AJP - Renal Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Renal Physiol 290: F828-F837, 2006. First published December 6, 2005; doi:10.1152/ajprenal.00310.2005
0363-6127/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/F828    most recent
00310.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Awad, A. S.
Right arrow Articles by Okusa, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Awad, A. S.
Right arrow Articles by Okusa, M. D.

Adenosine A2A receptor activation attenuates inflammation and injury in diabetic nephropathy

Alaa S. Awad,1 Liping Huang,1 Hong Ye,1 Elizabeth Thu Anh Duong,1 W. Kline Bolton,1 Joel Linden,1,2 and Mark D. Okusa1,2

Departments of 1Medicine and the 2Cardiovascular Research Center, University of Virginia, Charlottesville, Virginia

Submitted 1 August 2005 ; accepted in final form 8 November 2005


   ABSTRACT
TOP
 ABSTRACT
METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We previously demonstrated the anti-inflammatory effects and renal tissue protection in response to adenosine A2A-receptor (A2AR) activation in acute renal injury. We sought to extend these studies and determine the efficacy of A2AR agonists in a chronic model of renal injury. We hypothesized that A2A agonists mediate renal tissue protection in diabetic nephropathy by reducing glomerular inflammation. Diabetes was induced with single intravenous injection of streptozotocin in Sprague-Dawley rats (50 mg/kg). Increases in urinary albumin excretion (UAE) and plasma creatinine at week 6 in the diabetes group (26- and 6-fold over control, respectively) were markedly reduced by continuous subcutaneous administration of ATL146e (10 ng·kg–1·min–1), a selective A2A agonist. The increase in UAE in the diabetes group was associated with a significant reduction in the expression of slit diaphragm-associated molecules compared with control (nephrin; P < 0.05 and podocin; P < 0.005) that was reversed by ATL146e treatment. Diabetes led to an increase in urinary excretion of monocyte chemoattractant protein-1 (705% of control), TNF-{alpha} (1,586% of control), IFN-{gamma} (298% of control), kidney fibronectin mRNA (457% of control), and glomerular infiltration of macrophages (764% of control), effects significantly reduced by ATL146e treatment. Mesangial expansion and basement membrane thickness were reduced with ATL146e. To further confirm the selectivity of ATL146e, we used wild-type (WT) or A2Aknockout (A2A-KO) mice. Four weeks after diabetes, UAE increased significantly in both WT and A2A-KO diabetic mice (3.0- and 3.3-fold over control). A2A agonist treatment blocked the increase in UAE in WT diabetic mice (P < 0.001), whereas it had no effect on the A2A-KO diabetic mice. These results demonstrate that chronic A2AR activation in diabetic rats 1) ameliorates histological and functional changes in kidneys induced by diabetes and 2) causes reduced inflammation associated with diabetic nephropathy.

proteinuria; diabetes; macrophage; kidney; ATL146e

DIABETES MELLITUS IS the most common cause of end-stage renal disease (ESRD), responsible for more than 40% of all cases in the United States (1, 52), and this number is likely to continue to increase unabated. Current therapy, including blood pressure and glucose control and treatment with blockers of the renin-angiotensin system, has been modestly successful in delaying the progression of renal failure. More robust outcomes might be achieved through interventions that reverse pathophysiological changes caused by diabetic nephropathy.

Inflammation in the genesis of diabetes as well as its complications has attracted recent interest. Evidence suggests that monocytes/macrophages and their adherence to endothelial cells contribute to the pathogenesis of diabetic nephropathy (19, 54). The subsequent immune response leads to fibrosis and matrix deposition and progressive renal insufficiency. Increased kidney macrophages, mainly in the glomeruli and interstitium, and kidney expression of monocyte chemoattractant protein (MCP-1) were correlated with the duration and severity of renal injury in diabetes (13). Infiltrated macrophages release lysosomal enzymes, nitric oxide, reactive oxygen species (ROS), transforming growth factor-beta (TGF-beta), tumor necrosis factor-{alpha} (TNF-{alpha}), and interleukin-1 (IL-1) (14, 34, 41) that may play a pivotal role in the development and progression of diabetic nephropathy. These data support the role of macrophages and potentially other bone marrow-derived cells in the genesis and maintenance of inflammation, increased ROS, and endothelial dysfunction in the pathogenesis of diabetic complications.

Adenosine has many diverse functions, all of which are dependent on its interaction with the receptor subtypes: A1, A2A, A2B, and A3(28, 39). Activation of adenosine A2A receptors (A2ARs) has potent anti-inflammatory effects (10, 37, 49, 50). A2ARs are found in the glomeruli (53) as well as in monocyte/macrophages, neutrophils, T cells, and other bone marrow-derived cells (20) that are poised, on activation, to abrogate the immune response. Recently, highly selective A2A agonists have demonstrated a high degree of potency in blocking inflammation primarily by activating bone marrow-derived cells (15). Therefore, we tested the hypothesis that A2A agonists administered chronically, in a dose that does not produce systemic hemodynamic effects, attenuate inflammation and renal injury associated with diabetic nephropathy. Our results demonstrate that early administration of A2A agonists markedly reduces macrophage infiltration, inflammation, functional and histological changes associated with diabetic nephropathy. We believe that A2A agonists represent a new class of compounds in the prevention and treatment of diabetic complications.


   METHODS
TOP
 ABSTRACT
 METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Induction of diabetes. Experiments were conducted in 14-wk-old conscious Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) weighing 245–255 g and approved by the University of Virginia Animal Research Committee. Additional experiments was conducted in ~7- to 8-wk-old C57BL/6 mice [wild-type (WT); Charles River Laboratories] and mice that lack A2AR (A2A-KO; C57BL/6 background) weighing ~20 g (11). After an overnight fast, under brief vaporized halothane anesthesia (Halothan Vapor 19.1), animals were given a single intravenous injection via tail vein of vehicle or streptozotocin (STZ; Sigma, St. Louis, MO; rats 50 mg/kg body wt; mice 100 mg/kg body wt dissolved in lactated Ringer solution). After STZ injection, a 5% dextrose solution was administered subcutaneously (rat 5 ml; mice 2 ml). Establishment of diabetes was confirmed at 48 h after STZ induction and at weekly intervals by measuring fasting (8 h) blood glucose levels >250 mg/dl (Accu-Chek glucometer, Boehringer Mannheim, Indianapolis, IN).

Drug delivery. Rats were anesthetized with ketamine (80 mg/kg ip) and xylazine (8 mg/kg ip). Osmotic minipumps (model 2004; ALZA, Palo Alto, CA) containing vehicle or ATL146e (10 ng·kg–1·min–1) 3 days before (ATL146e –3D) or 7 days after (ATL146e +7D) induction of diabetes (prepared in PBS containing <0.01% DMSO) were inserted subcutaneously. In another experiments, osmotic minipumps containing ATL313 (1 ng·kg–1·min–1) were inserted subcutaneously in mice or rats 3 days before STZ induction of diabetes (15). These doses of A2A agonists do not have systemic hemodynamic effect (38). After recovery from surgery, rats and mice were housed in individual cages under standard controlled conditions.

Study protocol. In this study, we used two protocols for rats. In the first protocol, rats (n = 28) were placed in metabolic cages. Twenty-four-hour urinary collection for albumin excretion (UAE) rate was obtained at baseline. Rats were then randomly divided into a control group (n = 8) and diabetes groups (n = 20). The diabetes group was randomly divided into vehicle (n = 8), ATL146e –3D (n = 8), or ATL146e +7D (n = 4) groups. Twenty-four-hour urine collections were obtained at 2, 4, and 6 wk in all groups. At the end of the study, animals were anesthetized and tissue and plasma were collected and animals were euthanized.

In the second protocol, rats (n = 12) were randomly divided into a control group, diabetes group treated with vehicle, and diabetes group treated with ATL313 (n = 4 each group). Twenty-four-hour urine collections were obtained at 6 wk in all groups for measurement of UAE.

To determine the specificity of A2A agonist effect, WT and A2A-KO mice were randomly divided into control, diabetes, or diabetes + ATL313 groups (n = 4 each group) and 24-h urine collections were obtained at 4 wk in all groups for measurement of UAE.

Blood pressure measurement. Systolic blood pressure (SBP) was measured via the tail-cuff method as described previously (15) (IITC model 179, IITC/Life Science Instruments, Woodland Hills, CA). Rats or mice were allowed to rest quietly for 10 min at 26°C. All measurements were performed at the same time for all groups to prevent any diurnal variations and were measured twice and then averaged.

Histochemistry and immunohistochemistry. Kidneys from rats were fixed in 4% paraformaldehyde and embedded in paraffin, and 5-µm sections were cut. Sections were stained with Gomori's trichrome reagents. Sections were examined (WKB) in a masked fashion under x400 magnification by light microscopy (Zeiss AxioSkop). The measured parameters were 1) interstitial fibrosis, 2) size of the mesangium, and 3) the tubular basement membrane thickness. Assessment of fibrosis was based on the intensity of trichrome staining as well as change from normal morphology, compared with normal age-matched control rat tissue. A semiquantitative score (0–4+) was assigned based on the masked reading, as previously described (12).

Immunohistochemistry for macrophages was performed in rats using mouse anti-rat ED1+ monoclonal antibody (Serotec, Oxford, UK) on paraffin sections as described previously (23, 35). Sections were incubated with primary antibody (1 µg/ml) followed by a biotinylated goat IgG anti-rat (Vector Laboratories, Burlingame, CA) secondary antibody. A peroxidase reaction was performed according to the manufacturer's protocol. Sections were viewed using a Zeiss AxioSkop microscope, and digital images were taken using a SPOT RT Camera (software version 3.3; Diagnostic Instruments, Sterling Heights, MI). The number of macrophages was counted in eight consecutive nonoverlapping fields (interstitium) or glomerulus (glomeruli) on blinded fashion under x400 magnification and averaged.

Quantitative real-time PCR. Total RNA was extracted from rat kidneys using RNeasy Mini Kit (Qiagen, Gumbh, Hilden, Germany). The quality of RNA was confirmed by size separating total RNA using 2% agarose gel with subsequent staining with ethidium bromide. Single-strand cDNA was synthesized using iScript cDNA Synthesis Kits (Bio-Rad, Hercules, CA) for two-step real-time RT-PCR. Gene-specific primers for nephrin, podocin, and fibronectin were designed using Beacon Designer Probe/Primer Design Software (Premier Biosoft International, Palo Alto, CA). The sense primers were GCAGTGGGCTAAGGATGG, GCCTTGGACTCAGTGACC, and GGAGTGGAAGTGTGAGCGAC, and the antisense primers were GAGGTCACAGGCTTCAATAAG, GCAATCACCCGCACTTTG, and GTGGGTCTGGGGTTGGTAAATAG (Integrated DNA Technologies, Coralville, IA), respectively. The corresponding cDNA product sizes were 124, 140, and 97 bp, respectively. Amplification products were verified by melting curves and agarose gel electrophoresis. Quantitative real-time PCR was performed using MyIQ Single Color Real-Time PCR Detection System iCycler (Bio-Rad). Reactions were performed in duplicate, and threshold cycle numbers were averaged. Samples were calculated with normalization to GAPDH. Fold overexpression was calculated according to the formula 2(Rt – Et)/2(Rn – En), where Rt is the threshold cycle number for the reference gene observed in the test sample, Et is the threshold cycle number for the experimental gene observed in the test sample, Rn is the threshold cycle number for the reference gene observed in the control sample, and En is the threshold cycle number for the experimental gene observed in the control sample.

Analytic methods. UAE was measured by ELISA using Nephrat kit for rats or Albuwell M for mice (Exocell, Philadelphia, PA) as described previously (25). Plasma and urine MCP-1, TNF-{alpha}, and IFN-{gamma} were measured by ELISA (Pharmingen, San Diego, CA) (25). Plasma creatinine concentration was determined at the end of the study using a colorimetric assay according to the manufacturer's protocol (Sigma).

Statistical analysis. Comparisons between groups were examined by one-way ANOVA by using SPSS version 13.0 software for Windows (SPSS, Chicago, IL) program. Multiple comparisons of individual pairs of effect means were conducted by using the least squares methods of pooled variance. Data are expressed as means ± SE. Statistical significance was identified at P < 0.05.


   RESULTS
TOP
 ABSTRACT
 METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Effects of A2A agonists on blood glucose, body weight, and SBP in rats. Tables 1 and 2 summarize the data for blood glucose, body weight, and SBP in rats treated with ATL146e or ATL313. Blood glucose levels increased significantly in the diabetes groups treated with vehicle or A2A agonists 48 h after STZ injection and continued to be elevated throughout the study period. Control rats gained weight as expected. The increase in body weight in vehicle and treatment groups was modest. In rats treated with ATL146e, there were no significant changes in SBP 3 wk after STZ induction of diabetes between all groups. SBP was significantly higher after 6 wk in vehicle and ATL146e +7D groups compared with control and ATL146e –3D groups. In rats treated with ATL313, there was no significant change in SBP between groups throughout the study.


View this table:
[in this window]
[in a new window]
  		Table 1. Changes in BG, BW, and SBP in control, untreated diabetic, and diabetic rats treated with ATL146e –3D or ATL146e +7D

 

View this table:
[in this window]
[in a new window]
  		Table 2. Changes in BG, BW, and SBP in control, untreated diabetic, and diabetic rats treated with ATL313

 
Effects of A2A agonists on renal function in diabetes. In rats treated with ATL146e, UAE rate was 135 ± 23 µg/24 h at baseline and increased to 2,629 ± 272 µg/24 h (P < 0.0001) at week 6 in the diabetic group treated with vehicle (Fig. 1A). ATL146e administered to diabetics rats reduced albuminuria at week 6 in ATL146e –3D or ATL146e +7D groups to 614 ± 79 µg/24 h (P < 0.001 from vehicle) and 568 ± 109 µg/24 h (P < 0.001 from vehicle), respectively. At week 6, plasma creatinine was significantly higher in diabetic animals treated with vehicle (1.6 ± 0.3 mg/dl; P < 0.01) compared with the control (0.25 ± 0.02 mg/dl), ATL146e –3D (0.29 ± 0.05 mg/dl), and ATL146e +7D (0.6 ± 0.3 mg/dl) groups (Fig. 1B).


Figure 1
View larger version (23K):
[in this window]
[in a new window]
  		Fig. 1. Effects of ATL146e on urinary albumin excretion (UAE) rate (UAER) and plasma creatinine in diabetic rats. A: urine collections were obtained for measurement of UAE in rats by ELISA at baseline, 2, 4, and 6 wk of the study. B: plasma creatinine concentration was determined in rats at the end of the study (6 wk). Open bars, control rats; filled bars, diabetic rats; light gray bars, diabetic rats treated with ATL146e –3D; dark gray bars, diabetic rats treated with ATL146e +7D. Data are means ± SE. *P < 0.05, **P < 0.001, ***P < 0.0001 to control; +P < 0.05, ++P < 0.01, +++P < 0.001 to diabetes.

 
We next examined a new A2A agonist, ATL313, a compound that has similar selectivity as ATL146e at the A2AR but has a longer T1/2life (16). As shown in Fig. 2A, UAE rate was 295 ± 61 µg/24 h in the control group and increased to 1,726 ± 334 µg/24 h (P < 0.01) at week 6 in the diabetes group treated with vehicle, effects significantly reduced by ATL313 administration to 521 ± 55 µg/24 h (P < 0.005 from vehicle).


Figure 2
View larger version (21K):
[in this window]
[in a new window]
  		Fig. 2. Effects of ATL313 on UAE in diabetic rats and mice. A: to determine the effect of ATL313 in rats, urine collections were obtained for measurement of UAE at 6 wk of the study. Open bars, control group; filled bars, diabetes group; gray bars, diabetes group treated with ATL313 (1 ng·kg–1·min–1). Data are means ± SE. B: urine collections were obtained for measurement of UAE in mice by ELISA at 4 wk of the study in wild-type (WT) C57BL/6 mice or A2Aknockout (A2A-KO; C57BL/6 background) mice. *P < 0.05, **P < 0.01, ***P < 0.0001 to control; +P < 0.005 to diabetes.

 
ATL313 reduces proteinuria in diabetic nephropathy through A2ARs. To confirm the selectivity of ATL313, we used WT and A2A-KO mice treated with ATL313. Table 3 summarizes the effect of ATL313 on blood glucose, body weight, and SBP. ATL313 had no effect on blood glucose, body weight, or SBP compared with vehicle-treated wild-type or diabetic mice. As shown in Fig. 2B, both WT and A2A-KO mice show increased UAE in the diabetes group (34.3 ± 3 µg/24 h, P < 0.0001 and 80.4 ± 11 µg/24 h, P < 0.01, respectively) from control group (11.7 ± 1 and 25 ± 2 µg/24 h, respectively) after 4 wk. ATL313 treatment significantly decreased albuminuria in the WT mice (20.7 ± 0.8 µg/24 h, P < 0.001 to vehicle) but not the A2A-KO mice (73.5 ± 14 µg/24 h, P = not significant to vehicle). The absence of effect of ATL313 on proteinuria in A2A-KO mice is similar to that observed with ATL146e on ischemia-reperfusion injury in A2A-KO mice (15).


View this table:
[in this window]
[in a new window]
  		Table 3. Changes in BG, BW, and SBP in control, untreated diabetic, and diabetic mice treated with ATL313 in WT C57BL/6 mice or A2A-KO (C57BL/6 background) mice

 
Effects of ATL146e on kidney matrix deposition in diabetes. Diabetic nephropathy has been shown to be associated with an increase in kidney matrix deposition and fibrosis. Therefore, we investigated whether ATL146e could decrease fibronectin expression in diabetic kidney. We assessed kidney fibronectin mRNA by real-time PCR. As shown in Fig. 3, diabetes led to a 3.5-fold increase in fibronectin mRNA (P < 0.01 to control) 6 wk after diabetes, an effect attenuated by ATL146e treatment (ATL146e –3D, 0.6-fold increase from control; P < 0.05 to vehicle and ATL146e +7D, 0.2-fold increase from control; P < 0.05 to vehicle). Figure 4 shows the effect of ATL146e treatment on kidney histology after 6 wk of diabetes. Trichrome stain of the kidneys from control (A), diabetic rats treated with vehicle (B), ATL146e –3D (C), or ATL146e +7D (D) at 6 wk of the study. Semiquantitative histological score is shown in Table 4. The diabetes group showed a significant increase in the interstitial fibrosis (206%), size of the mesangium (235%), and thickness of the tubular basement membrane (277%) from the control group, effects significantly attenuated by ATL146e treatment to control levels.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
  		Fig. 3. Effect of ATL146e on fibronectin mRNA expression. RT-PCR was performed on whole rat kidney total RNA in control, diabetes, and diabetes rats treated with ATL146e (ATL146e –3D and ATL14e +7D) after 6 wk. Fibronectin mRNA expression was normalized with GAPDH. Open bars, control rats; filled bars, diabetic rats; light gray bars, diabetic rats treated with ATL146e –3D; dark gray bars, diabetic rats treated with ATL146e +7D. Values represent means ± SE. *P < 0.01 to control. +P < 0.05 to diabetes.

 

Figure 4
View larger version (146K):
[in this window]
[in a new window]
  		Fig. 4. Effect of ATL146e on renal tissue fibrosis. Representative rat kidney sections were subjected to histological staining with trichrome stain for normal control rat (A), diabetic treated with vehicle (B), diabetic rats treated with ATL146e –3D (C), and diabetic rats treated with ATL146e +7D (D) after 6 wk. A-D: photograph from separate animals. Magnification x400. Semiquantitative analysis is shown in Table 4.

 

View this table:
[in this window]
[in a new window]
  		Table 4. Histological score with trichrome stain

 
Effects of ATL146e on macrophage recruitment in the kidney tissue in diabetes. We next examined macrophage (ED1+ cells) infiltration in rat kidneys at 6 wk after induction of diabetes (Fig. 5). At 6 wk, diabetes (B) led to an increase in ED1+ cells in the glomeruli (7.6-fold; P < 0.05) and in the interstitium (3.4-fold; P < 0.01) from control (A). ATL146e treatment reduced macrophage density in the glomeruli (ATL146e –3D, 1.9-fold from control; ATL146e +7D, 4.4-fold from control) and the interstitium (ATL146e –3D, 1.6-fold from control; P < 0.05 to vehicle and ATL146e +7D, 1.5-fold from control; P < 0.01 to vehicle; C and D, respectively).


Figure 5
View larger version (153K):
[in this window]
[in a new window]
  		Fig. 5. Effects of ATL146e on macrophage recruitment in the kidney tissue in diabetes. Immunohistochemical staining for ED1-positive cells in glomeruli and interstitium at 6 wk of control rat (A), a diabetic rat (B), a diabetic rats treated with ATL146e –3D (C), and a diabetic rats treated with ATL146e +7D (D). Positive staining was observed in the glomerulus (arrow) and interstitium (arrow head). Magnification x400.

 
Effects of ATL146e on inflammatory cytokines. Increased inflammatory cytokines is a major feature of and an important predictor of diabetic nephropathy. Therefore, we further assessed the anti-inflammatory effect of adenosine 2A receptor agonist with ATL146e treatment in rats. Plasma MCP-1 and IFN-{gamma} concentrations were not different between all groups (data not shown). In contrast, urinary MCP-1 and IFN-{gamma} were 36 ± 4 ng/24 h and 16 ± 0.5 pg/24 h at baseline and increased in diabetes group at 4 and 6 wk after STZ induction. At 6 wk, urinary MCP-1 and IFN-{gamma} increased following STZ induction (705% of baseline; P < 0.001 and 298% of baseline; P < 0.001), respectively. ATL146e treatment before or after induction of diabetes significantly decreased urine MCP-1 to 38% of control (P < 0.001 to diabetes) and 50% of control (P < 0.001 to diabetes), respectively, and IFN-{gamma} to 118% of control (P < 0.01 to diabetes) and 130% of control (P < 0.05 to diabetes), respectively, 6 wk after diabetes. There was a significant correlation between urinary MCP-1 and IFN-{gamma} with UAE (r = 0.82) and (r = 0.6), respectively, between all groups at 6 wk of the study (Fig. 6, A and B). Similarly, urinary TNF-{alpha} excretion was 54.6 ± 8.5 pg/24 h at baseline and increased to 1,586% of baseline (P < 0.01) in the diabetes group at 6 wk after diabetes. ATL146e administration before or after diabetes significantly decreased the increase in TNF-{alpha} excretion to 312% of control (P < 0.05 to diabetes) and 352% of control (P < 0.05 to diabetes), respectively (Fig. 6C). There was a significant correlation between urinary TNF-{alpha} excretion and UAE (r = 0.76) at 6 wk of the study. Plasma TNF-{alpha} was not detectable in all groups at any point of the study periods (data not shown).


Figure 6
View larger version (29K):
[in this window]
[in a new window]
  		Fig. 6. Effect of ATL146e on inflammatory cytokines. Twenty-four-hour urine collections were obtained for measurement of MCP-1 (A), IFN-{gamma} (B), and TNF-{alpha} (C) in rats with a correlation analysis with UAE using linear regression analysis in control, diabetes, and diabetes + ATL146e treatment groups at 6 wk of the study. Open bars, control rats; filled bars, diabetic rats; light gray, diabetic rats treated with ATL146e –3D; dark gray bars, diabetic rats treated with ATL146e +7D. Values are means ± SE. *P < 0.01, **P < 0.001, ***P < 0.0001 to control; +P < 0.05, ++P < 0.01, +++P < 0.0001 to diabetes.

 
Effect of ATL146e on the expression of podocyte slit diaphragm-associated molecules podocin and nephrin. As shown in Fig. 7, diabetes was associated with a significant reduction in podocin and nephrin mRNA expression compared with control rats (podocin: 56% decrease from control, P < 0.005; nephrin: 36% decrease from control, P < 0.05). ATL146e administration before or after induction of diabetes restored podocin and nephrin mRNA expression to control levels.


Figure 7
View larger version (34K):
[in this window]
[in a new window]
  		Fig. 7. Effect of ATL146e on slit diaphragm-associated molecules (podocin and nephrin) mRNA expression in rats. RT-PCR was performed on whole rat kidney total RNA in control, diabetes, and diabetes rats treated with ATL146e (ATL146e –3D and ATL14e +7D) after 6 wk. Podocin and nephrin mRNA expressions were normalized with GAPDH. Open bars, control rats; filled bars, diabetic rats; light gray bars, diabetic rats treated with ATL146e –3D; dark gray bars, diabetic rats treated with ATL146e +7D. Values represent means ± SE. *P < 0.05, **P < 0.01 to control; +P < 0.05, ++P < 0.01, +++P < 0.0001 to diabetes.

 

   DISCUSSION
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
The present study demonstrates that 6 wk after induction of diabetes in Sprague-Dawley rats, marked albuminuria associated with reduction of podocyte specific gene mRNAs, reduction of renal function, and early histological changes of diabetic nephropathy are established. Furthermore, these changes were associated with evidence of inflammation. Macrophage infiltration and urinary excretion of TNF-{alpha}, IFN-{gamma}, and MCP-1 were increased in diabetic animals as well as kidney fibronectin mRNA. Administration of A2A agonists led to a marked reversal of albuminuria along with restoration of podocin and nephrin transcripts, histological changes, plasma creatinine, and urinary proinflammatory cytokines. Given the known effect of A2A agonists to block inflammation through immune regulation of hematopoietic cells (15, 36, 37, 50) along with our finding of their effects on podocyte gene expression, these results suggest the possibility that A2A agonists protect kidneys from diabetic nephropathy through actions on hematopoietic cells and/or kidney-derived cells. Given the increasingly recognized role of inflammation in diabetic nephropathy (13, 33, 54), we conducted studies to examine whether A2A agonists reduce injury associated with a chronic model of STZ-induced diabetic nephropathy. ATL146e, an A2AR agonist, has a higher affinity and selectivity for human and rat A2ARs than the widely used CGS-21680 (44) and blocks inflammation and renal ischemia-reperfusion injury primarily by activating bone marrow-derived cells (15). ATL313 is similarly effective with longer duration than ATL146e (16).

In the present study, we demonstrated a significant increase in UAE after 2 wk of diabetes in conscious animals that continued to be elevated throughout the study period. Administration of A2A agonists significantly reduced albuminuria. Similarly, ATL146e administered either before or after STZ-induced diabetes reduced the increase in plasma creatinine in diabetes. Loss of A2A agonist effect on A2A-KO mice as shown in our results (current study and Ref. 15) indicates ATL146e and ATL313 are selective at A2ARs. It is interesting to note that proteinuria is greater in A2A-KO mice than WT mice, which suggests that endogenous A2ARs might contribute to kidney protection from diabetes in a similar manner than they do in kidney ischemia-reperfusion injury (15). In these mice, blood glucoses and blood pressures were the same for both groups; thus these factors are unlikely to explain the difference in proteinuria observed.

Other findings from the present study indicate that the increase in kidney fibronectin mRNA in diabetes is reduced by ATL146e. Increased expression of renal fibronectin is an early event in the pathogenesis of diabetic renal disease and its accumulation in the kidney is thought to lead to the development of glomerulosclerosis (30). In diabetes, both TGF-beta and fibronectin stimulate matrix production and blocking matrix degradation (5, 7, 21, 55).

The mechanism by which A2A agonists mediate protection in STZ-induced diabetic nephropathy is not known; however, we speculate that A2A agonists may attenuate kidney injury in diabetes either indirectly through effects on hematopoietic cells, or directly through effects on podocytes, or vascular endothelium. Both nephrin and podocin are crucial complex proteins in the assembly and reinforcement of the slit diaphragm by bounding to the actin cytoskeleton via CD2-associated protein (17, 47). Previous studies showed a reduction in nephrin mRNA and protein expression in human (4) and STZ diabetic rat models (6, 26). Data on podocin are controversial ranging from no change (4), decreased protein expression (27), to increased mRNA expression (27). {alpha}3beta1-Integrin is the major integrin that anchors podocytes (43, 48) to collagen, fibronectin, and laminin present on glomerular basement membranes (GBM) (17, 18). Deregulation of these proteins and podocytes has been described to be associated with glomerular disease including DN (31, 40). Whether the effect of ATL146e on restoring podocin and nephrin is due to reducing inflammation or has a direct effect on podocyte is not clear. Additional studies need to explore the relationship between diabetes, podocytes, and A2ARs.

The increase in kidney macrophages was correlated with the duration and severity of renal injury in diabetes (13). In the kidney, MCP-1 is produced by mesangial and tubular epithelial cells (42, 45) and mediates renal interstitial inflammation, tubular atrophy, and interstitial fibrosis (29). In the current study, we found significant elevation of urinary MCP-1 excretion level with the progression of diabetes that correlated with the rate of UAE in the diabetes group. ATL146e significantly reduced urinary MCP-1 to normal levels. There was no change in plasma MCP-1 in all groups indicating the urinary excretion of MCP-1 in diabetes is due to MCP-1 production by the kidney. These data suggest the possibility that renal MCP-1 may contribute to the glomerular and tubulointerstitial lesions in diabetic nephropathy.

Macrophages were found in our study mainly in the interstitium and the glomeruli. In our study, urinary TNF-{alpha} significantly correlated with UAE in diabetes. TNF-{alpha} is produced mainly by monocytes, macrophages, T and B lymphocytes, and glomerular mesangial cells (3, 22). Both TNF-{alpha} and IL-1beta have been associated with increasing vascular endothelial permeability (46) and have been detected in isolated GBM in diabetes (33). The relationship between proteinuria, MCP-1, macrophage infiltration, inflammatory cytokines, and renal tissue fibrosis adds further support to the potential role of macrophages in the pathogenesis of DN. The ability of A2A agonists to block macrophage entry or secretion of key products is likely a key element in tissue protection.

CD4+ cells are the primary hematopoietic cells that secrete IFN-{gamma}. Increased IFN-{gamma} with diabetes and the reduction observed with A2A agonists treatment implicate the potential role of T cells. IFN-{gamma} is known to induce macrophage priming or activation causing renal injury (24). Further studies are needed to better understand the role of individual hematopoietic elements in the pathogenesis of diabetic complications.

Our studies do not exclude the possibility that A2A agonists induce a favorable intraglomerular hemodynamic effect to reduce proteinuria. It is possible that A2A agonists mitigate proteinuria through direct effects on the glomerular vascular bed or indirectly by blocking vasoactive inflammatory mediators. Additional studies are necessary to address this issue.

There is unexplained variability in the blood pressure response ranging from an increase (9, 32) to no change in diabetes (8, 51). In our study, we observed similar variabilities. Thus conclusions drawn from blood pressure measurements should be made with caution. SBP increased significantly at 6 wk in the diabetes group, an effect that may be a consequence of ongoing inflammation and endothelial dysfunction. The effect of ATL146e to block inflammation may have resulted in the observed late decrease in SBP possibly secondary to reduced inflammation. It is unlikely that ATL146e has a direct blood pressure-reducing effect at the doses used, as previous studies in rats and mice show that ATL146e infused by osmotic minipumps did not produce an effect on SBP (38) and had not early effects in this study.

In summary, our study demonstrates that chronic administration of selective A2A agonists attenuates renal lesions and functional abnormalities characteristic of diabetic nephropathy. We believe that the renal tissue protective effect of A2A agonist is mediated primarily by abrogating the inflammatory response associated with diabetes. Whether A2A agonists have direct effects on bone marrow-derived cells or nonbone marrow-derived cells such as podocytes in attenuating the diabetic kidney phenotype similar to effects observed in acute renal ischemia-reperfusion injury is the focus of future studies. We conclude that A2A agonists represent a novel therapeutic option for the treatment of diabetic kidney disease and potentially other diabetic complications.


   GRANTS
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by National Institutes of Health Grants DK-56223, DK-62324, HL-37942, JDRF 1-2005-986, and NKF-Vas-04–020.


   ACKNOWLEDGMENTS
 
The authors gratefully acknowledge T. Macdonald (Department of Chemistry, University of Virginia) and J. Rieger (Adenosine Therapeutics, LLC, Charlottesville) for the generous gift of ATL146e and ATL313, K. Kalantarinia for careful reading of the manuscript, and members of the Okusa lab for helpful discussions.


   FOOTNOTES
 

Address for reprint requests and other correspondence: M. D. Okusa, Division of Nephrology, Box 133, Univ. of Virginia Health System, Charlottesville, VA 22908 (e-mail: mdo7y{at}virginia.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. American Diabetes Association. Position statement: diabetic nephropathy.Diabetes Care 24: S69–S72, 2001.[CrossRef]
  2. Banba N, Nakamura T, Matsumura M, Kuroda H, Hattori Y, and Kasai K. Possible relationship of monocyte chemoattractant protein-1 with diabetic nephropathy. Kidney Int 58: 684–690, 2000.[CrossRef][Web of Science][Medline]
  3. Baud L, Oudinet JP, Bens M, Noe L, Peraldi MN, Rondeau F, Etienne J, and Ardaillou R. Production of tumor necrosis factor by rat mesangial cells in response to bacterial lipopolysaccharide. Kidney Int 35: 1111–1118, 1989.[Web of Science][Medline]
  4. Benigni A, Gagliardini E, Tomasoni S, Abbate M, Ruggenenti P, Kalluri R, and Remuzzi G. Selective impairment of gene expression and assembly of nephrin in human diabetic nephropathy. Kidney Int 65: 2193–2200, 2004.[CrossRef][Web of Science][Medline]
  5. Benigni A, Zoja C, Corna D, Zatelli C, Conti S, Campana M, Gagliardini E, Rottoli D, Zanchi C, Abbate M, Ledbetter S, and Remuzzi G. Add-on anti-TGF-beta antibody to ACE inhibitor arrests progressive diabetic nephropathy in the rat. J Am Soc Nephrol 14: 1816–1824, 2003.[Abstract/Free Full Text]
  6. Bonnet F, Cooper ME, Kawachi H, Allen TJ, Boner G, and Cao Z. Irbesartan normalises the deficiency in glomerular nephrin expression in a model of diabetes and hypertension. Diabetologia 44: 874–877, 2001.[CrossRef][Web of Science][Medline]
  7. Border WA and Noble NA. Transforming growth factor beta in tissue fibrosis. N Engl J Med 331: 1286–1292, 1994.[Free Full Text]
  8. Brands MW, Fitzgerald SM, Hewitt WH, and Hailman AE. Decreased cardiac output at the onset of diabetes: renal mechanisms and peripheral vasoconstriction. Am J Physiol Endocrinol Metab 278: E917–E924, 2000.[Abstract/Free Full Text]
  9. Brands MW and Hopkins TE. Poor glycemic control induced hypertension in diabetes mellitus. Hypertension 27: 753–759, 1996.
  10. Bullough DA, Magill MJ, Firestein GS, and Mullane KM. Adenosine activates A2 receptors to inhibit neutrophil adhesion and injury to isolated cardiac myocytes. J Immunol 155: 2579–2596, 1995.[Abstract]
  11. Chen JF, Huang Z, Ma J, Zhu J, Moratalla R, Standaert D, Moskwitz MA, Fink JS, and Schwarzschild MA. A(2A) adenosine receptor deficiency attenuates brain injury induced by transient focal ischemia in mice. J Neurosci 19: 9192–9200, 1999.[Abstract/Free Full Text]
  12. Chen L, Hellmark T, Wieslander J, and Bolton WK. Immunodominant epitopes of {alpha}3(IV)NC1 induce autoimmune glomerulonephritis in rats. Kidney Int 64: 2108–2120, 2003.[CrossRef][Web of Science][Medline]
  13. Chow F, Ozols E, Nikolic-Paterson DJ, Atkins RC, and Tesch GH. Macrophages in mouse type 2 diabetic nephropathy: correlation with diabetic state and progressive renal injury. Kidney Int 65: 116–128, 2004.[CrossRef][Web of Science][Medline]
  14. Cooper ME. Pathogenesis, prevention, and treatment of diabetic nephropathy. Lancet 352: 213–219, 1998.[CrossRef][Web of Science][Medline]
  15. Day YJ, Huang L, McDuffie MJ, Rosin DL, Ye H, Chen JF, Schwarzschild MA, Fink JS, Linden J, and Okusa MD. Renal protection from ischemia mediated by A2A adenosine receptors on bone marrow-derived cells. J Clin Invest 112: 883–891, 2003.[CrossRef][Web of Science][Medline]
  16. Day YJ, Li Y, Rieger JM, Ramos SI, Okusa MD, and Linden J. A2A adenosine receptors on bone marrow-derived cells protect liver from ischemia-reperfusion injury. J Immunol 174: 5040–5046, 2005.[Abstract/Free Full Text]
  17. Dedhar S, Jewell K, Rojiani M, and Gray V. The receptor for the basement membrane glycoprotein entactin is the integrin {alpha}3/beta1. J Biol Chem 267: 18908–18914, 1992.[Abstract/Free Full Text]
  18. Elices MJ, Urry LA, and Hemler ME. Receptor functions for the integrin VLA-3: fibronectin, collagen, and laminin binding are differentially influenced by Arg-Gly-Asp peptide and by divalent cations. J Cell Biol 112: 169–181, 1991.[Abstract/Free Full Text]
  19. Furuta T, Saito T, Ootaka T, Soma J, Obara K, Abe K, and Yoshinaga K. The role of macrophages in diabetic glomerulosclerosis. Am J Kidney Dis 21: 480–485, 1993.[Web of Science][Medline]
  20. Gessi S, Varani K, Merighi S, Ongini E, and Borea PA. A(2A) adenosine receptors in human peripheral blood cells. Br J Pharmacol 129: 2–11, 2000.[CrossRef][Web of Science][Medline]
  21. Gilbert RE and Cooper ME. The tubulointerstitium in progressive diabetic kidney disease: more than an aftermath of glomerular injury? Kidney Int 56: 1627–1637, 1999.[CrossRef][Web of Science][Medline]
  22. Hruby ZW and Lowry RP. Spontaneous release of tumor necrosis factor {alpha} by isolated renal glomeruli and cultured glomerular mesangial cells. Clin Immunol Immunopathol 59: 156–164, 1991.[CrossRef][Web of Science][Medline]
  23. Huang L, Wei YY, Momose-Hotokezaka A, Dickey J, and Okusa MD. {alpha}2B-adrenergic receptors: immunolocalization and regulation by potassium depletion in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 270: F1015–F1026, 1996.[Abstract/Free Full Text]
  24. Ikezumi Y, Atkins RC, and Nikolic-Paterson DJ. Interferon-{gamma} augments acute macrophage-mediated renal injury via a glucocorticoid-sensitive mechanism. J Am Soc Nephrol 14: 888–898, 2003.[Abstract/Free Full Text]
  25. Kalantarinia K, Awad AS, and Siragy HM. Urinary and renal interstitial concentrations of TNF-{alpha} increase prior to the rise in albuminuria in diabetic rats. Kidney Int 64: 1208–1213, 2003.[CrossRef][Web of Science][Medline]
  26. Kelly DJ, Aaltonen P, Cox AJ, Rumble JR, Langham R, Panagiotopoulos S, Jerums G, Holthofer H, and Gilbert RE. Expression of the slit-diaphragm protein, nephrin, in experimental diabetic nephropathy: differing effects of anti-proteinuric therapies. Nephrol Dial Transplant 17: 1327–1332, 2002.[Abstract/Free Full Text]
  27. Koop K, Eikmans M, Baelde HJ, Kawachi H, De Heer E, Paul LC, and Bruijn JA. Expression of podocyte-associated molecules in acquired human kidney diseases. J Am Soc Nephrol 14: 2063–2071, 2003.[Abstract/Free Full Text]
  28. Linden J. Molecular approach to adenosine receptors: receptor-mediated mechanisms of tissue protection. Annu Rev Pharmacol Toxicol 41: 775–787, 2001.[CrossRef][Web of Science][Medline]
  29. Lloyd CM, Minto AW, Dorf ME, Proudfoot A, Wells TN, Salant DJ, and Gutierrez-Ramos JC. RANTES and monocyte chemoattractant protein-1 (MCP-1) play an important role in the inflammatory phase of crescentic nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis. J Exp Med 185: 1371–1380, 1997.[Abstract/Free Full Text]
  30. Ma G, Allen TJ, Cooper ME, and Cao Z. Calcium channel blockers, either amlodipine or mibefradil, ameliorate renal injury in experimental diabetes. Kidney Int 66: 1090–1098, 2004.[CrossRef][Web of Science][Medline]
  31. Meyer TW, Bennett PH, and Nelson RG. Podocyte number predicts long-term urinary albumin excretion in Pima Indians with Type II diabetes and microalbuminuria. Diabetologia 42: 1341–1344, 1999.[CrossRef][Web of Science][Medline]
  32. Miller JA. Impact of hyperglycemia on the renin angiotensin system in early human type 1 diabetes mellitus. J Am Soc Nephrol 10: 1778–1785, 1999.[Abstract/Free Full Text]
  33. Nakamura T, Fukui M, Ebihara I, Osada S, Nagaoka I, Tomino Y, and Koide H. mRNA expression of growth factors in glomeruli from diabetic rats. Diabetes 42: 450–456, 1993.[Abstract]
  34. Nikolic-Paterson DJ and Atkins RC. The role of macrophages in glomerulonephritis. Nephrol Dial Transplant 16: 3–7, 2001.[Abstract/Free Full Text]
  35. Okusa MD, Huang L, Momose-Hotokezaka A, Huynh LP, and Mangrum AJ. Regulation of adenylyl cyclase in polarized renal epithelial cells by G protein-coupled receptors. Am J Physiol Renal Physiol 273: F883–F891, 1997.[Abstract/Free Full Text]
  36. Okusa MD, Linden J, Huang L, Rieger JM, Macdonald TL, and Huynh LP. A(2A) adenosine receptor-mediated inhibition of renal injury and neutrophil adhesion. Am J Physiol Renal Physiol 279: F809–F818, 2000.[Abstract/Free Full Text]
  37. Okusa MD, Linden J, Huang L, Rosin DL, Smith DF, and Sullivan G. Enhanced protection from renal ischemia-reperfusion injury with A2A-adenosine receptor activation and PDE 4 inhibition. Kidney Int 59: 2114–2125, 2001.[Web of Science][Medline]
  38. Okusa MD, Linden J, Macdonald T, and Huang L. Selective A2A adenosine receptor activation reduces ischemia-reperfusion injury in rat kidney. Am J Physiol Renal Physiol 277: F404–F412, 1999.[Abstract/Free Full Text]
  39. Olah ME and Stiles GL. Adenosine receptor subtypes: characterization and therapeutic regulation. Annu Rev Pharmacol Toxicol 35: 581–606, 1995.[CrossRef][Web of Science][Medline]
  40. Pagtalunan ME, Miller PL, Jumping-Eagle S, Nelson RG, Myers BD, Rennke HG, Coplon NS, Sun L, and Meyer TW. Podocyte loss and progressive glomerular injury in type II diabetes. J Clin Invest 99: 342–348, 1997.[Web of Science][Medline]
  41. Parving HH, Osterby R, and Ritz E. Diabetic nephropathy. In: The Kidney, 6th ed., edited by Brenner BM. Philadelphia, PA: WB Saunders, 2000, p. 1731–1773.
  42. Prodjosudjadi W, Gerritsma JS, Klar-Mohamad N, Gerritsen AF, Bruijn JA, Daha MR, and van Es LA. Production and cytokine-mediated regulation of monocyte chemoattractant protein-1 by human proximal tubular epithelial cells. Kidney Int 48: 1477–1486, 1995.[Web of Science][Medline]
  43. Raats CJ, van den BJ, Bakker MA, Oppers-Walgreen B, Pisa BJ, Dijkman HB, Assmann KJ, and Berden JH. Expression of agrin, dystroglycan, and utrophin in normal renal tissue and in experimental glomerulopathies. Am J Pathol 156: 1749–1765, 2000.[Abstract/Free Full Text]
  44. Rieger JM, Brown ML, Sullivan GW, Linden J, and Macdonald TL. Design, synthesis, and evaluation of novel A2A adenosine receptor agonists. J Med Chem 44: 531–539, 2001.[CrossRef][Web of Science][Medline]
  45. Rovin BH, Yoshiumura T, and Tan L. Cytokine-induced production of monocyte chemoattractant protein-1 by cultured human mesangial cells. J Immunol 148: 2148–2153, 1992.[Abstract]
  46. Royall JA, Berkow RL, Beckman JS, Cunningham MK, Matalon S, and Freeman BA. Tumor necrosis factor and interleukin 1{alpha} increase vascular endothelial permeability. Am J Physiol Lung Cell Mol Physiol 257: L399–L410, 1989.[Abstract/Free Full Text]
  47. Schwarz K, Simons M, Reiser J, Saleem MA, Faul C, Kriz W, Shaw AS, Holzman LB, and Mundel P. Podocin, a raft-associated component of the glomerular slit diaphragm, interacts with CD2AP and nephrin. J Clin Invest 108: 1621–1629, 2001.[CrossRef][Web of Science][Medline]
  48. Smoyer WE and Mundel P. Regulation of podocyte structure during the development of nephrotic syndrome. J Mol Med 76: 172–183, 1998.[CrossRef][Web of Science][Medline]
  49. Sullivan GW and Linden J. Role of A2A adenosine receptors in inflammation. Drug Dev Res 45: 103–112, 1998.[CrossRef]
  50. Sullivan GW, Rieger JM, Scheld WM, Macdonald TL, and Linden J. Cyclic AMP-dependent inhibition of human neutrophil oxidative activity by substituted 2-propynylcyclohexyl adenosine A2A receptor agonists. Br J Pharmacol 132: 1017–1025, 2001.[CrossRef][Web of Science][Medline]
  51. Tatchum-Talom R, Gopalakrishnan V, and McNeill JR. Radiotelemetric monitoring of blood pressure and mesenteric arterial bed responsiveness in rats with streptozotocin-induced diabetes. Can J Physiol Pharmacol 78: 721–728, 2000.[CrossRef][Web of Science][Medline]
  52. The United States Renal Data System. USRDS Annual Data Report. Bethesda, MD. National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases,2001.
  53. Vitzthum H, Weiss B, Bachleitner W, Kramer BK, and Kurtz A. Gene expression of adenosine receptors along the nephron. Kidney Int 65: 1180–1190, 2004.[CrossRef][Web of Science][Medline]
  54. Wada T, Furuichi K, Sakai N, Iwata Y, Yoshimoto K, Shimizu M, Takeda SI, Takasawa K, Yoshimura M, Kida H, Kobayashi KI, Mukoida N, Naito T, Matsushima K, and Yokoyama H. Upregulation of MCP-1 in tubulointerstitial lesions of human diabetic nephropathy. Kidney Int 58: 1492–1498, 2000.[CrossRef][Web of Science][Medline]
  55. Wolf G and Ziyadeh FN. Molecular mechanisms of diabetic renal hypertrophy. Kidney Int 56: 393–405, 1999.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
H. Wang, W. Zhang, C. Zhu, C. Bucher, B. R. Blazar, C. Zhang, J.-F. Chen, J. Linden, C. Wu, and Y. Huo
Inactivation of the Adenosine A2A Receptor Protects Apolipoprotein E-Deficient Mice From Atherosclerosis
Arterioscler Thromb Vasc Biol, July 1, 2009; 29(7): 1046 - 1052.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
Y. Qian, E. Feldman, S. Pennathur, M. Kretzler, and F. C. Brosius III
From Fibrosis to Sclerosis: Mechanisms of Glomerulosclerosis in Diabetic Nephropathy
Diabetes, June 1, 2008; 57(6): 1439 - 1445.
[Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
G. Hasko and P. Pacher
A2A receptors in inflammation and injury: lessons learned from transgenic animals
J. Leukoc. Biol., March 1, 2008; 83(3): 447 - 455.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
A. S. Awad, M. Rouse, L. Liu, A. L. Vergis, D. L. Rosin, J. Linden, J. R. Sedor, and M. D. Okusa
Activation of Adenosine 2A Receptors Preserves Structure and Function of Podocytes
J. Am. Soc. Nephrol., January 1, 2008; 19(1): 59 - 68.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
D. J. Friedman, H. G. Rennke, E. Csizmadia, K. Enjyoji, and S. C. Robson
The Vascular Ectonucleotidase ENTPD1 Is a Novel Renoprotective Factor in Diabetic Nephropathy
Diabetes, September 1, 2007; 56(9): 2371 - 2379.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/F828    most recent
00310.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Awad, A. S.
Right arrow Articles by Okusa, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Awad, A. S.
Right arrow Articles by Okusa, M. D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.