AJP - Renal Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 289: F569-F576, 2005. First published May 3, 2005; doi:10.1152/ajprenal.00292.2004
0363-6127/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/3/F569    most recent
00292.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagai, J.
Right arrow Articles by Nielsen, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagai, J.
Right arrow Articles by Nielsen, R.

Mutually dependent localization of megalin and Dab2 in the renal proximal tubule

J. Nagai,1,2 E. I. Christensen,1 S. M. Morris,3 T. E. Willnow,4 J. A. Cooper,3 and R. Nielsen1

1Cell Biology, Institute of Anatomy, University of Aarhus, Aarhus, Denmark; 2Department of Pharmaceutics and Therapeutics, Hiroshima University, Hiroshima, Japan; 3Fred Hutchinson Cancer Research Center, Seattle, Washington; and 4Max-Delbrueck-Center for Molecular Medicine, Berlin, Germany

Submitted 6 August 2004 ; accepted in final form 25 April 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Disabled-2 (Dab2) is a cytoplasmic adaptor protein that binds to the cytoplasmic tail of the multiligand endocytic receptor megalin, abundantly expressed in renal proximal tubules. Deletion of Dab2 induces a urinary increase in specific plasma proteins such as vitamin D binding protein and retinol binding protein (Morris SM, Tallquist MD, Rock CO, and Cooper JA. EMBO J 21: 1555–1564, 2002). However, the subcellular localization of Dab2 in the renal proximal tubule and its function have not been fully elucidated yet. Here, we report the characterization of Dab2 in the renal proximal tubule. Immunohistocytochemistry revealed colocalization with megalin in coated pits and vesicles but not in dense apical tubules and the brush border. Kidney-specific megalin knockout almost abolished Dab2 staining, indicating that Dab2 subcellular localization requires megalin in the proximal tubule. Reciprocally, knockout of Dab2 led to a redistribution of megalin from endosomes to microvilli. In addition, there was an overall decrease in levels of megalin protein observed by immunoblotting but no decrease in clathrin or {alpha}-adaptin protein levels or in megalin mRNA. In rat yolk sac epithelial BN16 cells, Dab2 was present apically and colocalized with megalin. Introduction of anti-Dab2 antibody into BN16 cells decreased the internalization of 125I-labeled receptor-associated protein, substantiating the role of Dab2 in megalin-mediated endocytosis. The present study shows that Dab2 is localized in the apical endocytic apparatus of the renal proximal tubule and that this localization requires megalin. Furthermore, the study suggests that the urinary loss of megalin ligands observed in Dab2 knockout mice is caused by suboptimal trafficking of megalin, leading to decreased megalin levels.

receptor-mediated endocytosis; kidney; adaptor proteins


RECENT RESEARCH HAS DEMONSTRATED that megalin (35) is one of the most important receptors for protein reabsorption in the renal proximal tubules (reviewed in Refs. 4 and 5). The giant endocytic receptor (600 kDa) is abundantly expressed in the endocytic apparatus of the renal proximal tubule, including the brush border, clathrin-coated pits, clathrin-coated vesicles, and dense apical tubules. Its ligands include Ca2+, vitamin binding proteins, apolipoproteins, hormones, enzymes, and drugs as well as receptor-associated protein (RAP), a chaperone for the low-density lipoprotein receptor (LDLR) gene family (38). Megalin has a large NH2-terminal extracellular region, a single transmembrane domain, and a short COOH-terminal cytoplasmic tail (11, 35). The extracellular region contains four clusters of cysteine-rich, complement-type repeats forming the ligand-binding regions characteristic of the LDLR gene family. The sequence of the cytoplasmic tail has little similarity to that of other members of the LDLR gene family except for the NPXY motifs, which are known to serve as the sorting signal for rapid endocytosis of the LDLR via clathrin-coated pits (2, 11, 35).

Disabled-2 (Dab2) was isolated as a phosphoprotein involved in colony-stimulating factor-1 signal transduction (40). Interestingly, Dab2 expression is downregulated during prostate degeneration and in many human carcinomas and accordingly is also called deleted in ovarian cancer-2 (6, 25, 26, 37). In addition, Dab1, a related protein expressed predominantly in the brain, binds to the NPXY motif(s) in the cytoplasmic tail of very low-density lipoprotein receptor and apolipoprotein E receptor 2 through the phosphotyrosine binding (PTB) domain of Dab1 (9, 1216, 22). This interaction between the members of the LDLR gene family and Dab1 plays an important role in neuronal positioning (12, 13, 15). Thus some of the members of the LDLR gene family might serve as transmembrane signal transduction molecules (9, 16, 32, 39).

Much attention has been focused on the involvement of the cytoplasmic tail domain of megalin in subcellular localization, endocytic trafficking, and signaling (5, 3234, 36, 39). The cytoplasmic tail domain of megalin has binding sites for some intracellular protein-protein interaction domains including Src homology 3 (SH3) binding motifs (PXXP) and NPXY motifs, which bind to SH3 domains and PTB domains, respectively (11, 35). Recently, it has been found that Dab2 binds to the cytoplasmic tail of megalin by using in vitro methods such as coimmunoprecipitation and binding assays (33). Furthermore, Morris et al. (29) observed that the deletion of the Dab2 gene in mice induced an increase in urinary excretion of vitamin D binding protein (DBP) and retinol binding protein (RBP), ligands of megalin (5). These observations may indicate an involvement of Dab2 in megalin-mediated endocytosis in renal proximal tubules under in vivo conditions. However, the precise localization of Dab2 in the renal proximal tubules has not been determined, and the role of Dab2 in megalin-mediated endocytosis has not been fully characterized.

The present study was performed to investigate the subcellular localization of Dab2 in the renal proximal tubules by immunohistocytochemistry and to approach the mechanism underlying increased urinary excretion of megalin ligands in Dab2 knockout mice by investigating Dab2 and megalin levels in knockout mouse models.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals

Dab2 conditional knockout mice were prepared by breeding Dab2fl/fl to Dab2+/– Meox2cre/+. This circumvents the embryonic lethality caused by Dab2 deletion, and allows the generation of mice lacking Dab2 genes in most cells (29). Young adult Dab2–/– and Dab2–/+ mice were anesthetized, perfused with 4% paraformaldehyde in PBS, and kidneys were further processed (3). The experimental protocol was approved in advance by the Animal Experiments Inspectorate, Ministry of Justice (Denmark).

The generation of mice carrying a kidney-specific megalin gene deletion has been described before (19). Cre recombinase-mediated inactivation of the megalin gene in the kidney results in a complete loss of receptor expression in ~80–90% of all cells in the renal proximal tubule.

Antibodies

Rabbit anti-Dab2 polyclonal antibody (H-110) and goat anti-clathrin heavy chain polyclonal antibody (C-20) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Sheep anti-megalin polyclonal antibody and rabbit megalin polyclonal antibody were obtained as described previously (3, 24, 41). Mouse anti-{alpha}-adaptin monoclonal antibody was from Affinity BioReagents (Golden, CO). Horseradish peroxidase-conjugated goat anti-rabbit Ig (P448), rabbit anti-sheep Ig (P163), rabbit anti-goat Ig (P449), goat anti-mouse Ig (P447), and TRITC coupled to swine anti-rabbit Ig (R156) were from Dako (Copenhagen, Denmark). Alexa Fluor 488 donkey anti-sheep Ig (A11015) was obtained from Molecular Probes (Leiden, the Netherlands).

Immunocytochemistry

For light microscopy, semithin (0.8 µm) cryosections were cut at –80°C on an FCS Reichert Ultracut S cryomicrotome (Reichert-Jung, Vienna, Austria) and placed on gelatin-coated glass slides. The sections were incubated with rabbit anti-Dab2 antibody (1:20–1:80) or sheep anti-megalin antibody (1:20,000) at room temperature for 1 h following preincubation in 10 mM PBS containing 50 mM glycine and 0.1% skim milk. After incubation for 1 h with horseradish peroxidase-conjugated secondary antibodies, the peroxidase was visualized with diaminobenzidine, and sections were counterstained with Meier’s hematoxylin stain and examined in a Leica DMR microscope equipped with a Sony 3CCD color video camera and a Sony Digital Still recorder (Sony, Tokyo, Japan). For electron microscopy, ultrathin (70–90 nm) cryosections were obtained, and the sections were incubated with rabbit anti-Dab2 antibody (1:80–1:240) and/or sheep anti-megalin antibody (1:20,000) followed by incubation with gold-conjugated secondary antibodies (British BioCell, Cardiff, UK). The cryosections were embedded in 2% methylcellulose containing 0.3% uranyl acetate and were examined in a Phillips CM 100 electron microscope.

Morphometric Determination of Megalin Localization in Kidneys from Normal and Dab2 Knockout Mice

Sections from control and Dab2 knockout mice were prepared for electron microscopy as described above. The sections were stained with sheep anti-megalin antibody 1:20,000 and developed with a secondary antibody conjugated to 10-nm gold particles. Eight randomized pictures were taken from six control and six knockout mice at a magnification of x25,000. All pictures were from tubules that were sectioned in the longitudinal axis of the microvilli. Areas encompassing the microvilli and cytoplasm were measured and gold particles were counted by the use of AnalySIS.

Immunoblotting

Crude kidney membranes for immunoblotting were prepared as described previously (1, 21). Briefly, the excised kidneys were homogenized in an ice-cold buffer (0.3 M sucrose, 25 mM imidazole, 1 mM EDTA, 8.5 µM leupeptin, and 1 mM phenylmethylsulfonyl fluoride, pH 7.2) for 30 s with an IKA Ultra-Turrax T8 homogenizer (IKA Labortenik). The homogenate was centrifuged at 4,000 g for 15 min at 4°C. The supernatant was transferred to an Ultra-Clear tube (Beckman Instruments, Fullerton, CA) and centrifuged at 17,000 g for 30 min at 4°C in an L8–70 M ultracentrifuge (Beckman Instruments) with rotor 70.1 T1. The pellet was suspended in the ice-cold buffer used for the homogenization and was heated for 5 min at 95°C in Laemmli sample buffer containing 2.5% SDS and 1% 2-mercaptoethanol. The samples (5 µg of protein) were run on 3–16% SDS polyacrylamide gradient gels and then transferred to a nitrocellulose membrane for 60 min at 4°C. Subsequently, the membrane was blocked in 5% skim milk in PBS (PBS-T; 80 mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl, 0.1% Tween 20, pH 7.5) for 1 h. The membranes were washed for 15 min in PBS-T followed by washing twice for 5 min and incubated overnight at 4°C with primary antibody in PBS-T with 1% BSA [rabbit anti-Dab2 antibody (1:100), rabbit anti-rat megalin antibody (1:1,000), goat anti-clathrin heavy chain antibody (1:400), or mouse anti-{alpha}-adaptin antibody (1:100)]. After washing for 15 min in PBS-T followed by washing twice for 5 min, the blots were incubated for 1 h with the horseradish peroxidase-conjugated secondary antibody, washed three times in PBS-T, and visualized with enhanced chemiluminescence (Amersham International, Buckinghamshire, UK).

Cell Culture

Rat yolk sac carcinoma (BN16) cells were cultured as described previously (7, 20). Briefly, BN16 cells were grown in 25-cm2 plastic culture flasks (Corning Costar, Badhoevedrop, Holland) in Eagle’s Minimal Essential Medium (Bio-Whittaker, Walkersville, MD) supplemented with 10% fetal calf serum (Biological Industries, Fredensborg, Denmark), 2 mM L-glutamine, 50 U/ml penicillin, and 50 µg/ml streptomycin (Bio-Whittaker) in a humidified atmosphere of 5% CO2-95% air at 37°C. The cells were subcultured every fourth day with a split ratio of 1:5 by using 0.02% EDTA and 0.05% trypsin (Bio-Whittaker). Experiments were carried out with confluent monolayers of BN16 cells cultured in 24-well plates (Nagle Nunc International) for quantitative uptake studies.

Immunofluorescence Microscopy

Colocalization of Dab2 and megalin. Immunohistochemistry was performed on cells grown confluent in flasks, fixed in 2% paraformaldehyde in 0.1 M cacodylate buffer, washed three times in cacodylate buffer, and scraped off in 1% gelatin in cacodylate buffer at 37°C. The cells were centrifuged twice in 1% gelatin, and finally a few drops of 12% gelatin were added. The gelatin containing the cells was cooled on ice and infiltrated with 2.3 M sucrose in 0.01 M PBS, pH 7.4 for 2 h. The blocks were frozen on nails. Sections were made and labeled with a mixture of primary antibodies, rabbit polyclonal anti-Dab2 1:10 (H110) and sheep polyclonal anti-rat megalin 1:4,000, and then incubated with a mixture of secondary antibodies, TRITC coupled to swine anti-rabbit Ig 1:20 and Alexa Fluor 488 donkey anti-sheep IgG (H+L) 1:300.

Effect of anti-Dab2 antibody transfection on iodinated RAP uptake. Anti-Dab2 antibody was transfected into BN16 cells with the BioPorter protein delivery reagent from BioCarta. Briefly, BN16 cells cultured on 24-well plate for 3 days were incubated with the protein delivery reagent (5 µl) containing rabbit polyclonal anti-Dab2 antibody (H-110, 1 µg of protein) in a 5% CO2 incubator at 37°C for 1 h. As a control, the same amount of rabbit Ig (X903, Dako) was used. After being washed three times, the cells were preincubated with serum-free EMEM containing 0.5% ovalbumin for 10 min at 37°C and then were incubated with the above medium including iodinated RAP for 30 min in the 5% CO2 incubator. At the end of the incubation, the uptake buffer was removed and 200 µl of 0.1 M NaOH were added to dissolve the cells. The amount of the ligand taken up by the cells was measured by counting the radioactivity. The difference between the two groups was determined by a Student’s t-test. Protein was determined by a Bio-Rad Protein Assay with bovine serum albumin as the standard.

Northern Blotting

Digoxigenin (Dig)-labeled RNA probes for megalin and actin were produced by RT-PCR and in vitro transcription.

RT. Total RNA was purified from mouse kidney cortex with TRIzol reagent (Invitrogen). Purified RNA (0.1 µg) was incubated in a RT reaction mixture for 30 min at 42°C in a Genius thermocycler (Techne).

PCR. PCR was performed with a Hotstartaq master mix kit (Qiagen), 1 µl of RT, and 10 pmol of each primer. The identity of the products was confirmed by Big Dye termination sequencing and analyzed on an ABI PRISM 310 Genetic Analyzer (PerkinElmer). Megalin primers had the following sequences and localization in the rat sequence (gi 561852): sense 5'-cacaggtgactgtaccagaa-3', position 13762–13781; and antisense 5'-gtgagtgtctaaatgttccc-3', position 14141–14122, giving a 380-bp product. PCR was conducted with an annealing temperature of 60°C. Actin primers had the following sequences and localization in the rat sequence (gi 57573): sense 5' tacgtgggtgatgaggccca 3', position 180–199; and antisense 5' tagccctcatagatgggcac 3', position 529–510, giving a 350-bp product. PCR was conducted with an annealing temperature of 65°C. PCR products containing the T7 promoter sequence were produced from the purified PCR products and the primers described above except that the sense primer included a T7 sequence in the 5'-end. The T7 DNA was used for in vitro transcription in a mixture containing Dig-11-UTP (Roche) to produce the Dig-labeled RNA probes.

Blotting. 10 µg of total RNA was separated on a 1% agarose-2% formaldehyde gel. The loaded amount of RNA was adjusted according to the optical density of the purified RNA. After electrophoresis, the integrity of the RNA was confirmed and the RNA was transferred to a nylon membrane (Roche) by capillary blotting, and finally the RNA was linked to the membrane by UV linking (Hoefer UVC 500). The blots were prehybridized and hybridized with Dig-labeled RNA probes (megalin 20–24 µg, actin 8 µg) overnight at 68°C. Afterward, the blots were washed and blocked. Anti-digoxin-AP conjugate (1:10,000, Sigma) was applied and incubated with CSPD (Roche). The developed bands were quantified by the Fluor-S MultiImager system (Bio-Rad). The intensity of the actin bands was used to standardize the megalin bands.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Localization of Dab2 in the Endocytic Apparatus of the Renal Proximal Tubule

In kidneys from Dab2 knockout mice, Dab2 labeling could not be detected in proximal tubules by light microscopic immunohistochemistry, confirming the complete loss of Dab2 and the specificity of the antibody used for the detection of Dab2 (Fig. 1A). Kidneys from control mice showed a band of Dab2 labeling below the brush border, and labeling of endocytic vacuoles was observed in the cytoplasm of the renal proximal tubules from control mice (Fig. 1B). Electron microscopic immunocytochemistry of cryosections from control mice confirmed labeling of the endocytic apparatus. More specifically, labeling was detected in apical coated pits and apical vesicles but virtually not in dense apical tubules (defined as membrane limited longitudinal structures with diameters slightly smaller than the diameter of a microvillus) (Fig. 2).



View larger version (84K):
[in this window]
[in a new window]
 
Fig. 1. Immunohistochemistry using anti-disabled-2 (Dab2) antibody on cryosections of kidney cortex from a Dab2 knockout mouse (A) and a control mouse (B). Magnification: x1,500.

 


View larger version (129K):
[in this window]
[in a new window]
 
Fig. 2. Electron micrograph of a renal proximal tubule cell from a control rat labeled with anti-Dab2 antibody. Magnification: x50,000. CV, coated vesicle; D, dense apical tubule; BB, brush border. Inset: coated vesicle. Magnification: x160,000.

 
Absence of Dab2 in Megalin-Deficient Cells from Kidney-Specific Megalin Knockout Mice

Kidney-specific megalin knockout mice lack megalin in most but not all kidney cells (19). Investigation of Dab2 in kidney sections from these mice by fluorescence microscopy revealed Dab2 only in cells that still expressed megalin (Fig. 3). Most of the proximal tubule cells apparently lacked both megalin and Dab2. Immunoelectron microscopy for megalin and Dab2 also demonstrated that Dab2 labeling was virtually absent in megalin-deficient cells (Fig. 4). In the renal proximal tubular cells that did express megalin, Dab2 colocalized with megalin in parts of the apical endocytic apparatus such as coated pits and small endocytic vacuoles but was almost undetectable in dense apical tubules, where megalin is present. The reduced staining of Dab2 in megalin–/– cells could be due to a decrease in Dab2 protein levels or due to decreased sensitivity of detection owing to diffuse localization within the cell. These possibilities could not be conclusively distinguished because of the mosaic nature of the kidney-specific knockout. However, immunoblotting of kidney homogenates from mice with megalin knockout in all cells did not reveal any decrease in Dab2 compared with controls (result not shown). This suggests that Dab2 accumulation in apical endocytic pits and vesicles requires megalin.



View larger version (6K):
[in this window]
[in a new window]
 
Fig. 3. Immunofluorescent localization of Dab2 (A) and megalin (B) in kidney-specific megalin knockout mouse. Labeling for Dab2 was seen in some renal proximal tubular cells coinciding with cells containing megalin, whereas lack of Dab2 was observed in neighboring cells also lacking megalin. A section with an unusually high number of megalin-expressing cells is shown. C: merged picture. Magnification: x3,000.

 


View larger version (144K):
[in this window]
[in a new window]
 
Fig. 4. Double immunogold labeling for Dab2 (10-nm gold particles, arrows) and megalin (5-nm gold particles, arrowheads) on ultrathin frozen sections of renal cortex from kidney-specific megalin knockout mice. Magnification: x54,000.

 
Decreased Megalin Levels in Dab2 Knockout Mice

Immunohistocytochemistry for megalin in the proximal tubule from Dab2 knockout mice was examined and compared with megalin in control mouse kidney. As shown in Fig. 5, there was apparently a decrease in the subcellular compartments containing megalin of the renal proximal tubule in addition to an apparent reduction in the number of coated pits and coated vesicles, as described previously (29). Decreased levels of megalin in the apical cytoplasm were supported by morphometric analysis of electron microscopic sections (110 gold particles/µm2 in controls vs. 72 gold particles/µm2 in knockouts, Table 1). Furthermore, this analysis showed that megalin levels were increased in the microvilli (96 gold particles/µm2 and 150 gold particles/µm2 in controls and knockouts, respectively, Table 1). This suggests a redistribution of megalin from vesicles of the apical cytoplasm to microvilli, consistent with decreased endocytosis, when Dab2 is absent.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 5. Immunohistochemistry using anti-megalin antibody on cryosections of kidney cortex from a Dab2 knockout mouse (A) and a control mouse (B). Arrows indicate the cytoplasmic vesicles labeled with anti-megalin antibody. Magnification: x1,200.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Morphometric determination of megalin localization in microvilli and cytoplasm of control and Dab2 knockout mice

 
Surprisingly, immunoblotting of crude membranes from Dab2 knockout mice and control mice revealed an overall decrease in megalin levels when Dab2 was absent (Fig. 6). In contrast, no obvious differences in protein levels of clathrin and {alpha}-adaptin, the {alpha}-subunit of clathrin adaptor protein AP-2, were found between Dab2 knockout mice and control mice. As expected, Dab2 was not detected in kidney from knockout mice. Northern blot analysis did not reveal any differences in megalin mRNA expression between kidneys from Dab2 knockout mice and control mice (Fig. 7).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 6. Immunoblotting of Dab2, megalin, cubilin, clathrin heavy chain (HC), and {alpha}-adaptin in crude membrane fractions of kidney from Dab2 knockout mice and control mice.

 


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 7. Northern blot analysis for megalin mRNA in kidneys from Dab2 knockout mice and control mice.

 
This suggests that decreases in megalin protein levels are due to a decreased rate of protein synthesis or increased megalin protein turnover.

Involvement of Dab2 in Megalin-Mediated Endocytosis

To examine the role of Dab2 in receptor-mediated endocytosis, uptake studies were performed in BN16 cells, a cell line derived from the rat yolk sac highly expressing megalin. First, we performed double labeling immunofluorescence on confluent BN16 cell monolayers with anti-Dab2 antibody and anti-megalin antibody. The labeling pattern for Dab2 was present apically and partly colocalized with megalin (Fig. 8). Next, we introduced anti-Dab2 antibody into the confluent BN16 cell monolayers to inhibit the function of Dab2, and then uptake and binding of iodinated RAP in the cells was measured (Fig. 9). Uptake and binding of 125I-RAP was slightly but significantly reduced in the transfected cells.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 8. Immunofluorescent localization of Dab2 (A) and megalin (B) in BN16 cells. The merged image (C) indicates that Dab2 and megalin are partly colocalized (yellow). Magnification: x1,000 (AC).

 


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 9. Effect of transfection of anti-Dab2 antibody on 125I- receptor-associated protein (RAP) uptake in confluent BN16 cell monolayers. Confluent monolayers of BN16 cells were incubated in the presence of rabbit anti-Dab2 antibody or normal rabbit Ig. Each column is the mean ± SE of 5 monolayers. **P < 0.01, significantly different from control Ig.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Dab2 is present in various tissues, including heart, lung, liver and skeletal muscle, and is highly abundant in the kidney (6, 29), where it has been localized to the renal proximal tubule by immunohistochemistry (29, 33). Dab2 has been demonstrated to bind to the cytoplasmic tail of megalin by several approaches, such as two-hybrid screening, protein binding assay, and coimmunoprecipitation (33). Recently, an increase in urinary excretion of specific plasma proteins such as DBP and RBP in Dab2 knockout mice was reported (29). These proteins represent ligands to megalin. Thus Dab2 may play an important role in megalin-mediated endocytosis in the renal proximal tubule. The present study has been performed to clarify the cellular localization of Dab2 in the renal proximal tubule and its role in megalin-meditated endocytosis.

We found that Dab2 is abundantly expressed in parts of the apical endocytic apparatus such as coated pits and coated vesicles, but it is almost absent in the brush border and dense apical tubules of the renal proximal tubules from normal mice. The low Dab2 staining in the brush border is in contrast to immunofluorescence data obtained by Oleinikov et al. (33). The reason for this discrepancy is unknown and difficult to comment on as micrographs were not shown in the paper of Oleinikov et al. However, in fibroblasts and nonpolarized epithelial cells (HeLa), Dab2 localization depends on a region that binds to adaptin and clathrin (23, 27), which are present in coated structures and not associated with the microvillar membrane. Immunoelectron microscopic analysis revealed that labeling for Dab2 was present at the cytoplasmic side of the vesicular membrane of the endocytic apparatus, suggesting that Dab2 serves as a cytoplasmic adaptor protein mediating protein-protein interactions. In addition, colocalization of megalin and Dab2 was observed in apical coated pits and vesicles but not in dense apical tubules of the renal proximal tubules. Considering that the cytoplasmic tail of megalin has been shown to interact with Dab2 (33), Dab2 may be involved in megalin-mediated endocytosis in the renal proximal tubular cells by directly interacting with the cytoplasmic tail of megalin during endocytosis, but dissociating from megalin during recycling of the receptor. Similarly, Dab2 was absent from uncoated endosomes in fibroblasts (27).

Analysis of kidney-specific megalin knockout mice, which show a severe impairment in renal absorption of protein owing to a significant decrease in the number of proximal tubular cells expressing megalin (8, 19), revealed that Dab2 localization to the endocytic apparatus is strictly dependent on megalin. An almost complete loss of Dab2 in the endocytic apparatus was observed in megalin-deficient cells of the renal proximal tubule, whereas Dab2 was expressed normally and partly colocalized with megalin in normal tubular cells expressing megalin. These results suggest that the association of Dab2 with coated pits in polarized cells may require cooperative association with the megalin cargo as well as with clathrin and AP-2, whereas in fibroblasts the association with coated pits appears to be independent of cargo (27).

Several recent studies (10, 23, 27) have demonstrated that Dab2 interacts directly with phosphoinositides, clathrin, and the {alpha}-adaptin subunit of clathrin AP-2, which are components of clathrin-coated pits and vesicles. The subcellular localization of Dab2 in nonpolarized cells is not due to the PTB domain but to the central region that binds to the {alpha}-adaptin subunit of AP-2 (23, 27). In addition, a COOH-terminal region of Dab2 binds to myosin VI, an actin-based motor protein involved in cargo movement such as vesicular trafficking (17, 28). Thus it is possible that none of the interactions is tight enough on its own to recruit Dab2, and the absence of megalin is enough to reduce formation of clathrin-, AP-2-, and Dab2-containing structures. Alternatively, the absence of Dab2 in the endocytotic compartments of megalin-deficient cells may be due to a lack of proteins other than megalin that could regulate the localization of Dab2. In fact, clathrin and {alpha}-adaptin are less concentrated in apical endocytic structures in megalin knockout mice, as judged by immunohistochemistry (results not shown).

Megalin protein levels and subcellular localization also depend on Dab2. Electron immunohistochemical analysis showed a decrease in megalin in endosomes, and an increase in megalin in microvilli, in renal proximal tubular cells from Dab2 knockout mice, consistent with a role for Dab2 in megalin endocytosis. Surprisingly, total megalin levels were reduced in Dab2 knockout mice, as observed by immunoblotting. However, there was no significant change in megalin mRNA level between Dab2 knockout mice and control mice, suggesting that the decrease in megalin protein is due to decreased protein synthesis or increased protein turnover. The first and third NPXY motifs in the cytoplasmic tail of megalin are responsible for efficient endocytosis, whereas the second NPXY-like motif is essential for the apical sorting of megalin (36). In addition, the third NPXY motif has been suggested to be involved in the interaction between the PTB domain of Dab2 and the cytoplasmic tail of megalin (33). Therefore, a decrease in megalin levels in Dab2 knockout mice may result from an impaired trafficking of megalin through the endocytic/recycling pathway, leading to increased megalin shedding or degradation.

Even though Dab2 interacts with clathrin and AP-2, and there is a decrease in the number of apical coated pits and apical coated vesicles in the renal proximal tubular cells from Dab2 knockout mice (29) and megalin knockout mice (18), the levels of clathrin and {alpha}-adaptin in Dab2 knockout mouse kidneys were normal. Immunohistochemistry for clathrin also revealed equal levels in Dab2 knockout mice and control mice (data not shown).

To investigate the impact of decreased megalin levels induced by Dab2 knockout, we transfected anti-Dab2 rabbit antibodies into BN16 cells. This slightly but significantly decreased internalization of RAP, a high-affinity ligand for megalin, compared with that of control rabbit Ig. This is in accordance with the observations obtained by immunohistochemistry in Dab2 knockout mice, where deletion of Dab2 does not completely abolish endocytosis of RBP and DBP (results not shown).

Dab2 knockout mice present an increase in urinary excretion of DBP and RBP, but the increases are not as severe as in full megalin knockout mice, which exhibit vitamin D deficiency and bone formation defects (31). Indeed, there was a decreased endosomal level of megalin in Dab2 knockout mice, and megalin protein levels were reduced but not completely disrupted by the absence of Dab2. Thus another adaptor protein binding to the cytoplasmic tail of megalin, such as autosomal recessive hypercholesterolemia (30), may substitute for Dab2 in Dab2 knockout mice.

In conclusion, these experiments show the presence of Dab2 in coated structures of the endocytic apparatus of the proximal tubule. Here, its presence seems to be dependent on megalin or other factors associated with megalin. On the other hand, knockout of the Dab2 gene decreases megalin levels and alters the subcellular distribution of megalin. These results indicate that Dab2 and megalin mutually regulate each other’s localization in renal proximal tubule cells.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was funded by Novo Nordisk, the Karen Elise Jensen Foundation, National Institute of General Medical Sciences Grant GMO-66257, The European Commission (EU, Framework Program 6, EureGene, contact number 05085), and The Carlsberg Foundation.


    ACKNOWLEDGMENTS
 
The authors thank Inger Blenker Kristoffersen, Hanne Sidelmann, Pia Kamuk Nielsen, Anne Merete Hass, and Priscilla Kronstadt O’Brien for excellent technical assistance.


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. Nielsen, Cell Biology, Institute of Anatomy, Univ. of Aarhus, University Park, Bldg. 234, DK-8000 Aarhus C, Denmark (e-mail address: rn{at}ana.au.dk)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Birn H, Vorum H, Verroust PJ, Moestrup SK, and Christensen EI. Receptor-associated protein is important for normal processing of megalin in kidney proximal tubules. J Am Soc Nephrol 11: 191–202, 2000.[Abstract/Free Full Text]
  2. Chen WJ, Goldstein JL, and Brown MS. NPXY, a sequence often found in cytoplasmic tails, is required for coated pit-mediated internalization of the low density lipoprotein receptor. J Biol Chem 265: 3116–3123, 1990.[Abstract/Free Full Text]
  3. Christensen EI, Nielsen S, Moestrup SK, Borre C, Maunsbach AB, de Heer E, Ronco P, Hammond TG, and Verroust P. Segmental distribution of the endocytosis receptor gp330 in renal proximal tubules. Eur J Cell Biol 66: 349–364, 1995.[Web of Science][Medline]
  4. Christensen EI and Birn H. Megalin and cubilin: synergistic endocytic receptors in renal proximal tubule. Am J Physiol Renal Physiol 280: F562–F573, 2001.[Abstract/Free Full Text]
  5. Christensen EI and Birn H. Megalin and cubilin: multifunctional endocytic receptors. Nat Rev Mol Cell Biol 3: 256–266, 2002.[Medline]
  6. Fazili Z, Sun W, Mittelstaedt S, Cohen C, and Xu XX. Disabled-2 inactivation is an early step in ovarian tumorigenicity. Oncogene 18: 3104–3113, 1999.[CrossRef][Web of Science][Medline]
  7. Gburek J, Verroust PJ, Willnow TE, Fyfe JC, Nowacki W, Jacobsen C, Moestrup SK, and Christensen EI. Megalin and cubilin are endocytic receptors involved in renal clearance of hemoglobin. J Am Soc Nephrol 13: 423–430, 2002.[Abstract/Free Full Text]
  8. Gburek J, Birn H, Verroust PJ, Goj B, Jacobsen C, Moestrup SK, Willnow TE, and Christensen EI. Renal uptake of myoglobin is mediated by the endocytic receptors megalin and cubilin. Am J Physiol Renal Physiol 285: F451–F458, 2003.[Abstract/Free Full Text]
  9. Gotthardt M, Trommsdorff M, Nevitt MF, Shelton J, Richardson JA, Stockinger W, Nimpf J, and Herz J. Interactions of the low density lipoprotein receptor gene family with cytosolic adaptor and scaffold proteins suggest diverse biological functions in cellular communication and signal transduction. J Biol Chem 275: 25616–25624, 2000.[Abstract/Free Full Text]
  10. Hirst J and Robinson MS. Clathrin and adaptors. Biochim Biophys Acta 1404: 173–193, 1998.[Medline]
  11. Hjalm G, Murray E, Crumley G, Harazim W, Lundgren S, Onyango I, Ek B, Larsson M, Juhlin C, Hellman P, Davis H, Akerstrom G, Rask L, and Morse B. Cloning and sequencing of human gp330, a Ca2+-binding receptor with potential intracellular signaling properties. Eur J Biochem 239: 132–137, 1996.[Web of Science][Medline]
  12. Howell BW, Gertler FB, and Cooper JA. Mouse disabled (mDab1): a Src binding protein implicated in neuronal development. EMBO J 16: 121–132, 1997.[CrossRef][Web of Science][Medline]
  13. Howell BW, Hawkes R, Soriano P, and Cooper JA. Neuronal position in the developing brain is regulated by mouse disabled-1. Nature 389: 733–737, 1997.[CrossRef][Medline]
  14. Howell BW, Lanier LM, Frank R, Gertler FB, and Cooper JA. The disabled 1 phosphotyrosine-binding domain binds to the internalization signals of transmembrane glycoproteins and to phospholipids. Mol Cell Biol 19: 5179–5188, 1999.[Abstract/Free Full Text]
  15. Howell BW, Herrick TM, and Cooper JA. Reelin-induced tyrosine phosphorylation of disabled 1 during neuronal positioning. Genes Dev 13: 643–648, 1999.[Abstract/Free Full Text]
  16. Howell BW and Herz J. The LDL receptor gene family: signaling functions during development. Curr Opin Neurobiol 11: 74–81, 2001.[CrossRef][Web of Science][Medline]
  17. Inoue A, Sato O, Homma K, and Ikebe M. DOC-2/DAB2 is the binding partner of myosin VI. Biochem Biophys Res Commun 292: 300–307, 2002.[CrossRef][Web of Science][Medline]
  18. Leheste JR, Rolinski B, Vorum H, Hilpert J, Nykjaer A, Jacobsen C, Aucouturier P, Moskaug JO, Otto A, Christensen EI, and Willnow TE. Megalin knockout mice as an animal model of low molecular weight proteinuria. Am J Pathol 155: 1361–1370, 1999.[Abstract/Free Full Text]
  19. Leheste JR, Melsen F, Wellner M, Jansen P, Schlichting U, Renner-Muller I, Andreassen TT, Wolf E, Bachmann S, Nykjær A, and Willnow TE. Hypocalcemia and osteopathy in mice with kidney-specific megalin gene defect. FASEB J 17: 247–249, 2003.[Abstract/Free Full Text]
  20. Le Panse S, Verroust P, and Christensen EI. Internalization and recycling of glycoprotein 280 in BN/MSV yolk sac epithelial cells: a model system of relevance to receptor-mediated endocytosis in the renal proximal tubule. Exp Nephrol 5: 375–383, 1997.[Web of Science][Medline]
  21. Marples D, Knepper MA, Christensen EI, and Nielsen S. Redistribution of aquaporin-2 water channels induced by vasopressin in rat kidney inner medullary collecting duct. Am J Physiol Cell Physiol 269: C655–C664, 1995.[Abstract/Free Full Text]
  22. Margolis B, Borg JP, Straight S, and Meyer D. The function of PTB domain proteins. Kidney Int 56: 1230–1237, 1999.[CrossRef][Web of Science][Medline]
  23. Mishra SK, Keyel PA, Hawryluk MJ, Agostinelli NR, Watkins SC, and Traub LM. Disabled-2 exhibits the properties of a cargo-selective endocytic clathrin adaptor. EMBO J 21: 4915–4926, 2002.[CrossRef][Web of Science][Medline]
  24. Moestrup SK, Nielsen S, Andreasen P, Jorgensen KE, Nykjær A, Roigaard H, Gliemann J, and Christensen EI. Epithelial glycoprotein-330 mediates endocytosis of plasminogen activator-plasminogen activator inhibitor type-1 complexes. J Biol Chem 268: 16564–16570, 1993.[Abstract/Free Full Text]
  25. Mok SC, Wong KK, Chan RK, Lau CC, Tsao SW, Knapp RC, and Berkowitz RS. Molecular cloning of differentially expressed genes in human epithelial ovarian cancer. Gynecol Oncol 52: 247–252, 1994.[CrossRef][Web of Science][Medline]
  26. Mok SC, Chan WY, Wong KK, Cheung KK, Lau CC, Ng SW, Baldini A, Colitti CV, Rock CO, and Berkowitz RS. DOC-2, a candidate tumor suppressor gene in human epithelial ovarian cancer. Oncogene 16: 2381–2387, 1998.[CrossRef][Web of Science][Medline]
  27. Morris SM and Cooper JA. Disabled-2 colocalizes with the LDLR in clathrin-coated pits and interacts with AP-2. Traffic 2: 111–123, 2001.[CrossRef][Web of Science][Medline]
  28. Morris SM, Arden SD, Roberts RC, Kendrick-Jones J, Cooper JA, Luzio JP, and Buss F. Myosin VI binds to and localizes with Dab2, potentially linking receptor-mediated endocytosis and the actin cytoskeleton. Traffic 3: 331–341, 2002.[CrossRef][Web of Science][Medline]
  29. Morris SM, Tallquist MD, Rock CO, and Cooper JA. Dual roles for the Dab2 adaptor protein in embryonic development and kidney transport. EMBO J 21: 1555–1564, 2002.[CrossRef][Web of Science][Medline]
  30. Nagai M, Meerloo T, Takeda T, and Farquhar MG. The adaptor protein ARH escorts megalin to and through endosomes. Mol Biol Cell 14: 4984–4996, 2003.[Abstract/Free Full Text]
  31. Nykjær A, Dragun D, Walther D, Vorum H, Jacobsen C, Herz J, Melsen F, Christensen EI, and Willnow TE. An endocytic pathway essential for renal uptake and activation of the steroid 25-(OH) vitamin D3. Cell 96: 507–515, 1999.[CrossRef][Web of Science][Medline]
  32. Nykjær A and Willnow TE. The low-density lipoprotein receptor gene family: a cellular Swiss Army knife? Trends Cell Biol 12: 273–280, 2002.[CrossRef][Web of Science][Medline]
  33. Oleinikov AV, Zhao J, and Makker SP. Cytosolic adaptor protein Dab2 is an intracellular ligand of endocytic receptor gp600/megalin. Biochem J 347: 613–621, 2000.[CrossRef][Medline]
  34. Rader K, Orlando RA, Lou X, and Farquhar MG. Characterization of ANKRA, a novel ankyrin repeat protein that interacts with the cytoplasmic domain of megalin. J Am Soc Nephrol 11: 2167–2178, 2000.[Abstract/Free Full Text]
  35. Saito A, Pietromonaco S, Loo AK, and Farquhar MG. Complete cloning and sequencing of rat gp330/"megalin," a distinctive member of the low density lipoprotein receptor gene family. Proc Natl Acad Sci USA 91: 9725–9729, 1994.[Abstract/Free Full Text]
  36. Takeda T, Yamazaki H, and Farquhar MG. Identification of an apical sorting determinant in the cytoplasmic tail of megalin. Am J Physiol Cell Physiol 284: C1105–C1113, 2003.[Abstract/Free Full Text]
  37. Tseng CP, Ely BD, Li Y, Pong RC, and Hsieh JT. Regulation of rat DOC-2 gene during castration-induced rat ventral prostate degeneration and its growth inhibitory function in human prostatic carcinoma cells. Endocrinology 139: 3542–3553, 1998.[Abstract/Free Full Text]
  38. Willnow TE, Rohlmann A, Horton J, Otani H, Braun JR, Hammer RE, and Herz J. RAP, a specialized chaperone, prevents ligand-induced ER retention and degradation of LDL receptor-related endocytic receptors. EMBO J 15: 2632–2639, 1996.[Web of Science][Medline]
  39. Willnow TE, Nykjær A, and Herz J. Lipoprotein receptors: new roles for ancient proteins. Nat Cell Biol 1: E157–E162, 1999.[CrossRef][Web of Science][Medline]
  40. Xu XX, Yang W, Jackowski S, and Rock CO. Cloning of a novel phosphoprotein regulated by colony-stimulating factor 1 shares a domain with the Drosophila disabled gene product. J Biol Chem 270: 14184–14191, 1995.[Abstract/Free Full Text]
  41. Zhai XY, Nielsen R, Birn H, Drumm K, Mildenberger S, Freudinger R, Moestrup SK, Verroust PJ, Christensen EI, and Gekle M. Cubilin- and megalin-mediated uptake of albumin in cultured proximal tubule cells of opossum kidney. Kidney Int 58: 1523–1533, 2000.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Nielsen, P. J. Courtoy, C. Jacobsen, G. Dom, W. R. Lima, M. Jadot, T. E. Willnow, O. Devuyst, and E. I. Christensen
Endocytosis provides a major alternative pathway for lysosomal biogenesis in kidney proximal tubular cells
PNAS, March 27, 2007; 104(13): 5407 - 5412.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. E. Maurer and J. A. Cooper
The adaptor protein Dab2 sorts LDL receptors into coated pits independently of AP-2 and ARH
J. Cell Sci., October 15, 2006; 119(20): 4235 - 4246.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. E. Maurer and J. A. Cooper
Endocytosis of megalin by visceral endoderm cells requires the Dab2 adaptor protein
J. Cell Sci., November 15, 2005; 118(22): 5345 - 5355.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/3/F569    most recent
00292.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagai, J.
Right arrow Articles by Nielsen, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagai, J.
Right arrow Articles by Nielsen, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.