|
|
||||||||
1Division of Nephrology, Department of Medicine, and 3Department of Biochemistry, Albert Einstein College of Medicine, Bronx; and 2Department of Medicine, Mount Sinai Medical Center, New York, New York
Submitted 24 June 2004 ; accepted in final form 23 February 2005
| ABSTRACT |
|---|
|
|
|---|
glomerulus; podocytes; diabetes mellitus
180 g of glucose through the proximal tubules which accounts for
90% of glucose reabsorption. Due to the hydrophilicity of glucose, cellular glucose uptake is accomplished via transporters. Glucose influx occurs through apical Na+-glucose cotransporters that reabsorb glucose and concentrate glucose in tubules (26). Glucose efflux follows through basolateral facilitative glucose transporters (8). The family of hexose transporters (GLUT) proteins consists of several members with different characteristic elements that define their physiological function. GLUT1, GLUT2, GLUT3, GLUT4, and GLUT5 were described as hexose transporters in the kidney (3, 8, 11, 35). GLUT8, a recently identified member of the extended GLUT family has been localized to several tissues including kidney, testis, blastocysts, brain, muscle, and adipocytes and may contribute to maintenance of normal serum glucose (6, 14, 27). The aims of this study were to localize GLUT8 within normal and diabetic kidney and to study the regulation of its expression in a normal physiological context and in pathological states of insulin resistance. To understand the normal regulation in response to metabolic signals, fasting and feeding conditions were studied. To study pathological states two models of insulin resistance, the GLUT4/ mouse (16) and the leptin receptor-deficient db/db mouse (30, 32), were examined. GLUT8 mRNA and protein expression levels were regulated by normal metabolic functions during fasting and feeding as well as upregulated under diabetic conditions in vivo. The cells prominently expressing GLUT8 under normoglycemic conditions in the mouse kidney are glomerular podocytes as well as cells of the ascending limbs of Henle and the distal convoluted tubules. Glomerular podocytes are important cells for maintaining the structure of the glomerular tuft and the filtration barrier. High levels of glucose have been shown to induce stress-related markers and collagen in podocytes (15) and tubular cells (1, 34).
Glucose transporters have been described as critical mediators for intracellular glucose utilization and ATP generation and they influence the functions of the cellular survival factor Akt (10, 12, 25). Akt, a serine/threonine kinase, participates in various signaling pathways that prevent apoptosis. We and others have shown that Akt is a critical mediator of podocyte survival (13, 29). Because GLUT8 has already been shown to be required for cell survival in other cells (23) and the loss of podocytes is a key step during the development of glomerulosclerosis and observed in diabetic patients (18, 22), the present findings might be of great relevance for the pathogenesis of diabetic nephropathy. However, the functional role of increased GLUT8 expression in cellular survival of podocytes needs to be studied in more detail.
| MATERIALS AND METHODS |
|---|
|
|
|---|
GLUT4+/+ and GLUT4/ mice. Female GLUT4 +/+ or / mice on a C57BL6/CBA background (1113 wk old) were killed in the fed state or after an overnight fast (12 h) and rapidly dissected. Tissue was frozen in liquid nitrogen and stored at 70°C until processing for mRNA or protein extraction.
Db/db and db/m mice.
Male mice of C57BL/6 background were purchased from Jackson Laboratories (Bar Harbor, ME). All mice were housed at the Albert Einstein College of Medicine Animal Facility with free access to food and water. Animals were killed at 20 wk of age with average blood glucose levels of
600 mg/dl and significant proteinuria. All protocols were approved by the Animal Care and Use Committee of the Albert Einstein College of Medicine in accordance with the Public Health Service Animal Welfare Policy.
Immunofluorescence Labeling In Situ and In Vitro
For in situ detection, antibodies specific for the following proteins were used: monoclonal anti-synaptopodin antibody (20) and affinity-purified rabbit polyclonal anti-11 COOH-terminal amino acids of GLUT8 protein amino acid sequence (LEQITAHFEGR). Antibody generation and affinity purification were described earlier (27).
Mice were perfusion fixed via the left ventricle of the heart using paraformaldehyde (PFA) as described earlier (19). Tissues were then immersion fixed overnight in 10% formaldehyde and paraffin-embedded. Tissue was cut at 4 µM and, after standard deparaffinization, microwaved in citrate buffer (10 mM Na-citrate, pH 6.0). After being blocked with PBS/10% normal goat serum (NGS), tissue was incubated for 1 h with affinity-purified anti-GLUT8 (2 µg/ml). Detection was carried out using a Cy3-labeled anti-rabbit (1:150 in PBS/5% NGS) and a FITC-labeled anti-mouse antibody (1:150 in PBS/5% NGS; both from Jackson ImmunoResearch, West Grove, PA). Nuclear counterstain was carried out using 4', 6-diamidino-2-phenylindole (DAPI; Sigma, St. Louis, MO). Images were captured using a Bio-Rad MR600 confocal fluorescence microscope with a Kanton Electronic Prog/Res/3012 digital video camera and digitally processed using Adobe Photoshop 5.0.2 (Adobe Systems, San Jose, CA).
Quantitative Real-Time PCR
Total RNA was prepared using TRIzol reagent, reverse-transcribed with SuperScript II reverse transcriptase (Life Technologies, Invitrogen), and cDNA was amplified using SYBR-Green PCR Master Mix (Applied Biosystems) and specific primers for murine GLUT8 (5'-primer: ACCAAAGAGTTCAGCAGCGT; 3'-primer: TAGGACACTGAGAGCGCAGA) in an iCycler (Bio-Rad). Normalization across samples was performed using the average of the constitutive gene murine-
-actin (5'-primer: ACCGTGAAAAGATGACCCAG; 3'-primer: AGCCTGGATGGCTACGTACA).
Immunoblot Analysis
Kidneys were homogenized in buffer containing 250 mM sucrose, 1 mM EDTA, 20 mM HEPES, 4 mM phenylmethylsulfonyl fluoride, 20 nM leupeptin, and 20 nM aprotinin. Homogenates were centrifuged for 10 min at 12,000 rpm. The supernatant was transferred to new tubes and centrifuged at 90,000 rpm for 75 min at 4°C. Pellets were resuspended in PBS buffer containing 2% thesit, 4 mM phenylmethylsulfonyl fluoride, 20 nM leupeptin, and 20 nM aprotinin. One hundred micrograms of samples were separated by SDS-PAGE and transferred to Hybond ECL nitrocellulose (Amersham Pharmacia Biotech). Rabbit polyclonal GLUT8 antibodies (1:500) were used to detect GLUT8 in kidney preparations. Enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech) detection was used with laser-scanning densitometry for quantitation.
Cell Culture and Glucose Treatments
Conditionally immortalized podocytes were cultured as previously reported (20). In brief, podocytes were grown on collagen type I (Becton Dickinson, Franklin Lakes, NJ) at 33°C with IFN-
(10 U/ml, GIBCO BRL Life Technologies, Grand Island, NY) to drive expression of thermosensitive SV40 large T antigen (permissive conditions). To induce differentiation, podocytes were maintained at 37°C without IFN-
for 14 days. For D-glucose treatments, cells were grown under permissive conditions in RPMI with 10 mM glucose. At 95% confluence, they were serum starved for 48 h in RPMI with 5 mM glucose, 0.2% FBS. After 48 h, the media was changed, and the glucose-treated time points had a final concentration of 30 mM D-glucose. The time course was also done at 37°C. These cells were plated in 10 mM glucose RPMI and grown for 10 days at 37°C. They were then serum starved for 48 h in RPMI with 5 mM glucose, 0.2% FBS. After 48 h, the media was changed to the glucose-treated time points, which had a final concentration of 30 mM D-glucose.
| RESULTS |
|---|
|
|
|---|
Kidneys from 8-wk-old wild-type C57BL6/CBA mice were harvested after perfusion fixation with PFA and sucrose for 15 min each via the left ventricle of the heart followed by regular immersion fixation and tissue processing. Coimmunostainings using affinity-purified rabbit-anti GLUT8 antibody and mouse monoclonal anti-synaptopodin antibody identified glomerular podocytes as the main glomerular cells expressing GLUT8 (Fig. 1, AC). In general, glomerular staining intensity was much lower than the intensity in the tubular compartments. Longer exposure times led to stronger autofluorescence signals in the proximal tubules that were not quenchable (Fig. 1, DF). In addition, we screened glomerular cells by immunocytochemistry to define cellular distribution of GLUT8. Staining of differentiated, cultured, conditionally immortalized podocytes showed a perinuclear localization of GLUT8 (Fig. 1G), which partially overlapped with the synaptopodin staining (Fig. 1, H and I). In contrast, cultured mesangial cells stained negative for GLUT8 (data not shown). Intense GLUT8 staining was also detected in tubular cells. The staining was mainly basolateral (Fig. 2, A and B) but sometimes appeared in perinuclear regions. Colocalization experiments using GLUT8 with markers for different regions of the nephron, [aquaporin-1, -2, and -3 (AQP1/2/3) and Na-K-2Cl (NKCC)] on serial sections revealed expression of GLUT8 in the ascending loop of Henle (costaining with NKCC, Fig. 2, Ca and Cb, open arrows) and in the collecting ducts [costaining with AQP2 (Fig. 2Cc) and AQP3 (Fig. 2Cd, filled arrows)]. No overlapping staining was detected using a marker for proximal tubuli (AQP1) (data not shown). There were no significant differences in the distribution pattern between distal tubular segments of the nephron in the cortical or medullary portions. The medullary collecting ducts also stained positive for GLUT8 in a basolateral distribution pattern (data not shown). However, cultured inner medullary collecting duct (IMCD) cells showed a similar perinuclear expression pattern of GLUT8 immunostaining with no plasma membrane immunostaining noted (data not shown).
|
|
It was of interest to determine whether the absence of the insulin-responsive glucose transporter GLUT4 or differences in the serum glucose concentration in vivo would influence the expression levels of GLUT8. GLUT4 has been described to be expressed in mesangial and glomerular epithelial cells of the kidney as well as in renal microvessels (17). Quantitative real-time-PCR (QRT-PCR) analysis for GLUT8 mRNA extracted from total kidney from fed and fasted GLUT4+/+ and GLUT4/ mice was performed. Relative GLUT8 mRNA expression levels tended to be lower but did not reach statistical significance in GLUT4/ mice compared with GLUT4+/+ mice during the fed state (Fig. 3A). However, after an overnight fast, GLUT8 mRNA was significantly lower in GLUT4/ compared with GLUT4+/+ mice (P < 0.01) (Fig. 3A). Protein expression analysis using lysates from the same experimental group yielded two immunoreactive bands (32 and 75 kDa). The 32-kDa species of GLUT8 has been previously identified in various tissues by us and other investigators (6, 9, 14). Both protein species (32 and 75 kDa) showed no significant differences in expression levels in fed GLUT4+/+ vs. GLUT4/ mice [Fig. 3B; immunoblots (top) and densitometry (bottom)]. Similar to the mRNA results, lowering the blood glucose levels by an overnight fast significantly reduced the abundance of the 75-kDa species of GLUT8 in GLUT4/ compared with GLUT4+/+ mice (P < 0.01) (Fig. 3B). We previously demonstrated in the liver that preincubation of GLUT8 antiserum with the competing peptide at increasing concentrations revealed a higher specificity of the high molecular band (75 kDa) to the immune serum (9). Within both genotypes, fasting significantly downregulated the mRNA expression levels of GLUT8 in kidney (P < 0.001) (Fig. 3C). This regulatory effect on GLUT8 expression in GLUT4/ mice was also noted in GLUT8 protein expression, which demonstrated a significant reduction of the 75-kDa species in mice in the fasted compared with the fed state (P < 0.001) (Fig. 3D, bottom). These results demonstrate that GLUT8 expression in vivo is reduced with fasting, an effect that is more profound in GLUT4/ than in GLUT4+/+ mice.
|
The expression levels for GLUT8 mRNA and protein in kidney extracts from 20-wk-old db/db mice (glucose >600 mg/dl) compared with 20-wk-old nondiabetic, heterozygous (db/m) mice were examined. Interestingly, the mRNA expression levels were more than twofold higher (P < 0.01) in hyperglycemic db/db compared with db/m mice (Fig. 4A). Expression levels of the 75-kDa protein band were significantly increased 1.5-fold (P < 0.01) in db/db compared with db/m mice (Fig. 4B). Next, kidney sections from db/db and db/m mice were examined to identify changes in the expression pattern of GLUT8 in specific cell types. A strikingly higher expression of GLUT8 was found in the glomeruli in podocytes of diabetic db/db mice, as confirmed by double staining for the podocyte-specific marker synaptopodin (Fig. 4Cf) compared with wild-type db/m mice (Fig. 4Cc). The tubular expression of GLUT8 appeared to be slightly increased, but these differences could not be captured using fluorescence microscopy (data not shown).
|
Similar studies were conducted to examine whether treatment with high glucose could alter the cellular expression pattern of GLUT8 in podocytes. As noted in other cell types, GLUT8 was consistently expressed throughout the cell body with a perinuclear enrichment. Treatment with glucose or insulin never led to a notable increase in protein expression or cellular redistribution of GLUT8 at the fluorescence microscopic level (data not shown). These data suggest that the expression of GLUT8 mRNA might be regulated by the glucose concentration in vivo. Because the in vitro experiments only led to a transient mRNA induction peak and no cellular redistribution, the functional significance of this induction in the kidney requires further study.
| DISCUSSION |
|---|
|
|
|---|
In this report, we show that GLUT8 mRNA and protein are regulated in total kidney lysates of fasted vs. fed mice, in GLUT4+/+ and GLUT4/ mice, and in a model of type 2 diabetes. With the use of QRT-PCR, it was shown that overnight fasting decreases the level of GLUT8 mRNA >50% in the kidneys of GLUT4+/+ mice. Detection of GLUT8 protein led to the identification of two molecular species, as previously described (9). We detected in the protein lysates a 32-kDa species as described earlier (6, 14) and a higher-molecular-mass band around 72 kDa. Fasting also significantly decreased the expression of the 72-kDa protein band.
GLUT4/ mice, a model of peripheral insulin resistance, are able to maintain normal glycemia despite totally lacking insulin-responsive GLUT4 (16). Altered GLUT4 activity is suggested to be one of the factors responsible for decreased glucose uptake in muscle and adipose tissue in obesity and diabetes. We observed no difference in GLUT8 mRNA and protein levels in GLUT4+/+ vs. GLUT4/ mice in the fed state; however, a significant decrease in GLUT8 mRNA and protein expression levels was observed compared with the fasted state. This effect was not genotype specific and was reproducible on mRNA level in ad libitum fed vs. fasted GLUT4+/+ and in ad libitum fed vs. fasted GLUT4/ mice. We also detected this difference on the protein level in the GLUT4/ mice. These data suggest that the expression of GLUT8 is influenced by serum glucose levels in vivo independently of the presence or absence of the glucose transporter GLUT4.
In uncontrolled diabetes, glucose flux through the proximal tubule is increased and this has been shown to affect expression of glucose transporters in the proximal tubules (GLUT1 and GLUT2) (7). Db/db mice have a recessive mutation in the hypothalamic leptin receptor and develop type 2 diabetes at
8 wk of age. Kidneys are generally enlarged in this mouse strain, and structural glomerular changes (e.g., diffuse glomerulosclerosis, glomerular basement membrane thickening) occur without evidence of tubulointerstitial disease (30). Here, a significant upregulation of GLUT8 mRNA and protein expression in diabetic kidneys of 20-wk-old db/db mice was observed. In contrast to overnight fasting conditions, under the high-glucose conditions of the diabetic milieu in db/db mice, expression of GLUT8 mRNA and 75-kDa protein was significantly (2-fold) increased. This observation emphasizes the direct correlation between GLUT8 expression and serum glucose levels. Additional studies are required to address more precisely whether an increase in GLUT8 expression in one or more region of the kidney has a beneficial or harmful effect on the development of kidney disease.
Immunohistochemistry stainings for GLUT8 on renal cortex sections were performed to determine how fasting and feeding or hyperglycemia altered cellular expression patterns. No convincing difference could be demonstrated in the GLUT8 expression pattern in glomerular or tubular cells in response to fasting and feeding of GLUT4+/+ and GLUT4/ mice (data not shown). Thus a conclusion about the cell types involved in GLUT8 regulation under physiological conditions will require more sensitive techniques (e.g., immunoelectron microscopy). However, on immunofluorescence examination in a direct comparison of diabetic kidneys to nondiabetic kidneys, a strong increase in GLUT8 protein signal in glomerular podocytes was detected (Fig. 4C). Differences in tubular expression of GLUT8 could not be reliably demonstrated using confocal fluorescence microscopy (data not shown). To clarify this point, experiments in isolated glomerular and tubular compartments are necessary and will be a part of further studies on GLUT8 regulation in the kidney.
Experiments examining glucose transporters in vitro are often a difficult task because it is likely that glucose effects on other glucose transporters are masked by counterregulatory effects of GLUT1, the major glucose transporter. The examination of GLUT8 expression in conditionally immortalized murine podocytes (Fig. 1, GI) demonstrated a prominent perinuclear distribution. However, high-glucose treatment led only to a slight and transient induction of GLUT8 mRNA in cultured differentiated podocytes. Challenging cultured podocytes with high glucose, insulin, or glucocorticoids did not lead to a cellular redistribution of GLUT8 at the level of fluorescence microscopy (data not shown). More detailed studies in vitro with isoform-specific knockdown and overexpression experiments are necessary to study possible effects on glucose uptake and intracellular membrane redistribution of GLUT8 in kidney cells after high-glucose treatments. In vivo studies have examined the redistribution of GLUT8 in neurons of the rat hippocampus using an in vivo glucose challenge, and enrichment of GLUT8 in the endoplasmic reticulum was noted (24).
Podocytes constitute an important component of the glomerular filtration barrier and contribute to the stabilization of capillary tuft, basement membrane turnover, and have immunological functions (31). Because podocytes are considered incapable of replication postnatally, the ability of the glomerulus to compensate for podocyte loss may be limited (2, 21). We and others previously demonstrated that podocyte loss is an early mechanism in glomerulosclerosis development in mice (28, 29) and serves as a positive predictor for the progression of diabetic glomerulosclerosis in patients with type 2 diabetes (18). The expression and upregulation of GLUT8 in podocytes could be an indicator of adaptation to cellular stress, but it remains unclear and requires further study to clarify whether these effects have a protective or harmful effect on podocytes. There is evidence for a potential protective effect against apoptosis and involvement in important cellular survival signaling pathways in murine blastocysts (23). Whether the upregulation of GLUT8 in podocytes in diabetic conditions is an indicator of higher cellular stress remains to be tested. More detailed studies of GLUT8 involvement in cellular survival signaling pathways and as an intracellular regulator of glucose concentration to maintain the intracellular milieu in different cellular compartments are necessary for a better understanding of GLUT8 regulation and its potential involvement in the pathogenesis of diabetic nephropathy.
In summary, we present the first studies on the localization and regulation of GLUT8 in the murine kidney under normal, insulin-resistant, and diabetic conditions. GLUT8 expression was found in podocytes and distal tubular epithelial cells in the kidney. GLUT8 mRNA and protein expression levels in the kidney are dependent on the plasma glucose levels in vivo under normal physiological (metabolic) as well as pathological (diabetic) conditions. GLUT8 expression is strongly upregulated in glomerular podocytes in diabetic db/db mice. GLUT8 is expressed in podocytes in culture and shows a perinuclear expression pattern; however, high glucose has no obvious influence on cellular redistribution of GLUT8. Our data suggest an important role for GLUT8 in glucose metabolism in podocytes in normal and pathological conditions. Further functional studies are necessary to elucidate the precise role of GLUT8 as a regulator of intracellular glucose milieu or its involvement in podocyte survival/apoptosis, and both functions have important implications for the treatment of diabetic nephropathy
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Present address of M. Schiffer: Dept. of Medicine/Nephrology, Hannover Medical School, 30625 Hannover, Germany.
| REFERENCES |
|---|
|
|
|---|
and Smad7. J Clin Invest 108: 807816, 2001.[CrossRef][ISI][Medline]
-induced apoptosis. J Biol Chem 279: 3700437012, 2004.This article has been cited by other articles:
![]() |
B. D. Schaan, U. F. Machado, S. Rogers, and D. J. Kelly Glucose transporters in animal models of diabetes and hypertension Am J Physiol Renal Physiol, September 1, 2006; 291(3): F702 - F703. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Gomez, A. Romero, J. Terrado, and J. E Mesonero Differential expression of glucose transporter GLUT8 during mouse spermatogenesis Reproduction, January 1, 2006; 131(1): 63 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Linden, C. L. DeHaan, Y. Zhang, S. Glowacka, A. J. Cox, D. J. Kelly, and S. Rogers Renal expression and localization of the facilitative glucose transporters GLUT1 and GLUT12 in animal models of hypertension and diabetic nephropathy Am J Physiol Renal Physiol, January 1, 2006; 290(1): F205 - F213. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |