AJP - Renal Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 289: F186-F193, 2005. First published March 1, 2005; doi:10.1152/ajprenal.00234.2004
0363-6127/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/1/F186    most recent
00234.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schiffer, M.
Right arrow Articles by Charron, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schiffer, M.
Right arrow Articles by Charron, M. J.

Localization of the GLUT8 glucose transporter in murine kidney and regulation in vivo in nondiabetic and diabetic conditions

Mario Schiffer,1,2 Katalin Susztak,1,2 Mollie Ranalletta,3 Amanda C. Raff,1 Erwin P. Böttinger,1,2 and Maureen J. Charron3

1Division of Nephrology, Department of Medicine, and 3Department of Biochemistry, Albert Einstein College of Medicine, Bronx; and 2Department of Medicine, Mount Sinai Medical Center, New York, New York

Submitted 24 June 2004 ; accepted in final form 23 February 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Kidney disease is a major complication of diabetes, and poor glycemic control is associated with the development of diabetic nephropathy. The precise mechanisms that lead to diabetic kidney disease still remain largely unknown and are under current investigation. Because glucose transporters in the kidney play an important role in the local maintenance of intracellular glucose and plasma glucose homeostasis, the tissue distribution and regulation of glucose transporter GLUT8, a new member of the glucose transporter family with important functions in cellular survival, were examined. To understand the normal regulation of GLUT8 expression in response to metabolic signals, fasting and feeding conditions were studied. Additionally, GLUT8 expression was studied using two different models of insulin resistance, GLUT4–/– and db/db mice. GLUT8 was localized to glomerular podocytes and tubular epithelial cells in the distal portion of the nephron. Expression of GLUT8 in the kidney was influenced by plasma glucose levels in vivo. Podocytes in kidneys of diabetic db/db mice express higher levels of GLUT8 compared with nondiabetic db/m mice. Because podocytes play an important role in glomerulosclerosis development and high levels of glucose have been shown to induce apoptotic cell death in various kidney cells, these data may provide further insight into the pathogenesis of glomerulosclerosis and diabetic nephropathy.

glomerulus; podocytes; diabetes mellitus


THE KIDNEYS PLAY A SIGNIFICANT role in plasma glucose homeostasis. In 24 h the kidneys filter ~180 g of glucose through the proximal tubules which accounts for ~90% of glucose reabsorption. Due to the hydrophilicity of glucose, cellular glucose uptake is accomplished via transporters. Glucose influx occurs through apical Na+-glucose cotransporters that reabsorb glucose and concentrate glucose in tubules (26). Glucose efflux follows through basolateral facilitative glucose transporters (8). The family of hexose transporters (GLUT) proteins consists of several members with different characteristic elements that define their physiological function. GLUT1, GLUT2, GLUT3, GLUT4, and GLUT5 were described as hexose transporters in the kidney (3, 8, 11, 35). GLUT8, a recently identified member of the extended GLUT family has been localized to several tissues including kidney, testis, blastocysts, brain, muscle, and adipocytes and may contribute to maintenance of normal serum glucose (6, 14, 27).

The aims of this study were to localize GLUT8 within normal and diabetic kidney and to study the regulation of its expression in a normal physiological context and in pathological states of insulin resistance. To understand the normal regulation in response to metabolic signals, fasting and feeding conditions were studied. To study pathological states two models of insulin resistance, the GLUT4–/– mouse (16) and the leptin receptor-deficient db/db mouse (30, 32), were examined. GLUT8 mRNA and protein expression levels were regulated by normal metabolic functions during fasting and feeding as well as upregulated under diabetic conditions in vivo. The cells prominently expressing GLUT8 under normoglycemic conditions in the mouse kidney are glomerular podocytes as well as cells of the ascending limbs of Henle and the distal convoluted tubules. Glomerular podocytes are important cells for maintaining the structure of the glomerular tuft and the filtration barrier. High levels of glucose have been shown to induce stress-related markers and collagen in podocytes (15) and tubular cells (1, 34).

Glucose transporters have been described as critical mediators for intracellular glucose utilization and ATP generation and they influence the functions of the cellular survival factor Akt (10, 12, 25). Akt, a serine/threonine kinase, participates in various signaling pathways that prevent apoptosis. We and others have shown that Akt is a critical mediator of podocyte survival (13, 29). Because GLUT8 has already been shown to be required for cell survival in other cells (23) and the loss of podocytes is a key step during the development of glomerulosclerosis and observed in diabetic patients (18, 22), the present findings might be of great relevance for the pathogenesis of diabetic nephropathy. However, the functional role of increased GLUT8 expression in cellular survival of podocytes needs to be studied in more detail.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals

GLUT4+/+ and GLUT4–/– mice. Female GLUT4 +/+ or –/– mice on a C57BL6/CBA background (11–13 wk old) were killed in the fed state or after an overnight fast (12 h) and rapidly dissected. Tissue was frozen in liquid nitrogen and stored at –70°C until processing for mRNA or protein extraction.

Db/db and db/m mice. Male mice of C57BL/6 background were purchased from Jackson Laboratories (Bar Harbor, ME). All mice were housed at the Albert Einstein College of Medicine Animal Facility with free access to food and water. Animals were killed at 20 wk of age with average blood glucose levels of ~600 mg/dl and significant proteinuria. All protocols were approved by the Animal Care and Use Committee of the Albert Einstein College of Medicine in accordance with the Public Health Service Animal Welfare Policy.

Immunofluorescence Labeling In Situ and In Vitro

For in situ detection, antibodies specific for the following proteins were used: monoclonal anti-synaptopodin antibody (20) and affinity-purified rabbit polyclonal anti-11 COOH-terminal amino acids of GLUT8 protein amino acid sequence (LEQITAHFEGR). Antibody generation and affinity purification were described earlier (27).

Mice were perfusion fixed via the left ventricle of the heart using paraformaldehyde (PFA) as described earlier (19). Tissues were then immersion fixed overnight in 10% formaldehyde and paraffin-embedded. Tissue was cut at 4 µM and, after standard deparaffinization, microwaved in citrate buffer (10 mM Na-citrate, pH 6.0). After being blocked with PBS/10% normal goat serum (NGS), tissue was incubated for 1 h with affinity-purified anti-GLUT8 (2 µg/ml). Detection was carried out using a Cy3-labeled anti-rabbit (1:150 in PBS/5% NGS) and a FITC-labeled anti-mouse antibody (1:150 in PBS/5% NGS; both from Jackson ImmunoResearch, West Grove, PA). Nuclear counterstain was carried out using 4', 6-diamidino-2-phenylindole (DAPI; Sigma, St. Louis, MO). Images were captured using a Bio-Rad MR600 confocal fluorescence microscope with a Kanton Electronic Prog/Res/3012 digital video camera and digitally processed using Adobe Photoshop 5.0.2 (Adobe Systems, San Jose, CA).

Quantitative Real-Time PCR

Total RNA was prepared using TRIzol reagent, reverse-transcribed with SuperScript II reverse transcriptase (Life Technologies, Invitrogen), and cDNA was amplified using SYBR-Green PCR Master Mix (Applied Biosystems) and specific primers for murine GLUT8 (5'-primer: ACCAAAGAGTTCAGCAGCGT; 3'-primer: TAGGACACTGAGAGCGCAGA) in an iCycler (Bio-Rad). Normalization across samples was performed using the average of the constitutive gene murine-{beta}-actin (5'-primer: ACCGTGAAAAGATGACCCAG; 3'-primer: AGCCTGGATGGCTACGTACA).

Immunoblot Analysis

Kidneys were homogenized in buffer containing 250 mM sucrose, 1 mM EDTA, 20 mM HEPES, 4 mM phenylmethylsulfonyl fluoride, 20 nM leupeptin, and 20 nM aprotinin. Homogenates were centrifuged for 10 min at 12,000 rpm. The supernatant was transferred to new tubes and centrifuged at 90,000 rpm for 75 min at 4°C. Pellets were resuspended in PBS buffer containing 2% thesit, 4 mM phenylmethylsulfonyl fluoride, 20 nM leupeptin, and 20 nM aprotinin. One hundred micrograms of samples were separated by SDS-PAGE and transferred to Hybond ECL nitrocellulose (Amersham Pharmacia Biotech). Rabbit polyclonal GLUT8 antibodies (1:500) were used to detect GLUT8 in kidney preparations. Enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech) detection was used with laser-scanning densitometry for quantitation.

Cell Culture and Glucose Treatments

Conditionally immortalized podocytes were cultured as previously reported (20). In brief, podocytes were grown on collagen type I (Becton Dickinson, Franklin Lakes, NJ) at 33°C with IFN-{gamma} (10 U/ml, GIBCO BRL Life Technologies, Grand Island, NY) to drive expression of thermosensitive SV40 large T antigen (permissive conditions). To induce differentiation, podocytes were maintained at 37°C without IFN-{gamma} for 14 days. For D-glucose treatments, cells were grown under permissive conditions in RPMI with 10 mM glucose. At 95% confluence, they were serum starved for 48 h in RPMI with 5 mM glucose, 0.2% FBS. After 48 h, the media was changed, and the glucose-treated time points had a final concentration of 30 mM D-glucose. The time course was also done at 37°C. These cells were plated in 10 mM glucose RPMI and grown for 10 days at 37°C. They were then serum starved for 48 h in RPMI with 5 mM glucose, 0.2% FBS. After 48 h, the media was changed to the glucose-treated time points, which had a final concentration of 30 mM D-glucose.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Expression of GLUT8 in Normal Mouse Kidneys

Kidneys from 8-wk-old wild-type C57BL6/CBA mice were harvested after perfusion fixation with PFA and sucrose for 15 min each via the left ventricle of the heart followed by regular immersion fixation and tissue processing. Coimmunostainings using affinity-purified rabbit-anti GLUT8 antibody and mouse monoclonal anti-synaptopodin antibody identified glomerular podocytes as the main glomerular cells expressing GLUT8 (Fig. 1, AC). In general, glomerular staining intensity was much lower than the intensity in the tubular compartments. Longer exposure times led to stronger autofluorescence signals in the proximal tubules that were not quenchable (Fig. 1, DF). In addition, we screened glomerular cells by immunocytochemistry to define cellular distribution of GLUT8. Staining of differentiated, cultured, conditionally immortalized podocytes showed a perinuclear localization of GLUT8 (Fig. 1G), which partially overlapped with the synaptopodin staining (Fig. 1, H and I). In contrast, cultured mesangial cells stained negative for GLUT8 (data not shown). Intense GLUT8 staining was also detected in tubular cells. The staining was mainly basolateral (Fig. 2, A and B) but sometimes appeared in perinuclear regions. Colocalization experiments using GLUT8 with markers for different regions of the nephron, [aquaporin-1, -2, and -3 (AQP1/2/3) and Na-K-2Cl (NKCC)] on serial sections revealed expression of GLUT8 in the ascending loop of Henle (costaining with NKCC, Fig. 2, Ca and Cb, open arrows) and in the collecting ducts [costaining with AQP2 (Fig. 2Cc) and AQP3 (Fig. 2Cd, filled arrows)]. No overlapping staining was detected using a marker for proximal tubuli (AQP1) (data not shown). There were no significant differences in the distribution pattern between distal tubular segments of the nephron in the cortical or medullary portions. The medullary collecting ducts also stained positive for GLUT8 in a basolateral distribution pattern (data not shown). However, cultured inner medullary collecting duct (IMCD) cells showed a similar perinuclear expression pattern of GLUT8 immunostaining with no plasma membrane immunostaining noted (data not shown).



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 1. GLUT8 expression in glomerular cells. A–C: indirect immunofluorescence labeling of perfusion-fixed mouse kidney incubated with affinity-purified rabbit polyclonal GLUT8 antibody reveals expression in glomerular podocytes. GLUT8 is visualized using Cy3-labeled anti-rabbit antibody (red) and colocalizes (C) with the podocyte-specific marker synaptopodin visualized using a FITC-labeled anti-mouse antibody (green; B). Arrows depict double-positive podocytes. Magnification: x60; x80 (inset). DF: peptide competition experiment demonstrates autofluorescence in proximal tubules in the red channel (D), green channel (E), as well as in the overlapping picture (F) but no staining within the glomerular area (within white line). Magnification: x40. GI: indirect immunofluorescence labeling of GLUT8 in differentiated podocytes. GLUT8 (G) is mainly located in the cell body with perinuclear enrichment and only partially overlaps (I) podocyte differentiation marker synaptopodin (H). Magnification: x80.

 


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2. GLUT8 expression in tubular cells. GLUT8 expression is mainly basolateral in vivo in renal tubuloepithelial cells (arrows, A and B). Magnification: x40. Using serial sections, tubular GLUT8 expression could be localized to the thick ascending loop of Henle [open arrows depict overlap of expression with Na-K-2Cl cotransporter (NKCC; Ca and Cb)] and in the distal tubules/collecting ducts [filled arrows depict overlap of expression with aquaporin-2 (AQP2) and aquaporin-3 (AQP3) in Ca and Cc/Cd, respectively]. Magnification: x30.

 
GLUT8 Expression is Regulated by Fasting and Feeding in Wild-Type (GLUT4+/+) and GLUT4 Null (GLUT4–/–) Mice

It was of interest to determine whether the absence of the insulin-responsive glucose transporter GLUT4 or differences in the serum glucose concentration in vivo would influence the expression levels of GLUT8. GLUT4 has been described to be expressed in mesangial and glomerular epithelial cells of the kidney as well as in renal microvessels (17). Quantitative real-time-PCR (QRT-PCR) analysis for GLUT8 mRNA extracted from total kidney from fed and fasted GLUT4+/+ and GLUT4–/– mice was performed. Relative GLUT8 mRNA expression levels tended to be lower but did not reach statistical significance in GLUT4–/– mice compared with GLUT4+/+ mice during the fed state (Fig. 3A). However, after an overnight fast, GLUT8 mRNA was significantly lower in GLUT4–/– compared with GLUT4+/+ mice (P < 0.01) (Fig. 3A). Protein expression analysis using lysates from the same experimental group yielded two immunoreactive bands (32 and 75 kDa). The 32-kDa species of GLUT8 has been previously identified in various tissues by us and other investigators (6, 9, 14). Both protein species (32 and 75 kDa) showed no significant differences in expression levels in fed GLUT4+/+ vs. GLUT4–/– mice [Fig. 3B; immunoblots (top) and densitometry (bottom)]. Similar to the mRNA results, lowering the blood glucose levels by an overnight fast significantly reduced the abundance of the 75-kDa species of GLUT8 in GLUT4–/– compared with GLUT4+/+ mice (P < 0.01) (Fig. 3B). We previously demonstrated in the liver that preincubation of GLUT8 antiserum with the competing peptide at increasing concentrations revealed a higher specificity of the high molecular band (75 kDa) to the immune serum (9). Within both genotypes, fasting significantly downregulated the mRNA expression levels of GLUT8 in kidney (P < 0.001) (Fig. 3C). This regulatory effect on GLUT8 expression in GLUT4–/– mice was also noted in GLUT8 protein expression, which demonstrated a significant reduction of the 75-kDa species in mice in the fasted compared with the fed state (P < 0.001) (Fig. 3D, bottom). These results demonstrate that GLUT8 expression in vivo is reduced with fasting, an effect that is more profound in GLUT4–/– than in GLUT4+/+ mice.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3. GLUT8 mRNA and protein expression in fed and fasted GLUT4+/+ and GLUT4–/– mice. A and C: quantitative real-time PCR shows normalized relative expression of GLUT8 in total kidney mRNA harvested from GLUT4+/+ and GLUT4–/– mice. A: GLUT8 levels are not significantly different in GLUT4+/+ (filled bars; n = 5) and GLUT4–/– mice (hatched bars; n = 5) in the fed state but are significantly lower in GLUT4–/– mice (n = 5) compared with GLUT4+/+ mice (n = 4) after overnight fasting. C: GLUT8 mRNA levels are significantly reduced in fasted (hatched bars) vs. fed (gray bars) GLUT4+/+ and GLUT4–/– animals. *P < 0.01, GLUT4+/+ (n = 5) and GLUT4–/– (n = 5). B and D: representative immunoblots using 50 µg of kidney lysate harvested from fed and fasted GLUT4+/+ (n = 5) and GLUT4–/– mice (n = 4) were incubated with the GLUT8 antiserum that detects 2 specific bands for GLUT8 at 75 and 32 kDa. B: densitometry indicates no difference in protein expression levels at 75 (filled bars) and 32 kDa (open bars) between fed GLUT4+/+ and GLUT4–/– kidneys but a significant difference (*P < 0.01) in protein expression levels of 75-kDa band between fasted GLUT4+/+ (n = 5) and GLUT4–/– kidneys (n = 5). D: densitometry indicates no difference in protein expression levels between fed and fasted GLUT4+/+ kidneys but a significant difference (*P < 0.01) in protein expression levels of 75-kDa band (gray bars) between fed and fasted GLUT4–/– kidneys (GLUT4+/+, n = 5, GLUT4–/–, n = 5).

 
GLUT8 Regulation in Kidneys of db/db Mice: A Mouse Model for Type 2 Diabetes

The expression levels for GLUT8 mRNA and protein in kidney extracts from 20-wk-old db/db mice (glucose >600 mg/dl) compared with 20-wk-old nondiabetic, heterozygous (db/m) mice were examined. Interestingly, the mRNA expression levels were more than twofold higher (P < 0.01) in hyperglycemic db/db compared with db/m mice (Fig. 4A). Expression levels of the 75-kDa protein band were significantly increased 1.5-fold (P < 0.01) in db/db compared with db/m mice (Fig. 4B). Next, kidney sections from db/db and db/m mice were examined to identify changes in the expression pattern of GLUT8 in specific cell types. A strikingly higher expression of GLUT8 was found in the glomeruli in podocytes of diabetic db/db mice, as confirmed by double staining for the podocyte-specific marker synaptopodin (Fig. 4Cf) compared with wild-type db/m mice (Fig. 4Cc). The tubular expression of GLUT8 appeared to be slightly increased, but these differences could not be captured using fluorescence microscopy (data not shown).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 4. GLUT8 mRNA and protein expression in kidneys from db/m and db/db mice. A: quantitative real-time PCR shows normalized relative expression of GLUT8 in total kidney mRNA harvested from 20-wk-old db/m (filled bars, n = 5) and 20-wk-old db/db mice (open bars, n = 5). *P < 0.01. B: Western blots using 50 µg of total kidney lysate harvested from 20-wk-old db/m and db/db mice were incubated with the GLUT8 antiserum that detects 2 specific bands for GLUT8 at 75 and 32 kDa. Densitometry indicates significant difference (*P < 0.01) in protein expression levels of 75-kDa (filled bars) between db/m and db/db kidneys. C: indirect immunofluorescence from renal cortex sections of 20-wk-old db/m (ac) and db/db mice (df). Double labeling with affinity-purified antibody for GLUT8, detected with Cy3-labeled anti-rabbit antibody (red, b and e) and anti-synaptopodin antibody detected with FITC-labeled anti-mouse antibody (green, a and d), shows increased expression of GLUT8 in podocytes in diabetic db/db mice (f) compared with nondiabetic db/m mice (c).

 
Next, studies were performed to examine whether treatment of cultured murine podocytes with high glucose would also induce GLUT8 mRNA expression. To accomplish this, differentiated podocytes were treated with 30 mM D-glucose. After 4 h of glucose exposure, a transient induction peak in GLUT8 mRNA expression levels was observed in differentiated podocytes. Replicate experiments yielded consistent induction peaks but never resulted in a greater than 0.5-fold change in GLUT8 expression (data not shown).

Similar studies were conducted to examine whether treatment with high glucose could alter the cellular expression pattern of GLUT8 in podocytes. As noted in other cell types, GLUT8 was consistently expressed throughout the cell body with a perinuclear enrichment. Treatment with glucose or insulin never led to a notable increase in protein expression or cellular redistribution of GLUT8 at the fluorescence microscopic level (data not shown). These data suggest that the expression of GLUT8 mRNA might be regulated by the glucose concentration in vivo. Because the in vitro experiments only led to a transient mRNA induction peak and no cellular redistribution, the functional significance of this induction in the kidney requires further study.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Expression of several glucose transporters (GLUT1, GLUT2, GLUT3, GLUT4, and GLUT5) have been previously reported in the kidney (5, 7, 11, 17). In the present study, we demonstrate that the new glucose transporter, GLUT8, is expressed in glomerular podocytes and in the distal part of the nephron (ascending limbs of Henle and collecting ducts). Additionally, we demonstrate that GLUT8 expression is regulated by physiological and pathophysiological alterations of blood glucose levels in vivo. Thus far, glucose reabsorption in the kidney was mainly attributed to GLUT1 and GLUT2. The majority of filtered glucose is reabsorbed in the convoluted proximal part of the nephron via the apical sodium glucose transporter-2 (SGLT-2) and basolateral GLUT2 (33). The remaining glucose is reabsorbed in the straight part of the proximal tubule via SGLT-1 apical and basolateral GLUT1 (33). Increased mRNA and protein levels of GLUT1 and GLUT2 were previously reported in streptozotocin-induced diabetes in rats (7). The segmental expression of GLUT8 in the ascending limps of Henle and the collecting duct indicates that GLUT8 might not be involved in the reabsorption of filtered glucose but more so in glucose utilization for oxidative metabolism, as previously postulated for GLUT4 (4, 17).

In this report, we show that GLUT8 mRNA and protein are regulated in total kidney lysates of fasted vs. fed mice, in GLUT4+/+ and GLUT4–/– mice, and in a model of type 2 diabetes. With the use of QRT-PCR, it was shown that overnight fasting decreases the level of GLUT8 mRNA >50% in the kidneys of GLUT4+/+ mice. Detection of GLUT8 protein led to the identification of two molecular species, as previously described (9). We detected in the protein lysates a 32-kDa species as described earlier (6, 14) and a higher-molecular-mass band around 72 kDa. Fasting also significantly decreased the expression of the 72-kDa protein band.

GLUT4–/– mice, a model of peripheral insulin resistance, are able to maintain normal glycemia despite totally lacking insulin-responsive GLUT4 (16). Altered GLUT4 activity is suggested to be one of the factors responsible for decreased glucose uptake in muscle and adipose tissue in obesity and diabetes. We observed no difference in GLUT8 mRNA and protein levels in GLUT4+/+ vs. GLUT4–/– mice in the fed state; however, a significant decrease in GLUT8 mRNA and protein expression levels was observed compared with the fasted state. This effect was not genotype specific and was reproducible on mRNA level in ad libitum fed vs. fasted GLUT4+/+ and in ad libitum fed vs. fasted GLUT4–/– mice. We also detected this difference on the protein level in the GLUT4–/– mice. These data suggest that the expression of GLUT8 is influenced by serum glucose levels in vivo independently of the presence or absence of the glucose transporter GLUT4.

In uncontrolled diabetes, glucose flux through the proximal tubule is increased and this has been shown to affect expression of glucose transporters in the proximal tubules (GLUT1 and GLUT2) (7). Db/db mice have a recessive mutation in the hypothalamic leptin receptor and develop type 2 diabetes at ~8 wk of age. Kidneys are generally enlarged in this mouse strain, and structural glomerular changes (e.g., diffuse glomerulosclerosis, glomerular basement membrane thickening) occur without evidence of tubulointerstitial disease (30). Here, a significant upregulation of GLUT8 mRNA and protein expression in diabetic kidneys of 20-wk-old db/db mice was observed. In contrast to overnight fasting conditions, under the high-glucose conditions of the diabetic milieu in db/db mice, expression of GLUT8 mRNA and 75-kDa protein was significantly (2-fold) increased. This observation emphasizes the direct correlation between GLUT8 expression and serum glucose levels. Additional studies are required to address more precisely whether an increase in GLUT8 expression in one or more region of the kidney has a beneficial or harmful effect on the development of kidney disease.

Immunohistochemistry stainings for GLUT8 on renal cortex sections were performed to determine how fasting and feeding or hyperglycemia altered cellular expression patterns. No convincing difference could be demonstrated in the GLUT8 expression pattern in glomerular or tubular cells in response to fasting and feeding of GLUT4+/+ and GLUT4–/– mice (data not shown). Thus a conclusion about the cell types involved in GLUT8 regulation under physiological conditions will require more sensitive techniques (e.g., immunoelectron microscopy). However, on immunofluorescence examination in a direct comparison of diabetic kidneys to nondiabetic kidneys, a strong increase in GLUT8 protein signal in glomerular podocytes was detected (Fig. 4C). Differences in tubular expression of GLUT8 could not be reliably demonstrated using confocal fluorescence microscopy (data not shown). To clarify this point, experiments in isolated glomerular and tubular compartments are necessary and will be a part of further studies on GLUT8 regulation in the kidney.

Experiments examining glucose transporters in vitro are often a difficult task because it is likely that glucose effects on other glucose transporters are masked by counterregulatory effects of GLUT1, the major glucose transporter. The examination of GLUT8 expression in conditionally immortalized murine podocytes (Fig. 1, GI) demonstrated a prominent perinuclear distribution. However, high-glucose treatment led only to a slight and transient induction of GLUT8 mRNA in cultured differentiated podocytes. Challenging cultured podocytes with high glucose, insulin, or glucocorticoids did not lead to a cellular redistribution of GLUT8 at the level of fluorescence microscopy (data not shown). More detailed studies in vitro with isoform-specific knockdown and overexpression experiments are necessary to study possible effects on glucose uptake and intracellular membrane redistribution of GLUT8 in kidney cells after high-glucose treatments. In vivo studies have examined the redistribution of GLUT8 in neurons of the rat hippocampus using an in vivo glucose challenge, and enrichment of GLUT8 in the endoplasmic reticulum was noted (24).

Podocytes constitute an important component of the glomerular filtration barrier and contribute to the stabilization of capillary tuft, basement membrane turnover, and have immunological functions (31). Because podocytes are considered incapable of replication postnatally, the ability of the glomerulus to compensate for podocyte loss may be limited (2, 21). We and others previously demonstrated that podocyte loss is an early mechanism in glomerulosclerosis development in mice (28, 29) and serves as a positive predictor for the progression of diabetic glomerulosclerosis in patients with type 2 diabetes (18). The expression and upregulation of GLUT8 in podocytes could be an indicator of adaptation to cellular stress, but it remains unclear and requires further study to clarify whether these effects have a protective or harmful effect on podocytes. There is evidence for a potential protective effect against apoptosis and involvement in important cellular survival signaling pathways in murine blastocysts (23). Whether the upregulation of GLUT8 in podocytes in diabetic conditions is an indicator of higher cellular stress remains to be tested. More detailed studies of GLUT8 involvement in cellular survival signaling pathways and as an intracellular regulator of glucose concentration to maintain the intracellular milieu in different cellular compartments are necessary for a better understanding of GLUT8 regulation and its potential involvement in the pathogenesis of diabetic nephropathy.

In summary, we present the first studies on the localization and regulation of GLUT8 in the murine kidney under normal, insulin-resistant, and diabetic conditions. GLUT8 expression was found in podocytes and distal tubular epithelial cells in the kidney. GLUT8 mRNA and protein expression levels in the kidney are dependent on the plasma glucose levels in vivo under normal physiological (metabolic) as well as pathological (diabetic) conditions. GLUT8 expression is strongly upregulated in glomerular podocytes in diabetic db/db mice. GLUT8 is expressed in podocytes in culture and shows a perinuclear expression pattern; however, high glucose has no obvious influence on cellular redistribution of GLUT8. Our data suggest an important role for GLUT8 in glucose metabolism in podocytes in normal and pathological conditions. Further functional studies are necessary to elucidate the precise role of GLUT8 as a regulator of intracellular glucose milieu or its involvement in podocyte survival/apoptosis, and both functions have important implications for the treatment of diabetic nephropathy


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was generously supported by National Institutes of Health Grants DK-47425 and HL-58119 (to M. J. Charron), DK-60995 (to E. P. Böttinger and M. J. Charron), and DK-60043 (to E. P. Böttinger) and by the American Diabetes Association (to M. J. Charron). M. Schiffer was a fellow of the Deutsche Forschungsgemeinschaft (Schi 587/1), Juvenile Diabetes Research Foundation, and National Kidney Foundation. M. Ranalletta was supported by Training Grant 5T32DK07513.


    ACKNOWLEDGMENTS
 
The authors thank Dr. Mark A. Knepper for providing aquaporin antibodies and critically reviewing the manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. J. Charron, Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461 (e-mail: charron{at}aecom.yu.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Present address of M. Schiffer: Dept. of Medicine/Nephrology, Hannover Medical School, 30625 Hannover, Germany.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Allen DA, Harwood S, Varagunam M, Raftery MJ, and Yaqoob MM. High glucose-induced oxidative stress causes apoptosis in proximal tubular epithelial cells and is mediated by multiple caspases. FASEB J 17: 908–910, 2003.[Abstract/Free Full Text]
  2. Barisoni L and Mundel P. Podocyte biology and the emerging understanding of podocyte diseases. Am J Nephrol 23: 353–360, 2003.[CrossRef][ISI][Medline]
  3. Bell GI, Kayano T, Buse JB, Burant CF, Takeda J, Lin D, Fukumoto H, and Seino S. Molecular biology of mammalian glucose transporters. Diabetes Care 13: 198–208, 1990.[Abstract]
  4. Charron MJ, Katz EB, and Zierath JR. Metabolic and molecular consequences of modifying GLUT4 expression in skeletal muscle. Biochem Soc Trans 25: 963–968, 1997.[ISI][Medline]
  5. Chin E, Zhou J, and Bondy C. Anatomical and developmental patterns of facilitative glucose transporter gene expression in the rat kidney. J Clin Invest 91: 1810–1815, 1993.[ISI][Medline]
  6. Doege H, Schurmann A, Bahrenberg G, Brauers A, and Joost HG. GLUT8, a novel member of the sugar transport facilitator family with glucose transport activity. J Biol Chem 275: 16275–16280, 2000.[Abstract/Free Full Text]
  7. Dominguez JH, Camp K, Maianu L, Feister H, and Garvey WT. Molecular adaptations of GLUT1 and GLUT2 in renal proximal tubules of diabetic rats. Am J Physiol Renal Fluid Electrolyte Physiol 266: F283–F290, 1994.[Abstract/Free Full Text]
  8. Gorovits N and Charron MJ. What we know about facilitative glucose transporters—lessons from cultured cells, animal models, and human studies. Biochem Mol Biol Educ 31: 163–172, 2003.[ISI]
  9. Gorovits N, Cui L, Busik JV, Ranalletta M, Hauguel de-Mouzon S, and Charron MJ. Regulation of hepatic GLUT8 expression in normal and diabetic models. Endocrinology 144: 1703–1711, 2003.[Abstract/Free Full Text]
  10. Gottlob K, Majewski N, Kennedy S, Kandel E, Robey RB, and Hay N. Inhibition of early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis and mitochondrial hexokinase. Genes Dev 15: 1406–1418, 2001.[Abstract/Free Full Text]
  11. Heilig C, Zaloga C, Lee M, Zhao X, Riser B, Brosius F, and Cortes P. Immunogold localization of high-affinity glucose transporter isoforms in normal rat kidney. Lab Invest 73: 674–684, 1995.[ISI][Medline]
  12. Hill MM, Clark SF, Tucker DF, Birnbaum MJ, James DE, and Macaulay SL. A role for protein kinase Bbeta/Akt2 in insulin-stimulated GLUT4 translocation in adipocytes. Mol Cell Biol 19: 7771–7781, 1999.[Abstract/Free Full Text]
  13. Huber TB, Hartleben B, Kim J, Schmidts M, Schermer B, Keil A, Egger L, Lecha RL, Borner C, Pavenstadt H, Shaw AS, Walz G, and Benzing T. Nephrin and CD2AP associate with phosphoinositide 3-OH kinase and stimulate AKT-dependent signaling. Mol Cell Biol 23: 4917–4928, 2003.[Abstract/Free Full Text]
  14. Ibberson M, Riederer BM, Uldry M, Guhl B, Roth J, and Thorens B. Immunolocalization of GLUTX1 in the testis and to specific brain areas and vasopressin-containing neurons. Endocrinology 143: 276–284, 2002.[Abstract/Free Full Text]
  15. Iglesias-de la Cruz MC, Ziyadeh FN, Isono M, Kouahou M, Han DC, Kalluri R, Mundel P, and Chen S. Effects of high glucose and TGF-beta1 on the expression of collagen IV and vascular endothelial growth factor in mouse podocytes. Kidney Int 62: 901–913, 2002.[CrossRef][ISI][Medline]
  16. Katz EB, Stenbit AE, Hatton K, DePinho R, and Charron MJ. Cardiac and adipose tissue abnormalities but not diabetes in mice deficient in GLUT4. Nature 377: 151–155, 1995.[CrossRef][Medline]
  17. Marcus RG, England R, Nguyen K, Charron MJ, Briggs JP, and Brosius FC III. Altered renal expression of the insulin-responsive glucose transporter GLUT4 in experimental diabetes mellitus. Am J Physiol Renal Fluid Electrolyte Physiol 267: F816–F824, 1994.[Abstract/Free Full Text]
  18. Meyer TW, Bennett PH, and Nelson RG. Podocyte number predicts long-term urinary albumin excretion in Pima Indians with type II diabetes and microalbuminuria. Diabetologia 42: 1341–1344, 1999.[CrossRef][ISI][Medline]
  19. Mundel P, Gilbert P, and Kriz W. Podocytes in glomerulus of rat kidney express a characteristic 44 KD protein. J Histochem Cytochem 39: 1047–1056, 1991.[Abstract]
  20. Mundel P and Kriz W. Cell culture of podocytes. Exp Nephrol 4: 263–266, 1996.[ISI][Medline]
  21. Mundel P and Shankland SJ. Podocyte biology and response to injury. J Am Soc Nephrol 13: 3005–3015, 2002.[Free Full Text]
  22. Nelson RG, Meyer TW, Myers BD, and Bennett PH. Course of renal disease in Pima Indians with non-insulin-dependent diabetes mellitus. Kidney Int Suppl 63: S45–S48, 1997.[CrossRef][Medline]
  23. Pinto AB, Carayannopoulos MO, Hoehn A, Dowd L, and Moley KH. Glucose transporter 8 expression and translocation are critical for murine blastocyst survival. Biol Reprod 66: 1729–1733, 2002.[Abstract/Free Full Text]
  24. Piroli GG, Grillo CA, Charron MJ, McEwen BS, and Reagan LP. Biphasic effects of stress upon GLUT8 glucose transporter expression and trafficking in the diabetic rat hippocampus. Brain Res 1006: 28–35, 2004.[CrossRef][ISI][Medline]
  25. Plas DR, Talapatra S, Edinger AL, Rathmell JC, and Thompson CB. Akt and Bcl-xL promote growth factor-independent survival through distinct effects on mitochondrial physiology. J Biol Chem 276: 12041–12048, 2001.[Abstract/Free Full Text]
  26. Quamme GA and Freeman HJ. Evidence for a high-affinity sodium-dependent D-glucose transport system in the kidney. Am J Physiol Renal Fluid Electrolyte Physiol 253: F151–F157, 1987.[Abstract/Free Full Text]
  27. Reagan LP, Rosell DR, Alves SE, Hoskin EK, McCall AL, Charron MJ, and McEwen BS. GLUT8 glucose transporter is localized to excitatory and inhibitory neurons in the rat hippocampus. Brain Res 932: 129–134, 2002.[CrossRef][ISI][Medline]
  28. Schiffer M, Bitzer M, Roberts IS, Kopp JB, ten Dijke P, Mundel P, and Böttinger EP. Apoptosis in podocytes induced by TGF-{beta} and Smad7. J Clin Invest 108: 807–816, 2001.[CrossRef][ISI][Medline]
  29. Schiffer M, Mundel P, Shaw AS, and Böttinger EP. A novel role for the adaptor molecule CD2-associated protein in TGF-{beta}-induced apoptosis. J Biol Chem 279: 37004–37012, 2004.[Abstract/Free Full Text]
  30. Sharma K, McCue P, and Dunn SR. Diabetic kidney disease in the db/db mouse. Am J Physiol Renal Physiol 284: F1138–F1144, 2003.[Abstract/Free Full Text]
  31. Somlo S and Mundel P. Getting a foothold in nephrotic syndrome. Nat Genet 24: 333–335, 2000.[CrossRef][ISI][Medline]
  32. Susztak K, Sharma K, Schiffer M, McCue P, Ciccone E, and Böttinger EP. Genomic strategies for diabetic nephropathy. J Am Soc Nephrol 14: S271–S278, 2003.[Abstract/Free Full Text]
  33. Thorens B, Lodish HF, and Brown D. Differential localization of two glucose transporter isoforms in rat kidney. Am J Physiol Cell Physiol 259: C286–C294, 1990.[Abstract/Free Full Text]
  34. Verzola D, Bertolotto MB, Villaggio B, Ottonello L, Dallegri F, Salvatore F, Berruti V, Gandolfo MT, Garibotto G, and Deferrari G. Oxidative stress mediates apoptotic changes induced by hyperglycemia in human tubular kidney cells. J Am Soc Nephrol 15, Suppl 1: S85–S87, 2004.
  35. Zhao FQ, Glimm DR, and Kennelly JJ. Distribution of mammalian facilitative glucose transporter messenger RNA in bovine tissues. Int J Biochem 25: 1897–1903, 1993.[CrossRef][ISI][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
B. D. Schaan, U. F. Machado, S. Rogers, and D. J. Kelly
Glucose transporters in animal models of diabetes and hypertension
Am J Physiol Renal Physiol, September 1, 2006; 291(3): F702 - F703.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
O. Gomez, A. Romero, J. Terrado, and J. E Mesonero
Differential expression of glucose transporter GLUT8 during mouse spermatogenesis
Reproduction, January 1, 2006; 131(1): 63 - 70.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K. C. Linden, C. L. DeHaan, Y. Zhang, S. Glowacka, A. J. Cox, D. J. Kelly, and S. Rogers
Renal expression and localization of the facilitative glucose transporters GLUT1 and GLUT12 in animal models of hypertension and diabetic nephropathy
Am J Physiol Renal Physiol, January 1, 2006; 290(1): F205 - F213.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/1/F186    most recent
00234.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schiffer, M.
Right arrow Articles by Charron, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schiffer, M.
Right arrow Articles by Charron, M. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.