AJP - Renal AJP: Endocrinology and Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Renal Physiol 289: F90-F96, 2005; doi:10.1152/ajprenal.00390.2004
0363-6127/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arteaga, M. F.
Right arrow Articles by Canessa, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arteaga, M. F.
Right arrow Articles by Canessa, C. M.

Functional specificity of Sgk1 and Akt1 on ENaC activity

Maria Francisca Arteaga and Cecilia M. Canessa

Department of Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, Connecticut 06510

Submitted 26 October 2004 ; accepted in final form 25 January 2005


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reabsorption of sodium by the epithelial sodium channel (ENaC) is essential for maintaining the volume of the extracellular compartment and blood pressure. The function of ENaC is regulated primarily by aldosterone, antidiuretic hormone [arginine vasopressin (AVP)], and insulin, but the molecular mechanisms that increase channel activity are still poorly understood. It has been proposed that the related serine/threonine kinases serum- and glucocorticoid-induced kinase (Sgk1) and protein kinase B (Akt) mediate activation of ENaC. Here, we addressed the question of whether there is functional specificity of these kinases for the activation of ENaC in epithelial cells of the distal renal tubule. We demonstrate that Akt does not increase ENaC function under basal conditions or after stimulation with aldosterone, insulin, or AVP. In contrast, under the same experimental conditions, Sgk1 increases ENaC activity by 10-fold. The effect of Sgk1 is additive to that of aldosterone, whereas, in the presence of active Sgk1, cells do not further respond to insulin or AVP. We conclude that, in cells expressing both kinases, modulation of ENaC activity is mediated by Sgk1 but not by Akt1.

insulin; aldosterone; arginine vasopressin; A6 cells

THE EPITHELIAL SODIUM CHANNEL (ENaC) mediates sodium reabsorption in the distal segment of the renal tubule. Activity of ENaC is highly regulated by aldosterone, insulin, and arginine vasopressin (AVP). Despite progress in the molecular identification and characterization of the molecules that constitute the channel and the receptors for hormones, little is known of the proteins that participate in the signaling pathways that ultimately activate ENaC. Most recently, it has been demonstrated that serum- and glucocorticoid-induced kinase (Sgk1) increases ENaC function (3, 7), and it may also mediate the responses to aldosterone and insulin (20, 25).

Sgk1 and protein kinase B (Akt1) are similar proteins (54% amino acid identity in the catalytic domain) that belong to a subfamily of S/T kinases known as the AGC (cAMP-dependent protein kinase/protein kinase G/protein kinase C) protein kinases that display a high degree of primary sequence conservation within their respective kinase domains (17). The main structural difference is the presence of a pleckstrin homology domain in the amino terminus of Akt1 that is absent in Sgk1. Sgk1 and Akt1 are both targets of phosphoinositide 3-kinase lipid products. Phosphorylation of two residues (S473 and T308 in Akt1, and S422 and T256 in Sgk1) by the phosphatidylinositol 3,4,5-trisphosphate-dependent kinases PDK1 and PDK2 determines activation of Akt1 and Sgk1 (1, 2, 16). The two kinases also overlap in tissue distribution and in substrate specificity. When tested in vitro, Akt1 and Sgk1 phosphorylate peptides with the same minimum sequence motif, RXRXXS/TB, where X is any amino acid, and B is a bulky hydrophobic residue (18, 19). Much more is known about proteins phosphorylated by Akt1: they include proteins downstream of insulin, such as glycogen synthase kinase 3 (GSK3), phosphodiesterase-3B, mammalian target of rapamycin, and the insulin receptor substrate-1 (18), and targets that promote survival, such as components of the apoptotic machinery Bcl antagonist, causing cell death (13), caspase-9, and the forkhead transcription factors (FKHR, FKHRL1, and AFX; see Ref. 21). Akt1 activates endothelial nitric oxide synthase (12, 14). Akt also phosphorylates WNK1 [with no K (lysine) protein kinase-1], a kinase that is mutated in an inherited hypertension syndrome called pseudohypoaldosteronism type II (24). In contrast, relatively little is known about downstream effectors of Sgk1. The few identified Sgk1 targets are also substrates of Akt1, such as GSK3 (23) and FKHRL1 (6). Another alleged substrate of Sgk1 is the ubiquitin ligase Nedd4–2 (neuronal expressed developmentally downregulated 4–2; see Ref. 10). Furthermore, Sgk1 and Akt1 stimulate the activity of many transporters in Xenopus oocytes when coexpressed with glucose transpsorter-1 (11), glutamine transporter SN1 (5, 15), and renal sodium dicarboxylate cotransporter-1 (15). Finally, a redundant function of these kinases could explain the mild phenotype of mice with inactivation of the Sgk1 gene (26).

Sodium-transporting cells of the distal tubule express both Sgk1 and Akt1; moreover, the two kinases have similar mechanisms of activation and targets of phosphorylation, raising the question of whether Sgk1 and Akt1 have interchangeable functions on ENaC regulation. Here, we examined the functional specificity of Sgk1 and Akt1 in the activation of ENaC in renal epithelial cells. Studies were conducted in A6 cells transfected with Akt1 and Sgk1 using the tetracycline-inducible system.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids and site-directed mutagenesis. The pcDNA3 mammalian expression vector (Invitrogen, Carlsbad, CA) with the full-length cDNA encoding Mus musculus Akt1 was generously provided by Dr. Anton Bennett. The cDNA of Akt1 was digested with BamHI and EcoRV and inserted in the cloning site of pcDNA4/TO vector (Invitrogen). The hemagglutinin (HA) epitope was fused at the 5'-end of the cDNA by PCR amplification. Point mutations, T308D/S473D and S473A, were introduced using the Quickchange mutagenesis kit (Stratagene, La Jolla, CA). All constructs were sequenced at the Keck Facility of Yale University. Plasmid pcDNA6/TR, containing the coding sequence for the tetracycline repressor, was from Invitrogen.

Cell culture, transfection, and generation of stable cell lines. Experiments were conducted with A6-S2 cells provided by Dr. John Hayslett. Cells were maintained in amphibian medium (0.75x DMEM, 10% FBS, buffered with sodium bicarbonate) in an incubator set at 27°C and 1.5% CO2. Cells expanded in plastic dishes were seeded on Transwell permeable supports, 0.33-cm2 filters (Corning, NY). After 10–14 days in culture, cells were washed two times in serum-free medium and maintained without serum for two more days before experiments were performed. The following components were used to the indicated final concentration: 100 nM aldosterone (Sigma, St. Louis, MO), 1 µg/ml tetracycline (Invitrogen), 100 nM insulin (Sigma), and 1 µM AVP (Sigma). When ethanol or DMSO was the solvent of stock solutions, the final dilution was 1:500 or 1:1,000, respectively. Control experiments included ethanol or DMSO at the same dilution and showed no effect. Transfection of A6 cells grown on plastic was performed with Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. A 5:1 mixture of pcDNA6/TR and pcDNA4/TO-Akt1 plasmids was used in every transfection. Stable cell lines expressing the tetracycline repressor and pcDNA4/TO-Akt1 constructs were obtained by growth on selective media containing 500 µg/ml zeocin and 10 µg/ml blasticidin. Clones were tested for Akt1 expression by induction with 1 µg/ml tetracycline.

RT-PCR. Total RNA was extracted from A6 cell lines grown on filters with the RNeasy kit from Qiagen (Valencia, CA) following the manufacturer's instructions. RNA concentration was measured by absorption spectroscopy. RNA (1 µg) was used for first-strand cDNA synthesis with SuperScript RT (Invitrogen). Five percent of each RT reaction was used as a template for amplification of 834-bp Akt1 and 619-bp Akt2 fragments by PCR. The following Akt1 primers were used: forward primers specific for Mus musculus Akt1 (5'-GTTGACCAGTTGGAAACTCC-3') and Akt2 (5'-GCCCGAAGATGAGGAGGAGG-3') and a common reverse primer (5'-CGACCATAGTCATTATCTTC-3') for the Akt1 and Akt2 sequence. Xenopus GSK3{alpha} and GSK3{beta} were amplified with the following specific primers: forward primers, GGGAGCTGCAGATCATGCGCAG and AGAACTGCAGATCATGAGAAAG, respectively; reverse primers, GTGTCTGGATCCACCAGCAAG and GTTTCTGGGTCCAGCAGTAGA, respectively.

Western blotting. A6 cells grown on filters were washed two times with ice-cold PBS, scraped in the same buffer, recovered by centrifugation, and lysed with SDS-PAGE loading buffer. Samples were separated by electrophoresis in 10% SDS-PAGE and transferred to an Immobilon-P membrane (Millipore, Bedford, MA). After being blocked with 5% dry milk, the membranes were probed with anti-HA-horseradish peroxidase (Santa Cruz, CA) antibody at 1:1,000 dilution. Signals were developed with ECL+ (Amersham), and blots were exposed to BioMax MR film (Eastman Kodak, New Haven, CT).

Immunoprecipitation. For immunoprecipitation of 35S-labeled proteins, A6 cells were grown on filters (25-mm diameter; Costar) and maintained in serum-free medium for 2 days. Before labeling (12 h), cells were treated ±1 µg/ml tetracycline. Labeling mix (200 µCi [35S]methionine and cysteine) was added for 3 h. After labeling, cells were lysed in 150 µl of 50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, and 1% Triton X-100 plus protease inhibitors (Complete; Roche). Samples were cleared by centrifugation and denatured by adding SDS to a final concentration of 2% and heating to 90°C for 3 min. SDS concentration was then diluted to 0.2% with lysis buffer, and samples were incubated with 8 µg anti-GSK3 monoclonal (Biosource International) and 50 µl protein G-agarose beads (Pierce) overnight at 4°C. Beads were washed six times with lysis buffer, and immunecomplexes were eluted from beads by adding 30 µl loading buffer. Samples were resolved in 10% SDS-PAGE. Immunoprecipitation of 32P-labeled proteins was conducted as indicated above except that cells were labeled with 3 mCi [32P]orthophosphate for 3 h, and lysis buffer was supplemented with 100 mM NaF, 2 mM orthovanadate, and 1 mM microcystin.

Equivalent short-circuit current measurement. Transepithelial voltage (VT) across confluent monolayers was measured with Ag/AgCl2 electrodes (electronic shop; Yale University). Current was passed with a model DVC-1000 voltage/current clamp apparatus (WPI Industries, Sarasota, FL) to estimate transepithelial resistance (RT). The equivalent short-circuit current (Isc) was calculated from the open-circuit estimates of VT and RT, using Ohm's law, and represents the net current associated with active ion flow when VT = 0 mV (22).

Statistical analysis. Data points represent the means ± SE of n independent experiments. Differences between groups were evaluated with nonpaired t-test. P and n values are given in the legends for Figs. 1–7.



View larger version (27K):
[in this window]
[in a new window]
  		Fig. 1. Protein kinase B (Akt) isoforms expressed in A6 cells and Xenopus laevis kidney. Ethidium bromide agarose gel shows amplified products from RT-PCR reactions using total RNA extracted from A6 cells and X. laevis kidney with specific primers for X. laevis Akt1 and Akt2 cDNAs. Arrows indicate DNA molecular weight markers.

 


View larger version (16K):
[in this window]
[in a new window]
  		Fig. 7. Serum- and glucocorticoid-induced kinase (Sgk1)-induced changes in Isc on stimulation with AVP, insulin, and aldosterone. Isc from an A6 cell line stably transfected with a constitutively active form of Sgk1 (SgkS425D) were measured in the absence (A–) or presence (A+) of aldosterone followed by stimulation for 30 min with insulin (A) or AVP (B). For each condition, measurements were conducted while the same cells expressed (T+) or did not express (T–) SgkS425D. Open and filled bars represent means ± SE of n = 9 independent measurements before and 30 min after application of the hormones.

 

   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of endogenous Akt1 in A6 cells. To determine whether Akt is expressed in A6 cells, we performed RT-PCR with total RNA extracted from A6 cells and Xenopus laevis kidney using primers specific for Xenopus Akt1 and Akt2 isoforms. We detected Akt1 transcript in both A6 cells and Xenopus kidney and Akt2 weakly in kidney but not in A6 cells. Figure 1 shows an ethidium bromide agarose gel loaded with the PCR products. The 834-bp band corresponds to Akt1 and the 619-bp band to Akt2, as expected from the cDNA sequences.

These results indicate that Akt1 is the predominant isoform expressed in A6. Although the frog kidney also expresses a low abundance of Akt2, this isoform was not detected in A6 cells that are derived from the distal tubule.

Generation of stable A6 cell lines transfected with Akt1 mutants. Previous experience in our laboratory developing A6 stable cell lines has indicated a great variability in expression of amiloride-sensitive current among isolated clones after transfection. This finding makes it difficult to distinguish whether changes in amiloride-sensitive current are the result of expression of the transfected protein or of nonspecific effects on transport resulting from the transfection and selection processes. To avoid this confounding effect, we used the tetracycline-regulated expression system that enables measurement of ENaC activity before and after induction of the transfected gene with tetracycline (Fig. 2A). We generated stable A6 cell lines coexpressing the tetracycline repressor protein together with constitutively active Akt1, which carries the mutations T308D and S473D (AktT308D/S473D; see Ref. 4), or inactive Akt1 with the mutation S473A (AktS473A; Fig. 2B). Only clones that exhibited expression of amiloride-sensitive currents of similar magnitude to the parental A6 cell line and expression of Akt tightly controlled by tetracycline were selected for further studies. Figure 2B shows a Western blot of a clone transfected with HA-AktT308D/S473D and a clone transfected with HA-AktS473A. Expression of the transgene is detected only after treatment with tetracycline.



View larger version (37K):
[in this window]
[in a new window]
  		Fig. 2. A: scheme describing the tetracycline-inducible expression system of Akt in A6 cells. Cells were cotransfected with a plasmid containing the tetracycline repressor (TetR) and a plasmid containing the Akt gene under the CMV promoter followed by tandem repeats of the tetracycline operon (TetO). Addition of tetracycline to the culture medium releases inhibition of Akt transcription by the TetR. B: representative Western blots of clones transfected with AktT308D/S473D or AktS473A before and after tetracycline for 12 h. Membranes were probed with anti-hemagglutinin (HA) antibody.

 
Characterization of AktT308D/S473D and AktS473A cell lines. To investigate the effect of Akt1 mutants on ENaC function, we conducted parallel time-course experiments of Akt1 expression and of Isc. Induction of Akt1 was examined by Western blots in cell lines AktT308D/S473D (clone 1) and AktS473A (clone 2) pretreated with tetracycline from 0 to 10 h. The two cell lines exhibited different kinetics of AktT308D/S473D and AktS473A induction. AktT308D/S473D was detected 5–6 h after addition of tetracycline and peaked at 10 h (Fig. 3A), whereas AktS473A was detected after 3–4 h and peaked at 10 h (Fig. 3B).



View larger version (33K):
[in this window]
[in a new window]
  		Fig. 3. Characterization of AktT308D/S473D and AktS473A cell lines. A and B show Western blots of the time course of tetracycline induction of AktT308D/S473D and AktS473A expression. C and D show the time course of the following electrical properties of these two clones grown on permeable supports: transepithelial voltage (mV), short-circuit current (Isc, µA/cm2), and calculated transepithelial resistance (RT, k{Omega}·cm2). Broken lines indicate with 100 nM aldosterone (A+) and solid lines without aldosterone (A–). T indicates tetracycline. Each point is the mean of at least 4 experiments. Error bars are SE.

 
Electrical properties of AktT308D/S473D and AktS473A monolayers were examined after 10 days of growth on permeable supports. Before experiments (2 days), serum was removed from the culture medium, and one-half of the filters were treated overnight with aldosterone (A). Tetracycline (T) was added to control and aldosterone-treated filters for 10 h. Transepithelial Isc, VT, and RT were measured at 1-h intervals as indicated in Fig. 3, C and D. Previous experiments have shown that tetracycline does not affect Isc, VT, or RT in the parental A6 cell line (3). Cells on filters displayed high RT, AktT308D/S473D on the order of 2.5 k{Omega}·cm2, and AktS473A 2.0 k{Omega}·cm2.

Aldosterone increased Isc from 21.2 (A–/T+) to 75.8 (A+/T+) µA/cm2 (3-fold) in AktT308D/S473D and from 4.0 (A–/T+) to 24.2 (A+/T+) µA/cm2 (6-fold) in clone AktS473A. However, expression of active and inactive Akt1 mutants did not affect the value of Isc, VT, or RT during the period of observation. Therefore, these results indicate that neither AktT308D/S473D nor AktS473A changes the level of basal ENaC activity or the response to aldosterone.

GSK3 kinase is phosphorylated in tetracycline-induced AktT308D/S473D cells. To demonstrate that the constitutively active form of Akt1 does phosphorylate its endogenous substrates in transfected A6 cells, we examined whether GSK3, a substrate of Akt1, was phosphorylated upon induction of AktT308D/S473D cells with tetracycline. During insulin signal transduction, GSK3 is inhibited by Akt-catalyzed phosphorylation of an amino-terminal serine residue (Ser-21 in GSK3{alpha} and Ser-9 in GSK3{beta}; see Ref. 9); thereby, activity of Akt1 should increase the level of phosphorylation of endogenously expressed GSK3 in A6 cells. We first demonstrated by RT-PCR that A6 cells grown of filters express GSK3{alpha} and GSK3{beta} isoforms (Fig. 4A) and that a monoclonal antibody specific for X. laevis GSK3 immuprecipitates proteins of the expected molecular weights, 51 kDa for GSK3{alpha} and 47 kDa for GSK3{beta} (Fig. 4B). To examine phosphorylation of GSK3{alpha} and GSK3{beta} by active Akt1, we pretreated AktT308D/S473D cells ± tetracycline followed by labeling with 32P and immunoprecipitation. Figure 4C shows that the degree of phosphorylation of GSK3 is increased by twofold (Fig. 4D) in the presence of constitutively active Akt1 compared with control. Notice that, in the absence of Akt1 expression, GSK3 exhibits a basal level of phosphorylation, which reflects the fact that this kinase is active [i.e., phosphorylated in other S/T residues (9) under nonstimulated conditions]. Induction of AktT308D/S473D by tetracycline induces additional phosphorylation at the amino terminus of GSK3 that results in inhibition of the kinase.



View larger version (69K):
[in this window]
[in a new window]
  		Fig. 4. Phosphorylation of endogenous glycogen synthase kinase 3 (GSK3) by AktT308D/S473D in clone 1 of A6 cells. A: agarose gel with RT-PCR products of GSK3{alpha} and GSK3{beta} obtained from RNA of A6 cells and specific X. laevis primers for the two isoforms of GSK3. B: immunoprecipitation of GSK3 from clone AktT308D/S473D (no. 1), induced (Tc+) and noninduced (Tc–), labeled with [35S]methionine and cysteine using anti-GSK3 monoclonal antibody. Arrows indicate the mobility of the two isoforms GSK3{alpha} and GSK3{beta}. Arrowhead indicates the molecular weight marker. C: immoprecipitation of GSK3 labeled with 32P. AktT308D/S473D cells were induced or noninduced with tetracycline for 12 h followed by labeling with [32P]orthophosphate for 3 h. GSK3 was immunoprecipitated with anti-GSK3 monoclonal antibody and resolved on SDS-PAGE. Gel shows the results of 3 independent experiments. D: densitometric quantification of phosphorylated signals of GSK3 kinase from cells induced (Tc+) and noninduced (Tc–) with tetracycline. *P < 0.001.

 
These experiments demonstrate that AktT308D/S473D phosphorylates its physiological substrates, but these do not affect basal or aldosterone-induced ENaC activity.

Effects of Akt1 on insulin- and AVP-induced activation of ENaC. To investigate whether Akt1 mediates increases of ENaC activity induced by insulin or AVP, we examined the response of these hormones in AktT308D/S473D and AktS473A cell lines. The following four conditions were studied: A–/T–, without aldosterone or tetracycline; A–/T+, without aldosterone and with tetracycline; A+/T–, aldosterone without tetracycline; and A+/T+, aldosterone and tetracycline. Aldosterone and tetracycline were administered for 10 h. Insulin or AVP was added to the basolateral side 30 min before electrical measurements.

Figure 5A shows the response of AktT308D/S473D cells to insulin. In the absence of aldosterone (A–/T– and A–/T+), cells increased Isc by 12.1 and 16.7 µA/cm2 and with aldosterone (A+/T– and A+/T+) by 21.9 and 20 µA/cm2, indicating that expression of constitutively active Akt1 does not change the insulin effect on ENaC. The response to aldosterone was also not affected by expression of AktT308D/S473D; cells increased current by 28.2 µA/cm2.



View larger version (38K):
[in this window]
[in a new window]
  		Fig. 5. Effects of Akt1 on Isc induced by insulin or arginine vasopressin (AVP). A cell line transfected with AktT308D/S473D (no. 1) grown on permeable supports was examined for its response to insulin (A) or AVP (B) without (T–) or with (T+) induction of AktT308D/S473D by tetracycline. Filled bars in A: A–/T– vs. A–/T+, P ≥ 0.7, n = 9 experiments; A+/T– vs. A+/T+, P ≥ 0.9, n = 9. Filled bars in B: A–/T– vs. A–/T+, P = 1.0, n = 4; A+/T– vs. A+/T+, P ≥ 0.5, n = 4. A cell line transfected with AktS473A (no. 2) was examined for its response to insulin (C) or AVP (D) without (T–) or with (T+) expression of AktS473A. Open and filled bars indicate Isc measurements before and after addition of the hormone, respectively. Data represent means ± SE of at least 4 independent filters. Filled bars in C: A–/T– vs. A–/T+, P ≥ 0.7, n = 5; A+/T– vs. A+/T+, P ≥ 0.5, n = 5. Filled bars in D: A–/T– vs. A–/T+, P ≥ 0.6, n = 4; A+/T– vs. A+/T+, P ≥ 0.9, n = 4.

 
Figure 5B shows the response of AktT308D/S473D cells to AVP. In the absence of aldosterone (A–/T– and A–/T+), cells increased Isc by 56.6 and 53.4 µA/cm2 and with aldosterone (A+/T– and A+/T+) by 45.5 and 51.5 µA/cm2; thereby, expression of AktT308D/S473D does not change the effects of AVP. Of note is the much larger effect of AVP in this A6 AktT308D/S473D clone than in the parental cell line (~10 µA/cm2) and the AktS473A clone. This observation illustrates the difficulty in interpreting the results in the absence of an internal control, e.g., cells not treated with tetracycline.

The response of a representative cell line expressing AktS473A is shown in Fig. 5, C and D. In the absence of aldosterone (A–/T– and A–/T+), insulin increased Isc by 4.0 µA/cm2 and with aldosterone (A+/T– and A+/T+) by 6.0 µA/cm2 (Fig. 5C). The response to AVP in the absence of aldosterone (A–/T– and A–/T+) was an increase in Isc of 3.0 µA/cm2 and with aldosterone (A+/T– and A+/T+) of 8.0 and 11 µA/cm2 (Fig. 5D).

The results presented in Fig. 5 are not restricted to clones 1 and 2. We also examined the response to aldosterone and insulin in additional AktT308D/S473D (clone 5) and AktS473A (clone 6) cells induced and noninduced with tetracycline (Fig. 6, A and B). Measurements of Isc were performed before and after 10 h of tetracycline induction when expression of Akt1 was maximal. As shown in Fig. 6, C and D, there was no difference in the basal current or in the insulin-induced response. Figures 5 and 6 also show the variability in basal Isc among clones transfected with identical cDNA.



View larger version (19K):
[in this window]
[in a new window]
  		Fig. 6. Isc response to insulin of additional AktT308D/S473D and AktS473A clones. A: Western blot analysis of AktT308D/S473D (clone 5) and AktS473A (clone 6) expression at 0 and 10 h after induction with tetracycline using anti-HA monoclonal antibody. B and C: basal and insulin-stimulated Isc of AktT308D/S473D (clone 5) and AktS473A (clone 6). Experiments were conducted as indicated in Fig. 5 using 2 additional and independent clones.

 
Effects of Sgk1 on insulin- and AVP-induced activation of ENaC. We next compared cells expressing Akt1 with a cell line that expresses a constitutively active form of Sgk1 (SgkS425D) that was previously generated and characterized in our laboratory (3). In contrast to Akt1, induction of SgkS425D produced a large increase in Isc from 3 to 76.3 ± 3.4 µA/cm2 without aldosterone (A–/T– to A–/T+) and from 11.6 ± 0.5 to 99.5 ± 1.4 µA/cm2 (A+/T– to A+/T+; Fig. 7). This result demonstrates a marked stimulatory effect of Sgk1 on ENaC function. Furthermore, it shows that aldosterone and Sgk1 have additive effects in the magnitude of Isc, and the responses to insulin (Fig. 7A) and AVP (Fig. 7B) are abolished by the expression of SgkS425D.

These data indicate that expression of a constitutively active or an inactive form of Akt1 does not change the basal activity of ENaC or the stimulation induced by AVP or insulin. In contrast, constitutively active SgkS425D induces a marked increase in Isc and abolishes insulin and AVP responses, as we have demonstrated previously (3).


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Importance of the tetracycline-inducible system for interpreting results of transfected A6 cells. The A6 cell line constitutes an ideal system to study regulation of ENaC because it forms a polarized epithelium when grown on permeable supports, expresses endogenous sodium channels, and responds to aldosterone, insulin, and AVP by upregulating sodium transport. Furthermore, the ability to make stable cell lines permits examination of the effects of transfected proteins on ENaC function. However, after transfection and antibiotic selection, the properties of the final clones may differ from the parental cell line. Thus differences in properties can be incorrectly attributed to expression of the transgene. This issue is illustrated by some of the clones presented in this work. For instance, Fig. 3, B and D, shows responses to AVP from clones AktT308D/S473D and AktS473A. Under control conditions (A–/T–), when cells do not express the transgene, the two cell lines differ in the magnitude of basal current and in the increase induced by AVP, 58.1 µA/cm2 (3.56-fold increase) vs. 4.6 µA/cm2 (2-fold increase). However, these differences in basal current and in AVP response are not the result of specific effects of the transgene because they remain after induction of Akt1 with tetracycline (A–/T– vs. A–/T+, and A+/T– vs. A+/T+). The reasons for variability of A6 cells after transfection and selection are not known, but factors that can account for it are selection of single cells from an original heterogeneous population. Alternatively, insertion of the transgene in the genomic DNA may change expression of surrounding genes that in turn alter the properties of the cells. Regardless of the precise mechanism involved, our observation makes it necessary to carry out the correct interpretation of the results after stable transfected cell lines have been generated. The best control consists of examining the same clone before and after induction of the transgene with tetracycline; if a functional difference is found in cells treated with tetracycline, it can be confidently attributed to expression of the transgene.

Transient transfection of cells avoids the need to select for single clones; however, this is not a viable alternative for A6 cells. Efficient transfection of A6 cells is achieved only when cells are grown on plastic dishes but not on filters. After transfection, cells need to be seeded on filters and grown for at least 10 days. After this time, most of the cells have already lost the transfected plasmid, leaving a very small number of cells expressing the transgene.

Differential response of ENaC to Akt1 and Sgk1 in A6 cells. As indicated in the introduction, Akt1 and Sgk1 are very similar protein kinases with overlapping mechanisms of activation, substrate specificity, and tissue distribution. Moreover, Akt1 and Sgk1 both increase the activity of the same ion channels and transporters expressed in Xenopus oocytes (5). These observations raise the question of whether Akt1 maintains basal activity of ENaC in the absence of aldosterone or whether it mediates the responses to aldosterone, insulin, or AVP in the distal renal tubule. It is known that Akt mediates many of the insulin effects, including translocation of the glucose transporter, GLUT4, from intracellular storage sites to the plasma membrane in myocytes and adipocytes. Overexpression of AktT308D/S473D stimulates recruitment of GLUT4 to the cell surface in the absence of insulin (8). Similar to the effects on GLUT4, it has been assumed that Akt also translocates ENaC from a vesicular pool to the plasma membrane upon insulin stimulation. In contrast, we found that AktT308D/S473D did not increase basal Isc or the response to insulin in A6 cells, demonstrating that insulin activation of ENaC is not mediated by Akt translocation of channels. The aldosterone and AVP responses were also not affected by AktT308D/S473D expression. The absence of ENaC stimulation cannot be attributed to failure of transfected AktT308D/S473D to phosphorylate target proteins because endogenous GSK3, a known substrate of Akt, was phosphorylated in the A6 cell line. In contrast, Sgk1 increased basal Isc and abolished the response to insulin, suggesting that Sgk1 may target one of the steps in the insulin-signaling pathway that leads to activation and/or translocation of channels in A6 cells.

We conclude that Sgk1 but not Akt1 increases ENaC activity in an epithelial cell line that recapitulates the properties of the distal renal tubule. The results also demonstrate that the increase in Isc induced by Sgk1 is not an artifact of overexpression of a constitutively active protein but reflects functional specificity of the kinases.


   FOOTNOTES
 

Address for reprint requests and other correspondence: C. M. Canessa, Yale Univ. School of Medicine, Dept. of Cellular and Molecular Physiology, Sterling Hall of Medicine, B-121, 333 Cedar St., New Haven, CT 06510 (E-mail: Cecilia.canessa{at}yale.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, and Hemmings BA. Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J 15: 6541–6551, 1996.[ISI][Medline]
  2. Alessi DR and Cohen P. Mechanism of activation and function of protein kinase B. Curr Opin Genet Dev 8: 55–62, 1998.[CrossRef][ISI][Medline]
  3. Alvarez de la Rosa D and Canessa CM. Role of SGK in hormonal regulation of epithelial sodium channel in A6 cells. Am J Physiol Cell Physiol 284: C404–C414, 2003.[Abstract/Free Full Text]
  4. Bellacosa A, Chan TO, Ahmed NN, Datta K, Malstrom S, Stokoe D, McCormick F, Feng J, and Tsichlis P. Akt activation by growth factors is a multiple-step process: the role of the PH domain. Oncogene 17: 313–325, 1998.[CrossRef][ISI][Medline]
  5. Boehmer C, Okur F, Setiawan I, Broer S, and Lang F. Properties and regulation of glutamine transporter SN1 by protein kinases SGK and PKB. Biochem Biophys Res Commun 306: 156–162, 2003.[CrossRef][ISI][Medline]
  6. Brunet A, Park J, Tran H, Hu LS, Hemmings BA, and Greenberg ME. Protein kinase SGK mediates survival signals by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol 21: 952–965, 2001.[Abstract/Free Full Text]
  7. Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, and Pearce D. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci USA 96: 2514–2519, 1999.[Abstract/Free Full Text]
  8. Cong LN, Chen H, Li Y, Zhou L, McGibbon MA, Taylor SI, and Quon MJ. Physiological role of Akt in insulin-stimulated translocation of GLUT4 in transfected rat adipose cells. Mol Endocrinol 11: 1881–1890, 1997.[Abstract/Free Full Text]
  9. Cross DA, Alessi DR, Cohen P, Andjelkovich M, and Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378: 785–789, 1995.[CrossRef][Medline]
  10. Debonneville C, Flores SY, Kamynina E, Plant PJ, Tauxe C, Thomas MA, Munster C, Chraibi A, Pratt JH, Horisberger JD, Pearce D, Loffing J, and Staub O. Phosphorylation of Nedd4–2 by Sgk1 regulates epithelial Na(+) channel cell surface expression. EMBO J 20: 7052–7059, 2001.[CrossRef][ISI][Medline]
  11. Dieter M, Palmada M, Rajamanickam J, Aydin A, Busjahn A, Boehmer C, Luft FC, and Lang F. Regulation of glucose transporter SGLT1 by ubiquitin ligase Nedd4–2 and kinases SGK1, SGK3, and PKB. Obesity Res 12: 862–870, 2004.[ISI][Medline]
  12. Dimmeler S, Fleming I, Fisslthaler B, Hermann C, Busse R, and Zeiher AM. Activation of nitric oxide synthase in endothelial cells by Akt-dependent phosphorylation. Nature 399: 601–605, 1999.[CrossRef][Medline]
  13. Downward J. How BAD phosphorylation is good for survival. Nat Cell Biol 1: E33–E35, 1999.[CrossRef][ISI][Medline]
  14. Fulton D, Gratton JP, McCabe TJ, Fontana J, Fujio Y, Walsh K, Franke TF, Papapetropoulos A, and Sessa WC. Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature 399: 597–601, 1999.[CrossRef][Medline]
  15. Henke G, Maier G, Wallisch S, Boehmer C, and Lang F. Regulation of the voltage gated K+ channel Kv1.3 by the ubiquitin ligase Nedd4–2 and the serum and glucocorticoid inducible kinase SGK1. J Cell Physiol 199: 194–199, 2004.[CrossRef][ISI][Medline]
  16. Kobayashi T and Cohen P. Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J 339: 319–328, 1999.[CrossRef][ISI][Medline]
  17. Lang F and Cohen P. Regulation and physiological roles of serum- and glucocorticoid-induced protein kinase isoforms (Abstract). Sci STKE 2001: RE17, 2001.[Medline]
  18. Lawlor MA and Alessi DR. PKB/Akt: a key mediator of cell proliferation, survival and insulin responses? J Cell Sci 114: 2903–2910, 2001.[ISI][Medline]
  19. Park J, Leong ML, Buse P, Maiyar AC, Firestone GL, and Hemmings BA. Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J 18: 3024–3033, 1999.[CrossRef][ISI][Medline]
  20. Pearce D. The role of SGK1 in hormone-regulated sodium transport. Trends Endocrinol Metab 12: 341–347, 2001.[CrossRef][ISI][Medline]
  21. Rena G, Guo S, Cichy SC, Unterman TG, and Cohen P. Phosphorylation of the transcription factor forkhead family member FKHR by protein kinase B. J Biol Chem 274: 17179–17183, 1999.[Abstract/Free Full Text]
  22. Rodriguez-Commes J, Isales C, Kalghati L, Gasalla-Herraiz J, and Hayslett JP. Mechanism of insulin-stimulated electrogenic sodium transport. Kidney Int 46: 666–674, 1994.[ISI][Medline]
  23. Sakoda H, Gotoh Y, Katagiri H, Kurokawa M, Ono H, Onishi Y, Anai M, Ogihara T, Fujishiro M, Fukushima Y, Abe M, Shojima N, Kikuchi M, Oka Y, Hirai H, and Asano T. Differing roles of Akt and serum- and glucocorticoid-regulated kinase in glucose metabolism, DNA synthesis, and oncogenic activity. J Biol Chem 278: 25802–25807, 2003.[Abstract/Free Full Text]
  24. Vitari AC, Deak M, Collins BJ, Morrice N, Prescott AR, Phelan A, Humphreys S, and Alessi DR. WNK1, the kinase mutated in an inherited high-blood-pressure syndrome, is a novel PKB (protein kinase B)/Akt substrate. Biochem J 378: 257–268, 2004.[CrossRef][ISI][Medline]
  25. Wang J, Barbry P, Maiyar AC, Rozansky DJ, Bhargava A, Leong M, Firestone GL, and Pearce D. SGK integrates insulin and mineralocorticoid regulation of epithelial sodium transport. Am J Physiol Renal Physiol 280: F303–F313, 2001.[Abstract/Free Full Text]
  26. Wulff P, Vallon V, Huang DY, Volkl H, Yu F, Richter K, Jansen M, Schlunz M, Klingel K, Loffing J, Kauselmann G, Bosl MR, Lang F, and Kuhl D. Impaired renal Na(+) retention in the sgk1-knockout mouse. J Clin Invest 110: 1263–1268, 2002.[CrossRef][ISI][Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Renal Physiol.Home page
J. Wang, Z. A. Knight, D. Fiedler, O. Williams, K. M. Shokat, and D. Pearce
Activity of the p110-{alpha} subunit of phosphatidylinositol-3-kinase is required for activation of epithelial sodium transport
Am J Physiol Renal Physiol, September 1, 2008; 295(3): F843 - F850.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. G. Brown, M. Gallacher, R. E. Olver, and S. M. Wilson
The regulation of selective and nonselective Na+ conductances in H441 human airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L942 - L954.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
E. Cordas, A. Naray-Fejes-Toth, and G. Fejes-Toth
Subcellular location of serum- and glucocorticoid-induced kinase-1 in renal and mammary epithelial cells
Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1971 - C1981.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
D. Y. Huang, K. M. Boini, H. Osswald, B. Friedrich, F. Artunc, S. Ullrich, J. Rajamanickam, M. Palmada, P. Wulff, D. Kuhl, et al.
Resistance of mice lacking the serum- and glucocorticoid-inducible kinase SGK1 against salt-sensitive hypertension induced by a high-fat diet
Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1264 - F1273.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon
(Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.
Physiol Rev, October 1, 2006; 86(4): 1151 - 1178.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
V. Bhalla, R. Soundararajan, A. C. Pao, H. Li, and D. Pearce
Disinhibitory pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ
Am J Physiol Renal Physiol, October 1, 2006; 291(4): F714 - F721.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arteaga, M. F.
Right arrow Articles by Canessa, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arteaga, M. F.
Right arrow Articles by Canessa, C. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.