquitination increases the molecular mass by
5, 25, or 65 kDa, implying that either 1, 34, or 10 ubiquitin molecules are coupled to the
-subunit. For the nonglycosylated
-subunit, this difference in molecular mass is
15 kDa, implying that 23 ubiquitin molecules are coupled to the
-subunit, and for the
-subunit the increase is
65 kDa, implying about 10 ubiquitin molecules.
|
-,
-, and
-subunits from the cells. Ubiquitinated ENaC subunits were detected in these immunoprecipitates with anti-ubiquitin monoclonal antibodies FK1 and FK2. Monoclonal antibody FK1 recognizes polyubiquitin molecules but not free ubiquitin molecules, whereas the FK2 antibody recognizes both mono- and polyubiquitins but not free ubiquitin molecules on Western blots. We [like many investigators studying ubiquitination (12, 28)] observed a broad, diffuse band corresponding to ubiquitinated
-,
-, and
-subunits (Fig. 2), which increased in intensity when the cells were incubated with the proteasome inhibitor MG-132. These results show that ubiquitin is coupled to ENaC subunits. However, these results cannot differentiate between mono- or polyubiquitin-coupled ENaC subunits because ubiquitin could couple to one or more of seven intracellular lysines for the
- and nine for
- and
-subunits as mono- or polyubiquitin. Consequently, both mono- and polyubiquitin ENaC subunits would resolve into 150- to 200-kDa bands on SDS-PAGE, as we seen in Fig. 2.
|
-,
-, and
-subunits. Ubiquinated ENaC subunits were detected with the anti-ubiquitin monoclonal antibody FK1 in these immunoprecipitates resolved on 7.5% linear SDS-PAGE. We observed high-molecular-mass bands similar to the one detected with the monoclonal antibody FK2 (recognizes both mono- and polyubiquitin but not free ubiquitin). However, no such diffuse band was present when antigenic peptide was included during immunoprecipitation (Fig. 3) or when the lysate was incubated with protein A-coated beads (data not shown). As expected, a 55-kDa band corresponding to the heavy chain of the primary antibody was observed, suggesting that in these control experiments protein A-coated beads bound to the primary antibody immunoprecipitating the antigenic peptides instead of ENaC subunits. Together, these results show that the immunoprecipitations are specific for ENaC subunits, which are coupled to either mono- or polyubiquitin. The intensity of these bands was increased when the cells were incubated with the proteasomal inhibitor MG-132 (Table 1). These results suggest that all three ENaC subunits are conjugated to polyubiquitin molecules and that the extent of polyubiquitinated ENaC increases in the presence of a proteasomal inhibitor. Because each substrate molecule may have different numbers of ubiquitin molecules linked to it, one might expect a ladder of bands spaced at 7-kDa intervals (the molecular mass of 1 ubiquitin molecule). However, the diffuse band of ENaC conjugated to polyubiquitin is typical of that observed by other investigators using anti-ubiquitin antibodies in many systems (12, 28). However, we wanted to further resolve these bands and determine their sizes; therefore, we used 415% gradient SDS-PAGE (Fig. 2). For the
-subunit, we detected three bands at
100, 200, and 250 kDa. The 100-kDa band could be coupled to two polyubiquitin molecules for glycosylated ENaC or three polyubiquitin molecules for nonglycosylated ENaC, and this band did not change in response to the proteasome inhibitor. Bands at higher molecular masses of
250 and 200 kDa represent an addition of
15 and 20 polyubiquitin molecules to the
-subunit, and these bands increased in intensity in the presence of proteasomal inhibitor. We detected several polyubiquitinylated bands in the immunoprecipitate of the
-subunit at 230, 205, 190, 160, 130, and 107 kDa. All of these bands increased in intensity in cells treated with proteasomal inhibitors. These bands correspond to addition of 218 polyubiquitin molecules on the
-subunit (Table 1). Interestingly, in the
-subunit immunoprecipitate we detected one band in untreated cells at 210 kDa and two bands at 230 and 190 kDa in proteasome inhibitor-treated cells with higher band intensity. These bands correspond to
13 ubiquitin molecules for untreated cells and 16 and 11 for proteasome inhibitor-treated cells (Table. 1). Together, these results show that all three ENaC subunits are polyubiquitinated and that the bands increase in intensity in the presence of a proteasome inhibitor. These results strongly suggest that all three ENaC subunits are degraded by proteasome in untransfected cells.
|
|
-subunits was very long (>24 h); however, half-life of
in cells treated with the proteasome inhibitor appeared to be even longer (Fig. 5). The half-life of
-subunit in untreated cells was 8.3 ± 0.96 h and increased to 64.6 ± 0.86 h in MG-132-treated cells (Fig. 5). The half-life of
was 16.5 ± 3.4 h and increased to 95.3 ± 1.9 h in cells treated with MG-132 (Fig. 5). These results suggest that proteasome determines the removal rate of at
-,
- and probably
-ENaC subunits from the apical membrane.
|
|
- and
-subunits using surface plasmon resonance. Furthermore, coexpression of Nedd4-2 or WWP2 (member of Nedd4-2 family) and ENaC subunits in X. laevis oocytes reduces membrane-associated ENaC protein and decreases whole cell sodium current (1, 23). Together, these studies suggest, but do not prove, that Nedd4-2 is the ubiquitin ligase responsible for ENaC ubiquitination in transfected cell systems. More importantly, Nedd4-2 is assumed to be the ubiquitin ligase in native, untransfected cells responsible for ENaC ubiquitin conjugation, but no studies so far have addressed such a role for Nedd4-2. Therefore, we wanted to determine whether Nedd4-2 was the ubiquitin ligase for ENaC in untransfected A6 cells expressing endogenous ENaC. To accomplish this, we used a Nedd4-2 antibody suitable for Western blotting that we produced according to the protocol in MATERIALS AND METHODS. We determined the specificity of the anti-Nedd4-2 antibody by probing A6 cellular lysates with anti-Nedd4-2 antibody in the presence and the absence of antigenic peptide. The antibody was specific because a band of the predicted size was observed and was completely eliminated in the presence of the antigenic peptide (Fig. 6). Moreover, an in vitro translation product was recognized by the antibody in Western blot analysis (Fig. 6).
|
- and
-subunits in a nondenaturing buffer so that ENaC would remain associated with all proteins with which it is normally associated in untransfected A6 cells. When the immunoprecipitate containing all ENaC-associated proteins was subjected to Western blot analysis with anti-Nedd4-2 antibodies, we observed a band at 110 kDa that was same size as the one we observed with the A6 cell lysate (Fig. 6), but no such band was observed with preimmune serum of Nedd4-2 or in
preimmune serum immunoprecipitate probed with anti-Nedd4-2 antibody. These results show that Nedd4-2 coimmunoprecipitates with ENaC in A6 cells, suggesting that Nedd4-2 is associated with ENaC in these cells and that it might be the ubiquitin ligase for ENaC in these cells. Nedd4-2 is associated with membrane-spanning proteins. Ubiquitin-coupled ENaC subunits residing in the membrane can be ubiquinated before or after insertion into the membrane, so we wanted to distinguish between these two possibilities. Therefore, we hoped to examine the interaction between Nedd4-2 and membrane-associated ENaC; however, such an experiment would be difficult, at best, because denaturing conditions would be required. The Nedd4-2-ENaC complex is held together by noncovalent bonds, and any denaturing condition would disrupt this association. However, we could determine in these cells whether Nedd4-2 was associated with apical membrane proteins. Apical membrane proteins were labeled with biotin, precipitated with streptavidin-coated beads, and then probed with anti-Nedd4-2 antibodies in a Western blot analysis to reveal a band of the correct size (Fig. 6). Therefore, Nedd4-2 in these cells is associated with proteins residing in the apical membrane or it is a membrane protein itself. These results imply that Nedd4-2 is associated with membrane-associated ENaC and also that membrane-associated ENaC molecules are conjugated to ubiquitin after their insertion into the membrane.
Reduced Nedd4-2 expression increases ENaC function. Nedd4-2 is associated with ENaC protein and therefore might act as an ENaC ubiquitin ligase in these cells. To confirm its role in ENaC degradation, we utilized antisense oligonucleotide and SiRNA methods to reduce the amount of Nedd4-2 in these cells. Antisense oligonucleotides were designed to bind to mRNA at the protein translational start site and block Nedd4-2 protein synthesis and consequently decrease the amount of functional Nedd4-2 in the cells. To verify the effect of oligonucleotides and SiRNA on Nedd4-2 protein synthesis, we subjected oligonucleotide- and SiRNA-treated cells to Western blot analysis using the anti-Nedd4-2 polyclonal antibody. A reduction in band intensity was observed in cells treated with antisense oligonucleotides compared with those treated with sense oligonucleotides. A similar reduction was observed in cells treated with SiRNA compared with those treated with scrambled SiRNA. These results confirm that antisense oligonucleotides and SiRNA blocked the Nedd4-2 protein synthesis in these cells.
ENaC function was assessed by measuring the transepithelial current in these cells treated with either sense or antisense oligonucleotides. An increase in transepithelial current was observed in the cells treated with antisense oligonucleotides for 19 h (Fig. 7). However, no such increase in current was observed in cells treated with sense oligonucleotides for 19 h (Fig. 7). These observations show that, when Nedd4-2 expression is inhibited, the number of functional ENaC in the apical membrane increases. This implies to us that Nedd4-2 is necessary for ENaC degradation and that in the absence of Nedd4-2, ENaC accumulates in the apical membrane. To confirm that the increase in transepithelial current was due to an increase in functional ENaC number at the apical membrane, we used patch-clamp to measure the number of channels in cells treated with Nedd4-2 SiRNA or (scrambled SiRNA as a control). We observed a significant (P = 0.021) increase in the number of ENaC channels per patch in cells treated with SiRNA (results of 11 experiments) compared with cells treated with scrambled SiRNA (results of 17 experiments) (Fig. 7). To verify the effect of SiRNA on Nedd4-2 protein synthesis, we subjected the SiRNA- and scrambled SiRNA-treated cells to Western blot analysis using a Nedd4-2-specific antibody. As mentioned before, we detected a decrease in band intensity in cells treated with SiRNA compared with scrambled SiRNA-treated cells (Fig. 7). Together, these results suggest that a reduction in Nedd4-2 protein expression increases the number of ENaC channels at the apical membrane.
| DISCUSSION |
|---|
|
|
|---|
To determine the role of ubiquitin in the degradation of ENaC subunits, we showed that ENaC
-,
-, and
-subunits are ubiquitin conjugated. We did this by using two different approaches. First, we probed
-,
-, and
-ENaC immunoprecipitates with anti-ubiquitin polyclonal antibodies, and then we probed ubiquitin immunoprecipitates with anti-ENaC
-,
-, and
-subunit-specific antibodies. The first approach resulted in a typical broad, diffuse band (as seen by others) corresponding to either mono- or polyubiquitinated
-,
-, and
-subunits (Fig. 1) (12, 28). The ubiquitin immunoprecipitate yielded discrete bands corresponding to, at the least, 34 or 10 ubiquitin molecules coupled to the
-subunit, 23 ubiquitin molecules coupled to the
-subunit, and 10 ubiquitin molecules coupled to the
-subunit. The difference in these results could be due to differences in affinities of these two antibodies for different populations of ubiquitin-coupled ENaC subunits in solution. The discrete bands observed could also represent a more predominant population of ubiquitin-coupled ENaC subunits in these cells. The 150-kDa band observed here could be the same band that was previously observed by Kleyman et al. (14).
Furthermore, we also demonstrated that ENaC
-,
-, and
-subunits are polyubiquitin conjugated and that the polyubiquitinated subunit intensities are increased by proteasome inhibition. We also used gradient SDS-PAGE to resolve the broad polyubiquitin band into a more discrete ladder of bands, and this ladder of bands increased in intensity in cells treated with proteasome inhibitor. These results imply that polyubiquitinated ENaC subunits are degraded by the proteasome. In MDCK cells transfected with ENaC subunits,
- and
-subunits were shown to be coupled to ubiquitin (23). However, previous work did not differentiate between mono- and polyubiquitinated ENaC subunits. Moreover, in these transfected MDCK cells, the
-subunit was not coupled to ubiquitin; this difference between transfected and untransfected cells expressing endogenous ENaC could be due to levels of ENaC subunits expressed in these different cells. The amount of ENaC subunits expressed per cell in transfected cells is significantly more than in untransfected cells expressing endogenous ENaC. Because in transfected cells more ENaC subunit protein is expressed, it is possible that some of the ENaC subunit proteins are trafficked and degraded by different pathways than in untransfected cells.
If the primary mechanism for retrieval and degradation of apical membrane ENaC is via ubiquitin conjugation followed by proteasomal degradation, then any treatment that interferes with the initial conjugation or subsequent proteolysis should increase the number of ENaC subunits in the apical membrane. In fact, we observed an increase in the half-lives of biotinylated
- and
-subunits in the presence of a proteasome inhibitor. The half-lives of both
- and
-subunits increase in response to the proteasome inhibitor. These results suggest that both
- and
-subunits residing in the plasma membrane are degraded by the proteasome. We were unable to measure accurately an increase in the half-life of the
-subunit in the presence of a proteasome inhibitor because the half-life of
is longer than 24 h before application of the inhibitor. Thus any additional increase would be difficult to detect. In fact, in other work Kleyman et al. (14) showed that the half-life of membrane-associated, endogenous ENaC was
40 h, which contrasts markedly with the half-life of only a few hours in ENaC-transfected cell preparations (10, 18). Nonetheless, when we previously examined the total amount of
-subunit in the apical membrane (rather than the rate of removal), we did see an increase (15). Because the total amount is the balance between retrieval for ENaC subunits and degradation and because there is no indication in literature that MG-132 affects insertion, the increase in apical
-subunit implies a reduced degradation rate for
- as well as
- and
-subunits.
The half-lives we observed for all three membrane-resident ENaC subunits are comparable to those observed by Weisz et al. (27); however, our half-lives are not comparable to those observed either by May et al. (17) or by Alvarez de la Rosa et al. (2). May et al. (17) determined turnover rates of total cellular ENaC subunits that included both membrane and intracellular subunits; however, in this study we looked at only the membrane-resident ENaC subunit rates, and therefore their results are not comparable to ours. Alvarez de la Rosa (2) observed half-lives much shorter than the half-lives we observed for all three ENaC subunits. This discrepancy between our observations and those of Alvarez de la Rosa might be due to antibodies or lysis buffer. Each group used a different set of ENaC subunit-specific antibodies. However, more likely are the differences between lysis conditions. The lysis buffer used by Alvarez de la Rosa et al. contained only one detergent Triton X-100, whereas the buffer of Weisz et al. (27) and our lysis buffer contained SDS, NP-40, and sodium deoxycholate. ENaC subunits at the apical membrane as well as intracellularly are present in lipid rafts (13), and ENaC associated with lipid rafts are insoluble in Triton X-100 (13, 18). Therefore, when biotinylated ENaC associate with lipid rafts, these ENaC become Triton X-100 insoluble and precipitate. These insoluble biotinylated ENaC are not precipitated with streptavidin and thus are not detected in Western blot analysis, which could make the half-lives of biotinylated ENaC appear much shorter. Alternately, biotinylated ENaC subunits associated with lipid rafts might represent a more stable pool of ENaC subunits with longer half-lives, and those membrane ENaC subunits that are not associated with lipid rafts are less stable with shorter half-lives.
Nedd4-2 is assumed to be the ENaC ubiquitin ligase in transfected cell systems and for ENaC subunits in vitro; however, trafficking and degradation of ENaC subunits might be different in untransfected cells expressing endogenous ENaC and transfected cells overexpressing ENaC (1, 15, 22). Therefore, it was important to show an interaction between Nedd4-2 and ENaC in untransfected renal A6 cells and try to provide some evidence that Nedd4-2 can act as a ubiquitin ligase in untransfected cells. Our results show direct interaction between Nedd4-2 and total cellular ENaC
- and
-subunits in untransfected cells, but due to technical difficulties, we could not differentiate between Nedd4-2 interaction with cytoplasmic ENaC and the functional channel molecules residing in the membrane. However, we have shown that Nedd4-2 is associated with apical membrane proteins in these cells. This implies that ENaC subunits residing in the apical membrane might be also associated with Nedd4-2 and, therefore, that ENaC subunits are still conjugated with ubiquitin after their insertion into the membrane or conjugate after insertion. Furthermore, when Nedd4-2 protein synthesis was reduced by the use of antisense oligonucleotides or by SiRNA, the transepithelial current and number of ENaC per patch in these cells increased, implying that the number of functional apical sodium channels also increased (Fig. 7). These results suggest that in untransfected renal cells Nedd4-2 decreased total membrane and functional ENaC by increasing the degradation rate of the channels. These results are consistent with the work done by others in ENaC-expressing X. laevis oocytes that shows that Nedd4-2 decreased the whole cell current and the number of ENaC molecules in the oocyte membrane (23). Furthermore, in FRT cells cotransfected with either Nedd4 or Nedd4-2 and ENaC subunits, Nedd4 or Nedd4-2 SiRNA reduced amiloride-sensitive current (21).
In summary, we have demonstrated that a membrane-spanning protein, ENaC, is degraded by the ubiquitin-proteasomal proteolytic pathway in untransfected renal cells. Functional channel molecules present in the apical plasma membrane and also perhaps in the cytoplasm appear to be first coupled to polyubiquitin and then degraded by the proteasome. Nedd4-2 appears to function as a ubiquitin ligase for ENaC degradation, making it an important enzyme involved in this proteolytic process.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Present address for W. E. Mitch: Dept. of Medicine, Univ. of Texas Medical Branch, Galveston, TX 77550.
| REFERENCES |
|---|
|
|
|---|
and
ENaC using surface plasmon resonance. Biochem Biophys Res Commu 286: 12281231, 2001.[CrossRef][Web of Science][Medline]
subunit: genetic heterogeneity of Liddle syndrome. Nat Genet 11: 7682, 1995.[CrossRef][Web of Science][Medline]
subunit of the epithelial sodium channel causes hypertension and Liddle syndrome, identifying a proline-rich segment critical for regulation of channel activity. Proc Natl Acad Sci USA 92: 1149511499, 1995.
-subunit of the epithelial sodium channel. Am J Physiol Renal Physiol 281: F213F221, 2001.
subunit in A6 renal cells. J Am Soc Nephrol 8: 18131822, 1997.[Abstract]
subunit of the epithelial sodium channel. Cell 79: 407414, 1994.[CrossRef][Web of Science][Medline]
subunit of the epithelial sodium channel gene in three pseudohypoaldosteronism type 1 families. Nat Genet 13: 248250, 1996.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
N. M. Jesse, J. McCartney, X. Feng, E. M. Richards, C. E. Wood, and M. Keller-Wood Expression of ENaC subunits, chloride channels, and aquaporins in ovine fetal lung: ontogeny of expression and effects of altered fetal cortisol concentrations Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2009; 297(2): R453 - R461. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Butterworth, R. S. Edinger, R. A. Frizzell, and J. P. Johnson Regulation of the epithelial sodium channel by membrane trafficking Am J Physiol Renal Physiol, January 1, 2009; 296(1): F10 - F24. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E Hills, P. E Squires, and R. Bland Serum and glucocorticoid regulated kinase and disturbed renal sodium transport in diabetes J. Endocrinol., December 1, 2008; 199(3): 343 - 349. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Albert, A. M. Woollhead, O. J. Mace, and D. L. Baines AICAR decreases the activity of two distinct amiloride-sensitive Na+-permeable channels in H441 human lung epithelial cell monolayers Am J Physiol Lung Cell Mol Physiol, November 1, 2008; 295(5): L837 - L848. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bhalla and K. R. Hallows Mechanisms of ENaC Regulation and Clinical Implications J. Am. Soc. Nephrol., October 1, 2008; 19(10): 1845 - 1854. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. J. Mace, A. M. Woollhead, and D. L. Baines AICAR activates AMPK and alters PIP2 association with the epithelial sodium channel ENaC to inhibit Na+ transport in H441 lung epithelial cells J. Physiol., September 15, 2008; 586(18): 4541 - 4557. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bhalla, R. Soundararajan, A. C. Pao, H. Li, and D. Pearce Disinhibitory pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ Am J Physiol Renal Physiol, October 1, 2006; 291(4): F714 - F721. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bhalla, N. M. Oyster, A. C. Fitch, M. A. Wijngaarden, D. Neumann, U. Schlattner, D. Pearce, and K. R. Hallows AMP-activated Kinase Inhibits the Epithelial Na+ Channel through Functional Regulation of the Ubiquitin Ligase Nedd4-2 J. Biol. Chem., September 8, 2006; 281(36): 26159 - 26169. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Faroqui, S. Sheriff, and H. Amlal Metabolic acidosis has dual effects on sodium handling by rat kidney Am J Physiol Renal Physiol, August 1, 2006; 291(2): F322 - F331. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Malik, S. R. Price, W. E. Mitch, Q. Yue, and D. C. Eaton Regulation of epithelial sodium channels by the ubiquitin-proteasome proteolytic pathway Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1285 - F1294. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Staub and F. Verrey Impact of Nedd4 Proteins and Serum and Glucocorticoid-Induced Kinases on Epithelial Na+ Transport in the Distal Nephron J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3167 - 3174. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |