|
|
||||||||
EDITORIAL FOCUS
1Division of Nephrology, Department of Medicine, University of Utah, and Veterans Affairs Medical Center, and Departments of 2Physiology and 3Pathology, University of Utah, Salt Lake City, Utah; and 4Bone Marrow Transplantation Center, Hamburg, Germany
Submitted 11 January 2005 ; accepted in final form 8 February 2005
| ABSTRACT |
|---|
|
|
|---|
106/animal) either immediately or 24 h after renal ischemia resulted in significantly improved renal function, higher proliferative and lower apoptotic indexes, as well as lower renal injury and unchanged leukocyte infiltration scores. Such renoprotection was not obtained with syngeneic fibroblasts. Using in vivo two-photon laser confocal microscopy, fluorescence-labeled MSC were detected early after injection in glomeruli, and low numbers attached at microvasculature sites. However, within 3 days of administration, none of the administered MSC had differentiated into a tubular or endothelial cell phenotype. At 24 h after injury, expression of proinflammatory cytokines IL-1
, TNF-
, IFN-
, and inducible nitric oxide synthase was significantly reduced and that of anti-inflammatory IL-10 and bFGF, TGF-
, and Bcl-2 was highly upregulated in treated kidneys. We conclude that the early, highly significant renoprotection obtained with MSC is of considerable therapeutic promise for the cell-based management of clinical ARF. The beneficial effects of MSC are primarily mediated via complex paracrine actions and not by their differentiation into target cells, which, as such, appears to be a more protracted response that may become important in late-stage organ repair. cell therapy; cytokines; growth factors; fibroblasts; apoptosis; mitogenesis
Recently, the importance of disordered vascular function and inflammation in the overall pathophysiology of ARF has been increasingly recognized (4, 19). From this would follow that new therapies effectively targeting vascular dysfunction and inflammation should improve the outcome in ARF by providing more favorable intrarenal conditions for tubular self-regeneration and thus kidney repair.
Another therapeutic principle that might at least theoretically improve recovery in ARF is the administration of viable tubular and vascular endothelial cells or their respective precursors, cells that would be capable of homing to the injured kidney, integrate, and physically replace cells that have been destroyed in ARF.
We propose that treatment with pluripotent, adult stem cells offers, compared with pharmacological interventions, a broad therapeutic spectrum through which vascular, inflammatory, and other manifestations of ischemic ARF can be simultaneously targeted. This reasoning is based on the fact that administered stem cells are functionally intact and readily reach intrarenal sites of injury via the circulation. There, they can react physiologically to different local stimuli, for example, hypoxia or ischemia, in turn leading to the release of vasoactive factors, growth factors, immunomodulatory cytokines, and chemokines. To further potentiate the secretion of renoprotective factors by stem cells, we genetically engineered cells to express erythropoietin (38).
In clinical practice, bone marrow-derived stem cells have been most extensively employed in bone marrow transplantation. Their use is facilitated by their ready availability, ease of harvest, and suitability for effective ex vivo enrichment. The bone marrow contains two stem cell types, hematopoietic stem cells (HSC), giving rise to all differentiated blood cells, and mesenchymal stem cells or marrow stromal cells (MSC), which support hematopoiesis in the stem cell niche and differentiate into mesenchymal cells such as chondrocytes, osteocytes, and adipocytes (28).
Stem cells are undifferentiated cells that undergo both self-renewal and differentiation into one or more cell types (37). They can be categorized cytologically, functionally, based on their expression of cell surface markers, transcription factors, and cytokines; however, stem cells are generally rare and difficult to detect.
It has been hypothesized that under physiological steady-state conditions, organ intrinsic stem cells replenish cells lost by normal turnover, and circulating or mobilized stem cells function as back-up units in case the organ intrinsic system is unable to adequately support tissue repair; however, both systems can be overwhelmed if tissue damage is more severe, leading to extensive and often permanent organ damage (15). Secretion of regulatory chemokines and cytokines has been recently reported to mediate homing to and transdifferentiation of bone marrow-derived cells in injured organs. This was concluded since bone marrow cells did not contribute to tissue regeneration in the absence of injury (35). Although transdifferentiation of adult stem cells is a recognized phenomenon, controversy still exists regarding its actual existence and frequency (36). In addition, it is also apparent that the effectiveness of stem cell therapy does not exclusively depend on this phenomenon (22). Despite the recent negative reports about transdifferentiation (3, 16, 36), clinical trials with bone marrow-derived cell populations have been published and in part proven effective in the treatment of myocardial infarction (31, 33, 39). Finally, in some injury models fusion of transplanted cells with resident cells was detected instead of actual transdifferentiation (34).
Treatment of human myocardial infarction with stem cells (14, 39) showed that HSC from the bone marrow transdifferentiate into cardiomyocytes and improve organ function as well as survival in a mouse model of myocardial infarction (25). However, these results could not be reproduced by other groups (3, 21). However, such HSC-based protocols have been tested in patients and a modest improvement of cardiac function has been observed, whereas specific mediator mechanisms remain poorly understood (39). Augmented intramyocardial angiogenesis and paracrine effects elicited by administered stem cells are organ-protective mechanisms that are currently favored over transdifferentiation of stem cells into myocardiocytes (18).
Based on this background, we hypothesized that the already recognized paracrine capabilities of bone marrow-derived mesenchymal stem cells, such as VEGF and HGF secretion (23), and their ability to differentiate into cells of endothelial phenotype (26), may hold particular promise in the treatment of ARF as has been shown by other groups with different cell types (2, 5). In this fashion, the intrarenal delivery of these and other factors and cytokines via administered MSC might prove a potent new technique of targeting vascular dysfunction. This, if found effective, would be expected to reduce the extent of secondary tubular injury and facilitate repair of the ischemically injured kidney (19, 30).
The aim of the present study was, therefore, to test the therapeutic potential of MSC administered either immediately or at 24 h after reflow in a rat model of I/R ARF. In addition, we thought to identify mediator mechanisms that underlie the renoprotective actions of MSC, as well as assess whether infused MSC elicit changes in the renal expression of relevant growth factors, cytokines, and other genes and whether they transdifferentiate into renal cells.
| METHODS |
|---|
|
|
|---|
Cell labeling for in vivo tracking. Before infusion into control and ARF rats, attached MSC were fluorescence labeled by incubation with 10 µM carboxy-fluorescein diacetate (CFDA; Vybrant cell tracer kit, Molecular Probes, Eugene, OR) in serum-free tissue culture medium (SFM) for 30 min. After trypsinization, labeling was confirmed by fluorescence microscopy and cells were kept on ice in SFM until infusion.
Animals, induction of I/R ARF, and cell infusions. All procedures involving animals were approved by the respective Institutional Animal Care and Use Committees of the University of Utah, Veterans Affairs Medical Center (Salt Lake City, UT), Indiana University (Indianapolis, IN), and the University of Hamburg (Hamburg, Germany). Animals were housed at a constant temperature and humidity, with a 12:12-h light-dark cycle, and had unrestricted access to a standard diet and tap water. For all experiments, groups (n = 6/group) of adult male Sprague-Dawley (SD) and Fisher 344 (F344) rats weighing 200300 g were used (Charles River, Wilmington, MA).
I/R ARF was induced in isoflurane-anesthetized animals, and rectal temperature was maintained at 37°C. After a midabdominal laparatomy, kidneys were exposed and renal pedicles were clamped with atraumatic vascular clamps for 40 min. While clamps were applied, the left carotid artery was cannulated with PE-50 tubing for intra-aortic cell delivery immediately after reflow. The vehicle in control rats with ARF was infused by the same route.
Administration of cells or vehicle was performed either immediately or 24 h after reflow or surgery. Immediately after visual confirmation of reflow,
106 labeled MSC/animal in 0.2 ml SFM were given via the left carotid artery. Control ARF animals were treated identically but infused with 0.2 ml SFM instead of cells. A separate control group of F344 rats with ARF was infused with
106 syngeneic fibroblasts in 0.2 ml SFM, using an identical protocol. Delayed infusions (
106 labeled MSC in 0.2 ml SFM or 0.2 ml SFM as vehicle) were conducted in isoflurane-anesthetized animals 24 h after reflow via the left carotid artery. Incisions were closed with 4-0 silk, and animals were allowed to recover.
Quantification of cell numbers. CFDA-labeled green fluorescing cells were examined and quantified in kidneys at 2, 24, and 72 h after ARF and cell or vehicle infusions. Nuclei were stained with either Hoechst 33342 or propidium iodide, and nuclei were counted in at least three high-power fields (HPF) per section based on a calibrated confocal micrometer measurement bar. After this, total cell numbers of the studied tissue sections were calculated based on numbers of nuclei and surface area of the section.
Real-time PCR. RNA for real-time PCR was extracted with an RNeasy kit (Qiagen, Valencia, CA), including a DNase-digestion step to exclude contaminating DNA. Reverse transcription was performed using Moloney Murine Leukemia Virus Reverse Transcriptase (Invitrogen, Carlsbad, CA) for 60 min at 42°C.
Real-time PCR with relative quantification of target gene copy numbers in relation to
-actin transcripts was carried out using the following primers:
: 5'ggacccaagcaccttctttt,3'agacagcacgaggcattttt
: 5'ctcgagtgacaagcccgtag,3'ccttgaagagaacctgggagtag
: 5'tctggaggaactggcaaaag,3'gtgctggatctgtgggttg
: 5'cacttcaacaagtgcccaga,3'agcagtggatcagcacacag
The Smart-Cycler system (Cepheid, Sunnyvale, CA) was used to monitor real-time PCR amplification using SYBR Green I (Molecular Probes), a nonspecific, double-strand DNA intercalating fluorescent dye. All reactions were carried out in a total volume of 25 µl with the Takara Ex Taq R-PCR Version (Takara Bio, Shiga, Japan). Reaction conditions were the following: hot start for 120 s at 95°C, melting at 95°C for 10 s, annealing at 63°C for 12 s, and amplification at 72°C for 15 s. Reading of the fluorescent product was set to be 2°C below the specific melting peak of the product to eliminate reading of nonspecific products and primer dimers. This was carried out at 85°C for 6 s after each cycle for the above genes. Optimal annealing and melting temperatures were determined for the primers before the running of the samples. Melting temperature analysis for the reaction mix revealed a characteristic melting profile, with a single sharp peak at the typical melting temperature for a given product. Specificity of the product was determined by generation of a melting curve, and gels were run to control for the formation of unspecific bands. Samples were run in duplicate, and the average crossing point (CP) value was used for calculations. The CP, which is the cycle at which the amount of amplified gene of interest reached a threshold above background fluorescence, was determined to quantitate initial starting copy numbers. The relative quantity of mRNA expression was calculated with the comparative CP method using the following formula (27)
![]() |
is the difference of a sample vs. control.
The relative quantitation value of a target gene, normalized to
-actin as the internal control gene, is expressed as a number, which indicates the relative expression compared with that gene. To avoid the possibility of amplifying contaminating DNA and unspecific amplification, the following precautions were taken: 1) a DNase-digestion step was included in the RNA-extraction protocol, 2) some primers were designed to include an intron sequence inside the cDNA to be amplified, 3) reactions were performed with appropriate negative controls (template-free controls), 4) a uniform amplification of the products was rechecked by analyzing the melting curves of the amplified products (dissociation graphs), and 5) gel electrophoresis was performed to confirm both the correct size of the amplification products and the absence of unspecific bands, respectively.
Y chromosome PCR. DNA extraction was carried out with the Qiagen DNeasy tissue kit. Amplification was performed as above with DNA instead of cDNA. Sensitivity of the Y-chromosome PCR for detection of male cells in a female background was determined by adding initially 104 male MSC to 106 female leukocytes (102 dilution), followed by stepwise 10-fold dilutions of male MSC down to a number of 1 in 106 female leukocytes.
Homing studies. In vivo homing studies of administered MSC were performed at the O'Brien Center, Division of Nephrology (directed by Dr. Bruce Molitoris, University of Indiana). Adult male SD rats, weighing 200300 g, were anesthetized with isoflurane, and ischemic ARF was induced as described above. For delivery of cells, a PE-50 line was inserted into the femoral artery, and its tip was advanced to position in the suprarenal aorta. MSC were labeled either with CFDA as described above or by 24-h incubation with rhodamine-dextran [molecular weight (MW) 10,000, Molecular Probes]. For in vivo microscopy, anesthesia was switched to pentobarbital sodium (50 mg/kg), and the left kidney was exteriorized through a flank incision and placed in a petri dish filled with normal saline. The renal vasculature was either visualized by infusion of large-MW dextran-rhodamine (MW 500,000), in the case of CFDA-labeled MSC, or FITC-labeled albumin, when rhodamine-dextran-labeled MSC were infused. A Bio-Rad MRC-1024 two-photon laser-scanning microscope (Bio-Rad, Hercules, CA) mounted on a Nikon Diaphot inverted stage platform (Fryer, Huntley, IL) with a Ti:sapphire laser (Spectra-Physics, Franklin, MA) was used for in vivo observations. Acquisition variables and placement of the rat on the microscope stage were performed as previously described (12). All images were collected with the use of an x60 water-immersion objective with a numerical aperture of 1.2. A wavelength of 800 nm was used to excite the mixture of fluorescent probes.
For cell-homing studies at 2 and 24 h after infusion of MSC, animals were killed at these time points and 8-µm snap-frozen kidney sections (OCT, Tissue Tek, EMS, Hatfield, PA) were analyzed by fluorescence microscopy on a deconvolution microscope.
Histology and injury scores. We stained coronal sections of fixed kidneys with hematoxylin and eosin and scored the degree of tubular injury by a previously reported approach (6) in random cortical fields using a graticulated grid with 25 squares with an x20 objective. One member of our team examined 100 intersections between tubular profiles and the grid for each kidney. A score for each tubular cross section per intersection was assigned as follows: 0 = normal histology; 1 = tubular cell swelling, loss of brush border, nuclear condensation (apoptosis), up to one-third of tubular cross section showing nuclear loss (necrosis); 2 = same as for score 1, except for greater than one-third and less than two-thirds of nuclear loss per tubular cross section (necrosis); and 3 = greater than two-thirds of tubular cross section shows nuclear loss (necrosis). The total score per kidney was calculated by addition of all 100 scores with a maximum possible injury score of 300. Leukocyte infiltration per millimeter was scored as reported before (32).
Immunohistochemistry. Paraffin sections of kidneys were deparaffinized with xylene and rehydrated in an alcohol series and water. After incubation with a peroxidase-blocking reagent, slides were labeled with a 1:1,000 dilution of a primary anti-fluorescein/Oregon green antibody (Molecular Probes) for 60 min, and CFDA-positive cells were visualized with the EnVision system (DAKO, Carpentaria, CA). For proliferating cell nuclear antigen (PCNA) staining, a monoclonal mouse anti-rat PC12 antibody was used in a ready-to-use formulation (DAKO). Scoring for PCNA-positive cells, a marker of mitogenesis, was carried out by counting the number of positive nuclei in four randomly chosen sections of kidney cortex and outer medulla using x20 magnification. Data from all fields and all kidneys were pooled to obtain PCNA scores. Apoptotic scores were obtained with a terminal transferase-mediated dUTP nick-end labeling (TUNEL) assay using an In Situ Cell Death Detection Kit (Roche, Mannheim, Germany). Accordingly, kidney sections were deparaffinized, rehydrated, and digested with protein K and labeled with TUNEL reaction mixture for 60 min at 37°C. Sections were screened for positive nuclei under a fluorescence microscope, and 10 random sections in the cortex and outer medullary were counted for every kidney under x40 magnification. Data from all fields and all kidneys were pooled to obtain apoptotic scores.
Fluorescence in situ hybridization. Frozen kidney sections (4 µm) were hybridized with a Starfish rat Y chromosome probe (Cambio, Cambridge, UK). Slides were fixed with methanol:acetic acid (3:1) and dehydrated by serial ethanol washings. After denaturation at 70°C, slides were incubated with the denatured probe at 37°C overnight, and posthybridization three rinses with PBS were performed at 37°C and nuclei were counterstained with 4',6'-diamidino-2-phenylindole.
Cytokine arrays. Decapsulated kidney tissues were minced, sonicated, lysed with RIPA buffer (1x PBS, 1% Nonidet P-40, 0.5% sodium deoxylate, 0.1% SDS, and protease inhibitor) for cell and tissue lysis, and protein was quantified by BCA protein assay (Pierce, Rockford, IL). The cytokine arrays were performed by RayBiotech according to their protocols for the RayBio Rat Cytokine Antibody Array I (R0608001A, RayBiotech, Norcross, GA). Relative intensities of obtained spots were measured by densitometry and corrected by background subtraction. Results of duplicate readings were averaged.
Statistical analysis. Data are expressed as means ± SD. Primary data collection utilized Excel (Microsoft, Redmond, WA), and statistical analyses were carried out using Prism (GraphPad, San Diego, CA). ANOVA and t-tests were used to assess differences between data means as appropriate. A P value of <0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
|
|
|
100 µm, infused, free-flowing cells were detected in the renal microvasculature in ARF and control animals immediately after administration, and occasional cells remained firmly attached in an intravascular, subcapsular, and occasional peritubular capillary location over the 30 min of observation. In addition, a rare superficial glomerulus was found to contain one or more MSC (Fig. 4).
|
|
Y chromosome fluorescence in situ hybridization and PCR.
Because CFDA and dextran are nongenetic markers, and because there is a small possibility of losing such a marker, we sought to track administered MSC with a stable genetic marker. Therefore, female rats with ARF were infused with male CFDA-labeled cells, and the cells were visualized, in addition, with Y chromosome fluorescence in situ hybridization (FISH). FISH for the Y chromosome had a sensitivity of
65% (Fig. 6), corresponding to published reports (29). We did not detect any Y chromosome- and CFDA-positive cells at 24 h in the kidneys of MSC-infused animals, thereby corroborating the negative results above.
|
|
, TNF-
, and IFN-
, as well as inducible NOS (iNOS), whereas the anti-inflammatory cytokine IL-10 was robustly expressed in MSC-treated and not in vehicle-infused animals (Fig. 8A). The renal expression of VEGF-A, - B, - C, and -D, EGF, HB-EGF. IGF-I, and BMP-7 was essentially comparable in MSC- and vehicle-treated animals. On the other hand, MSC-treated animals showed a 10-fold reduction in HGF expression, whereas that of bFGF increased 2.8-fold and that of TGF-
8-fold (Fig. 8B). The antiapoptotic Bcl-2 gene was only expressed in MSC-treated but not in control animals, whereas there was no significant difference in Bcl-XL, Bcl-XS, NF-
B, and endothelial NOS expression between MSC- and vehicle-treated animals.
|
|
and IL-1
levels were lower in treated animals corresponding with PCR results, whereas levels of IL-10 were similar, and those of TNF-
and VEGF were higher in MSC- compared with vehicle-treated ARF animals (Fig. 10A). However, due to the large variance in the duplicate densitometric data, none of the averaged results comparing MSC- and vehicle-treated animals reached statistical significance. In addition, MSC treatment caused lower intrarenal protein levels of GM-CSF, IL-1
, leptin, MIP-3, and NGF-
, whereas a series of other cytokine levels remained unchanged (Fig. 10B). The lack of correlation between the results obtained by PCR and cytokine array for IL-10, TNF-
, and VEGF is likely due to different degradation times for the respective mRNAs and their translation products, respectively.
|
| DISCUSSION |
|---|
|
|
|---|
, TNF-
, and IFN-
, as well as iNOS, and upregulation of anti-inflammatory and organ-protective IL-10 (8), as well as bFGF, TGF-
, and Bcl-2. The lack of renoprotection obtained by infused fibroblasts may be due, at least in part, to the fact that MSC exhibit a comparatively higher expression of VEGF, HGF, and IGF-I, therefore suggesting that the combined delivery, by MSC, of these factors appears to result in superior renoprotection than that obtained with the growth factors that are more highly expressed by fibroblasts (EGF, HB-EGF, BMP-7, bFGF). The current studies were conducted in rodents with I/R ARF, an extensively investigated, albeit imperfect model of the most common and the most treatment-resistant type of clinical ARF (17). In this model, when the injury is of modest intensity, the decrease in renal function immediately following I/R injury is maximal at 2448 h, followed within several days by almost complete normalization of renal function. Morigi et al. (20), using rodents with cisplatinum-induced ARF, showed that administration of MSC improved renal function, and MSC appeared to directly contribute to the reconstitution of renal epithelium by transdifferentiation. However, these investigators did not demonstrate that the observed transdifferentiation of MSC is the actual mechanism of renoprotection, and they presented no data regarding the actual numbers of donor cells that undertook the tubular repair.
There has been much debate about transdifferentiation of bone marrow-derived cells and a number of contradicting reports have been published showing either "transdifferentiation" or not (3, 25). It may be important, in this context, that the kinetics of the cisplatinum model are fundamentally different from those of the I/R model. Specifically, in this nephrotoxic model maximal injury occurs on day 7 after cisplatinum application, which, at least in theory, provides the earlier infused MSC significantly more time to transdifferentiate into renal target cells. In contrast, we obtained significant functional improvement in severe ARF as early as 24 h following reflow and infusion of MSC, i.e., at a time point that would be too early, as we show here, for tubular replacement to occur via transdifferentiation of administered stem cells.
Intravenous or intra-arterial infusion of MSC results in entrapment of administered cells in capillary beds of most organs, but most prominently in the lung, and also in the liver as late as 48 h postinfusion (13). We were, however, unable to reproduce the latter observation. This entrapment of MSC likely occurs because of the relatively large size of these cells, averaging
2030 µm in diameter. Overall, in normal animals, administered MSC have not been found to remain detectable beyond a few days in organs other than the bone marrow (9).
Having documented in the present study the rather early therapeutic efficiency of MSC in ARF, which makes direct, physical replacement of damaged resident cells by donor cells unlikely, we next investigated alternative, differentiation-independent mediator mechanisms that could explain the renoprotective effects of these cells. MSC are known to have incompletely understood immunomodulatory properties that result in the inhibition or modulation of the T cell response, and they secrete various growth factors and cytokines (1, 7). T cell responses are likely involved in the pathogenesis of ARF, and their modulation by MSC might be a possible mechanism of protection, i.e., analogous to the observations made by Yokoto et al. (40). We observed significant differences in cytokine and growth factor expression in MSC-treated kidneys, likely the direct or secondary result, via primary improvement of kidney injury, of this therapy. Expression of proinflammatory cytokines IL-1
, TNF-
, IFN-
, as well as iNOS, was reduced, whereas anti-inflammatory IL-10 was upregulated. Expression of known renoprotective growth factors bFGF, TGF-
, and antiapoptotic Bcl-2 was increased in MSC-treated kidneys, whereas HGF, highly expressed in MSC, was surprisingly downregulated. Infused fibroblasts, as we show, express high levels of a different spectrum of known renoprotective growth factors, such as EGF, HB-EGF, BMP-7, and bFGF. However, they lacked therapeutic efficiency in ARF, possible due to these differences in the types and mix of growth factors expressed by MSC and fibroblasts, respectively. As already pointed out above, an additional explanation for the therapeutic superiority of MSC may be their immunomodulatory capacity that fibroblasts lack (1). Finally, in contrast to whole kidney changes, relatively little is known to date about microenvironmental modifications in growth factor and cytokine expression and their secretion by sublethally injured or stressed resident cells in I/R ARF. In addition, it is furthermore likely that milieu changes at sites of injury induce the synthesis and secretion of additional factors that are currently unknown or not readily assayable.
The tracking of administered MSC in the kidney is critical to the interpretation of our experimental results. It has been argued that genetic markers like the Y chromosome or eGFP are superior to nongenetic tracking methods. However, the utility of eGFP as a cell marker is also limited because the kidney possesses intensive autofluorescence, which makes it difficult to detect eGFP-positive MSC unless confocal microscopy is used.
-Gal, another cell marker, has been shown to yield false positive results when pH is not strictly controlled during histological processing (11). In the present studies, we avoided inadequate sensitivity of a single-cell tracking method by utilizing both genetic and nongenetic cell-tagging techniques. We found that there was complete agreement in the data obtained with either approach, indicating that combining different labeling techniques and molecular assays achieves maximal sensitivity and highest possible specificity for tracking of MSC in the kidney. Although we did not detect transdifferentiation events during the 72-h period of observation, it is possible that cell transdifferentiation and integration may be important at later stages of organ repair. Additional studies are needed to further validate the individual or combined importance of paracrine and transdifferentiation mechanisms in ARF.
The primary advantage of MSC for utilization in cell therapy is the ease with which they can be harvested from the bone marrow, isolated by plastic adherence, expanded in culture, genetically engineered, differentiated, and handled in vitro (28). However, in vitro manipulations may also alter or influence their natural phenotype, leading to different, as yet undefined activities and responses. To control for this possibility, we regularly tested the canonical ability of cultured MSC to undergo lipogenic and osteogenic differentiation; i.e., we confirmed with this approach that subsequently administered cells had retained the characteristics of MSC.
There are currently no reports showing adverse effects of adult stem cells used in cell therapy. Although this suggests a great advantage over embryonic stem cells, which have been documented to give rise to teratomas, long-term studies will have to be conducted to prove that no adverse effects occur after in vivo administration of adult MSC.
In summary, our present studies clearly demonstrate that administration of MSC to animals with I/R ARF is highly renoprotective and that these beneficial effects are predominantly mediated, as our data suggest, by paracrine rather than transdifferentiation-dependent mechanisms. Our observations are furthermore compatible with the notion that the potentially unique mix of growth factors elaborated by MSC may explain their significant renoprotective activity that is not obtained with fibroblasts, cells that express a different growth factor spectrum. The collective and individual renoprotective capacity of cytokines temporarily released by MSC is currently undergoing investigation. It is surprising that the very transient presence of MSC in the injured kidney, as we document, is sufficient to greatly ameliorate the course of I/R ARF. Protective and repair mechanisms that are activated by MSC resemble those that can be induced by individual growth factors in experimental ARF. We documented antiapoptotic, mitogenic, and anti-inflammatory responses, evidenced by both improved tissue scores and changes in the expression of mechanism-specific genes. Whether the renoprotective and gene-modulating effects of MSC are primary actions that are humorally elicited by these cells or whether they result from the improvement of tissue injury by as yet unknown factors released by them remains to be determined. Future studies will also have to define the possible contribution to organ protection made by the immunomodulatory effects of MSC.
In conclusion, we believe that successful treatment of I/R ARF with MSC demonstrated herein holds substantial promise for the development of novel, MSC-based interventions that can improve the treatment of severe, and still largely therapy-resistant, clinical ARF that results from I/R injury. Pluripotent MSC, because of their versatility and the ease with which they can be harvested from the bone marrow, culture expanded, and engineered, appear to be a particularly well-suited stem cell type for these clinical indications.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. H. Bahlmann and D. Fliser The plasticity of progenitor cells--why is it of interest to the nephrologists? Nephrol. Dial. Transplant., July 1, 2009; 24(7): 2018 - 2020. [Full Text] [PDF] |
||||
![]() |
A. Shabbir, D. Zisa, G. Suzuki, and T. Lee Heart failure therapy mediated by the trophic activities of bone marrow mesenchymal stem cells: a noninvasive therapeutic regimen Am J Physiol Heart Circ Physiol, June 1, 2009; 296(6): H1888 - H1897. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. V. Bonventre Microvesicles from Mesenchymal Stromal Cells Protect against Acute Kidney Injury J. Am. Soc. Nephrol., May 1, 2009; 20(5): 927 - 928. [Full Text] [PDF] |
||||
![]() |
Y. Huang, P. Johnston, B. Zhang, A. Zakari, T. Chowdhry, R. R. Smith, E. Marban, H. Rabb, and K. L. Womer Kidney-Derived Stromal Cells Modulate Dendritic and T Cell Responses J. Am. Soc. Nephrol., April 1, 2009; 20(4): 831 - 841. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. N. Zeller, Y. Wang, T. A. Markel, B. Weil, A. Abarbanell, J. L. Herrmann, M. L. Kelly, A. Coffey, and D. R. Meldrum Role of tumor necrosis factor receptor 1 in sex differences of stem cell mediated cardioprotection. Ann. Thorac. Surg., March 1, 2009; 87(3): 812 - 819. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Markel, Y. Wang, J. L. Herrmann, P. R. Crisostomo, M. Wang, N. M. Novotny, C. M. Herring, J. Tan, T. Lahm, and D. R. Meldrum VEGF is critical for stem cell-mediated cardioprotection and a crucial paracrine factor for defining the age threshold in adult and neonatal stem cell function Am J Physiol Heart Circ Physiol, December 1, 2008; 295(6): H2308 - H2314. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, P. R. Crisostomo, M. Wang, T. A. Markel, N. M. Novotny, and D. R. Meldrum TGF-{alpha} increases human mesenchymal stem cell-secreted VEGF by MEK- and PI3-K- but not JNK- or ERK-dependent mechanisms Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1115 - R1123. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bi, J. Guo, A. Marlier, S. R. Lin, and L. G. Cantley Erythropoietin expands a stromal cell population that can mediate renoprotection Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1017 - F1022. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Liebler, C. Lutzko, A. Banfalvi, D. Senadheera, N. Aghamohammadi, E. D. Crandall, and Z. Borok Retention of human bone marrow-derived cells in murine lungs following bleomycin-induced lung injury Am J Physiol Lung Cell Mol Physiol, August 1, 2008; 295(2): L285 - L292. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Crowley, C. W. Frey, S. K. Gould, R. Griffiths, P. Ruiz, J. L. Burchette, D. N. Howell, N. Makhanova, M. Yan, H.-S. Kim, et al. Stimulation of lymphocyte responses by angiotensin II promotes kidney injury in hypertension Am J Physiol Renal Physiol, August 1, 2008; 295(2): F515 - F524. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Morigi, M. Introna, B. Imberti, D. Corna, M. Abbate, C. Rota, D. Rottoli, A. Benigni, N. Perico, C. Zoja, et al. Human Bone Marrow Mesenchymal Stem Cells Accelerate Recovery of Acute Renal Injury and Prolong Survival in Mice Stem Cells, August 1, 2008; 26(8): 2075 - 2082. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Curtis, S. Chen, B. Chen, A. Agarwal, C. A. Klug, and P. W. Sanders Contribution of intrarenal cells to cellular repair after acute kidney injury: subcapsular implantation technique Am J Physiol Renal Physiol, July 1, 2008; 295(1): F310 - F314. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Togel, Y. Yang, P. Zhang, Z. Hu, and C. Westenfelder Bioluminescence imaging to monitor the in vivo distribution of administered mesenchymal stem cells in acute kidney injury Am J Physiol Renal Physiol, July 1, 2008; 295(1): F315 - F321. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Schmitt and L. G. Cantley The impact of aging on kidney repair Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1265 - F1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Stokman, J. C. Leemans, I. Stroo, I. Hoedemaeker, N. Claessen, G. J. D. Teske, J. J. Weening, and S. Florquin Enhanced mobilization of bone marrow cells does not ameliorate renal fibrosis Nephrol. Dial. Transplant., February 1, 2008; 23(2): 483 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ohnishi, S. Mizuno, and T. Nakamura Inhibition of tubular cell proliferation by neutralizing endogenous HGF leads to renal hypoxia and bone marrow-derived cell engraftment in acute renal failure Am J Physiol Renal Physiol, February 1, 2008; 294(2): F326 - F335. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li, P. Truong, P. Igarashi, and F. Lin Renal and Bone Marrow Cells Fuse after Renal Ischemic Injury J. Am. Soc. Nephrol., December 1, 2007; 18(12): 3067 - 3077. [Full Text] [PDF] |
||||
![]() |
A. J. Nauta and W. E. Fibbe Immunomodulatory properties of mesenchymal stromal cells Blood, November 15, 2007; 110(10): 3499 - 3506. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Imberti, M. Morigi, S. Tomasoni, C. Rota, D. Corna, L. Longaretti, D. Rottoli, F. Valsecchi, A. Benigni, J. Wang, et al. Insulin-Like Growth Factor-1 Sustains Stem Cell Mediated Renal Repair J. Am. Soc. Nephrol., November 1, 2007; 18(11): 2921 - 2928. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bi, R. Schmitt, M. Israilova, H. Nishio, and L. G. Cantley Stromal Cells Protect against Acute Tubular Injury via an Endocrine Effect J. Am. Soc. Nephrol., September 1, 2007; 18(9): 2486 - 2496. [Full Text] [PDF] |
||||
![]() |
F. Benvenuto, S. Ferrari, E. Gerdoni, F. Gualandi, F. Frassoni, V. Pistoia, G. Mancardi, and A. Uccelli Human Mesenchymal Stem Cells Promote Survival of T Cells in a Quiescent State Stem Cells, July 1, 2007; 25(7): 1753 - 1760. [Abstract] [Full Text] [PDF] |
||||
|
|
A. G. Zenovich and D. A. Taylor CELL THERAPY IN KIDNEY DISEASE: CAUTIOUS OPTIMISM... BUT OPTIMISM NONETHELESS Perit. Dial. Int., June 1, 2007; 27(Supplement_2): S94 - S103. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Togel, K. Weiss, Y. Yang, Z. Hu, P. Zhang, and C. Westenfelder Vasculotropic, paracrine actions of infused mesenchymal stem cells are important to the recovery from acute kidney injury Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1626 - F1635. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Kishore, J. Isaac, and C. Westenfelder Administration of poly-D-glutamic acid induces proliferation of erythropoietin-producing peritubular cells in rat kidney Am J Physiol Renal Physiol, February 1, 2007; 292(2): F749 - F761. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Broekema, M. C. Harmsen, M. J.A. van Luyn, J. A. Koerts, A. H. Petersen, T. G. van Kooten, H. van Goor, G. Navis, and E. R. Popa Bone Marrow-Derived Myofibroblasts Contribute to the Renal Interstitial Myofibroblast Population and Produce Procollagen I after Ischemia/Reperfusion in Rats J. Am. Soc. Nephrol., January 1, 2007; 18(1): 165 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Poulsom, E. I. Prodromidi, C. D. Pusey, and H. T. Cook Cell therapy for renal regeneration--time for some joined-up thinking? Nephrol. Dial. Transplant., December 1, 2006; 21(12): 3349 - 3353. [Full Text] [PDF] |
||||
![]() |
B. Dekel, L. Zangi, E. Shezen, S. Reich-Zeliger, S. Eventov-Friedman, H. Katchman, J. Jacob-Hirsch, N. Amariglio, G. Rechavi, R. Margalit, et al. Isolation and Characterization of Nontubular Sca-1+Lin- Multipotent Stem/Progenitor Cells from Adult Mouse Kidney J. Am. Soc. Nephrol., December 1, 2006; 17(12): 3300 - 3314. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gupta, C. Verfaillie, D. Chmielewski, S. Kren, K. Eidman, J. Connaire, Y. Heremans, T. Lund, M. Blackstad, Y. Jiang, et al. Isolation and Characterization of Kidney-Derived Stem Cells J. Am. Soc. Nephrol., November 1, 2006; 17(11): 3028 - 3040. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. I. Prodromidi, R. Poulsom, R. Jeffery, C. A. Roufosse, P. J. Pollard, C. D. Pusey, and H. T. Cook Bone Marrow-Derived Cells Contribute to Podocyte Regeneration and Amelioration of Renal Disease in a Mouse Model of Alport Syndrome Stem Cells, November 1, 2006; 24(11): 2448 - 2455. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Floege, U. Kunter, M. Weber, and O. Gross Bone marrow transplantation rescues Alport mice Nephrol. Dial. Transplant., October 1, 2006; 21(10): 2721 - 2723. [Full Text] [PDF] |
||||
![]() |
M. Wang, P. R. Crisostomo, C. Herring, K. K. Meldrum, and D. R. Meldrum Human progenitor cells from bone marrow or adipose tissue produce VEGF, HGF, and IGF-I in response to TNF by a p38 MAPK-dependent mechanism Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2006; 291(4): R880 - R884. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Plotkin and M. S. Goligorsky Mesenchymal cells from adult kidney support angiogenesis and differentiate into multiple interstitial cell types including erythropoietin-producing fibroblasts Am J Physiol Renal Physiol, October 1, 2006; 291(4): F902 - F912. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Little Regrow or Repair: Potential Regenerative Therapies for the Kidney J. Am. Soc. Nephrol., September 1, 2006; 17(9): 2390 - 2401. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Rabelink and C. van Kooten Stem Cell Therapy for Glomerular Disease J. Am. Soc. Nephrol., August 1, 2006; 17(8): 2086 - 2088. [Full Text] [PDF] |
||||
![]() |
P. Devarajan Update on Mechanisms of Ischemic Acute Kidney Injury J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1503 - 1520. [Full Text] [PDF] |
||||
![]() |
P. S.M., M. T., S. A., Y. H.T., C. D., K. S.A., S. V.P., W. B., L. P.S., T. S.M., et al. Leaking Capillaries and White Lung in Sepsis--Is Angiopoietin 2 the Culprit?: Excess Circulating Angiopoietin-2 May Contribute to Pulmonary Vascular Leak in Sepsis in Humans. PLoS Medicine 3: e46, 2006 J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1207 - 1217. [Full Text] [PDF] |
||||
![]() |
C. Roufosse, G. Bou-Gharios, E. Prodromidi, C. Alexakis, R. Jeffery, S. Khan, W. R. Otto, J. Alter, R. Poulsom, and H. T. Cook Bone Marrow-Derived Cells Do Not Contribute Significantly to Collagen I Synthesis in a Murine Model of Renal Fibrosis J. Am. Soc. Nephrol., March 1, 2006; 17(3): 775 - 782. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-K. Guo, A. Schedl, and D. S. Krause Bone Marrow Transplantation Can Attenuate the Progression of Mesangial Sclerosis Stem Cells, February 1, 2006; 24(2): 406 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
Highlights from the Literature Physiology, August 1, 2005; 20(4): 213 - 217. [Full Text] [PDF] |
||||
![]() |
H. Rabb Paracrine and differentiation mechanisms underlying stem cell therapy for the damaged kidney Am J Physiol Renal Physiol, July 1, 2005; 289(1): F29 - F30. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |