| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1-subunit promoter by multiple prostaglandin-responsive elements
Biochemistry Department, School of Medicine and Biomedical Sciences, State University of New York at Buffalo, Buffalo, New York
Submitted 14 November 2005 ; accepted in final form 7 February 2006
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
1-subunit gene in Madin-Darby canine kidney cells via cAMP- and Ca2+-mediated pathways (Taub M, Borsick M, Geisel J, Matlhagela K, Rajkhowa T, and Allen C. Exp Cell Res 299: 1–14, 2004; Matlhagela K, Borsick M, Rajkhowa T, and Taub M. J Biol Chem 280: 334–346, 2005). Evidence was presented indicating that PGE1 stimulation was mediated through the binding of cAMP-regulatory element binding protein (CREB) to a prostaglandin-responsive element (PGRE) as well as Sp1 binding to an adjacent Sp1 site. In this report, we present evidence from EMSAs and DNA affinity precipitation studies that another PGRE present in the Na-K-ATPase 1-subunit promoter similarly binds CREB and Sp1. The evidence that indicates a requirement for CREB as well as Sp1 for gene activation through both PGREs (PGRE1 and PGRE3) includes studies with a dominant negative CREB (KCREB), Drosophila SL2 cells, and PGRE mutants. The results of these studies are indicative of a synergism between Sp1 and CREB in mediating regulation by PGRE3; while regulation occurring through PGRE1 also involves Sp1 and CREB, the mechanism appears to be distinct. Madin-Darby canine kidney cells; transport; gene regulation; kidney; eicosanoids
The Na-K-ATPase is an integral membrane protein that plays an essential role in the physiology of animal cells. The Na-K-ATPase maintains an electrochemical gradient by transporting three intracellular Na+ molecules out of the cells in exchange for three extracellular K+ molecules, in an ATP-dependent manner (18). The electrochemical gradient established by the Na-K-ATPase is required for a number of cellular processes, including cell volume regulation, maintenance of the action potential in excitable cells, and the activity of a number of membrane transport systems (19). In the kidney, the Na-K-ATPase is localized in the basolateral membrane and is integral to the process of sodium reabsorption (12, 13, 18, 24, 27). The electrochemical gradient established by the renal Na-K-ATPase acts as the driving force for the translocation of glucose, phosphate, and amino acids across the apical membrane by Na+/solute cotransport systems (23). Subsequently, these solutes are transported out of the cells' basolateral membrane by means of another set of transport systems.
The Na-K-ATPase is composed of an 
-subunit (110 kDa), responsible for the transport activity, as well as a glycosylated -subunit (60 kDa). The -subunit facilitates the correct assembly and transport of the -subunit into the basolateral membrane of epithelial cells. This process is dependent on / heterodimer formation, which is limited by the levels of newly synthesized - and -subunits (4, 15). The level of the newly synthesized -subunit has been found in some cases to be a limiting factor in / heterodimer formation (15). In those cases in which the newly synthesized -subunit is limiting, regulatory changes that affect -subunit levels ultimately affect overall Na-K-ATPase levels and sodium reabsorption by the kidney.
The activity of the Na-K-ATPase changes in response to changes in the extracellular environment. Acute regulation of the enzyme, which occurs within minutes to hours of a stimulus, generally occurs posttranslationally. Chronic regulation, which occurs within hours to days, involves changes in the numbers of Na-K-ATPases. Included among the regulatory changes that affect the numbers of Na-K-ATPases are changes in the general hormonal milieu as well as in more localized, organ-specific signals (16, 24). In the kidney, hormones that regulate the level of expression of the Na-K-ATPase - and -subunit genes (and ultimately modulate Na-K-ATPase levels) include glucocorticoids, mineralocorticoids, and thyroid hormone (5, 10, 14). In addition, endogenously produced effector molecules that play a role in regulating the renal Na-K-ATPase include dopamine, angiotensin, and prostaglandins, the products of AA metabolism by COX (25, 37).
Transcriptional regulation of the Na-K-ATPase may occur via a number of mechanisms. Hormones such as glucocorticoids, minerolocorticoids, and thyroid hormone bind to specific cytoplasmic receptors, which then enter the nucleus as a hormone-receptor complex, and then the hormone-receptor complex binds to regulatory elements located in the promoter region of the target genes (5, 14). Ultimately, changes observed at the transcriptional level affect the level of the Na-K-ATPase in the plasma membrane, which are in addition to any posttranscriptional affects, which may occur as a consequence of hormone treatment. In contrast, effector molecules that act via G protein-coupled receptors, such as prostaglandins, activate signaling pathways including cAMP, PKC, and/or other Ca2+-regulated signaling pathways, which ultimately also affect transcription (8).
Previously, we reported that PGE1 stimulates the activity of the Na-K-ATPase in Madin-Darby canine kidney (MDCK) cells (37, 40) and that the increase in Na-K-ATPase activity caused by PGE1 can be explained by regulation at the transcriptional level (37). The regulation of -subunit transcription by prostaglandins was examined in detail, using a human Na-K-ATPase 1 promoter/luciferase construct, pH1–1141Luc (Fig. 1A) (14, 25, 37). We defined a region within the Na-K-ATPase 1-subunit promoter (–83 to –182) that is required to elicit the effects of PGE1, as well as a prostaglandin-responsive element (PGRE) within this region (AGTCCCTGC; –92 to –100) that was required to elicit a PGE1 stimulation (25). EMSAs indicated that both the cAMP-regulatory element binding protein (CREB) and Sp1 are involved in mediating a PGE1 stimulation by binding to the PGRE and an adjacent Sp1 site, respectively (25). The involvement of the PGRE and adjacent Sp1 sites was also indicated by studies with mutant constructs (25).
|
1-subunit promoter (–92 to –100), the 5' deletion analysis did not necessarily exclude the presence of additional PGREs within the 1-subunit promoter. In this study, we examine the possibility that there are indeed additional PGRE sites. Evidence is presented indicating that indeed a second PGRE is present within the human 1-subunit promoter and that regulation through this PGRE is via a similar, albeit distinct mechanism from that occurring by the previously identified PGRE (at –92 to –100). |
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
Hormones, human transferrin, PGE1, and other chemicals were from Sigma (St. Louis, MO). Synthetic double-stranded oligonucleotides, medium, fetal bovine serum, soybean trypsin inhibitor, lipofectamine, and Cellfectin Reagent were from Invitrogen (Carlsbad, CA). BioMax MS-2 film, [
-32P]dCTP and [-32P]dATP were from PerkinElmer Life Sciences. The Galacto-Star system was from Applied Biosystems (Bedford, MA). The pSVgal plasmid, reporter lysis buffer, as well as the consensus Sp1 and CRE oligonucleotides were from Promega (Madison, WI). The Prism 4 program was obtained from GraphPad Software (San Diego, CA). Nitrocellulose membranes, the Immun-Star AP Detection Kit, and other reagents for electrophoresis were from Bio-Rad (Hercules, CA). Streptavidin-agarose was from Pharmingen (San Diego, CA), and Drosophila SL2 cells were from the American Type Culture Collection (Manassas, VA).
The affinity-purified rabbit polyclonal antibodies, which were employed in these studies, were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-human CREB-1 antibody (C-21, sc-186) recognizes dog CREB, which has an identical sequence to human CREB (NCBI database). Anti-CREB-1 also recognizes ATF-1 and CREM-1, although these proteins have molecular masses below 40 kDa. The epitope recognized by the anti-human Sp1 antibody (H-225, sc-1402X) includes the NH2-terminal amino acids 121–345. The corresponding epitope in dog Sp1 is 98% identical to sequence 121–345 of the human protein (NCBI database), unlike other members of the Sp1 family (the most similar protein dog Sp4 having only a 36% identity). The anti-human Sp3 antibody recognizes the COOH terminus of Sp3 (99% homology between dog and human), whereas the anti-human CREB antibody (A-22, sc-369) is against an NH2-terminal epitope (95% homology between dog and human). The anti-TFIID antibody (N-12, sc-204) is against an epitope mapping at the NH2 terminus of TFIID binding protein (TBP; 96% homology between dog and human). TBP is a component of human TFIID.
Expression Vectors
The Rc/RSV-KCREB vector, containing a dominant negative CREB (KCREB), and the empty vector Rc/RSV were obtained from Dr. Richard Goodman (Univ. of Oregon) (41). The Drosophila expression vectors pPacO, pPacSp1, and pPacgal were obtained from Dr. Robert Tjian (UC Berkeley) (9). The human Na-K-ATPase 1 promoter/luciferase construct pH1–1141Luc (Fig. 1A) was obtained from Dr. Jerry Lingrel (Univ. of Cincinnati) (14). The deletion mutant pH1–1141Luc
71–298, pH1–1141Luc was obtained by the digestion of pH1–1141Luc with BamH1 and BalI and ligation using T4 DNA ligase.
The vector pLuc-MCS (Stratagene, La Jolla, CA) contained a minimal promoter with a TATA box linked to the luciferase gene. The cis-reporting plasmid pCRE-Luc (Stratagene) contains four consensus CRE elements (AGCCTGACGTCAGAG) in tandem, immediately upstream of the TATA box in pLuc-MCS. Other constructs were created by ligating synthetic oligos into the HindIII/XhoI site immediately upstream of the TATA box. For pLuc-MCS-72–167, the synthetic oligo (homologous to –167 to –72 of the 1 promoter) (Fig. 1A) was CAGCGATCCA AGCGGCCCCT CTAGCCCCGGCGGCTCCTTT GTGCCGGCCC CGAACCCGCC CTCTCGGGCC GAGTCCCTGC CCCTGGCGCC GGCGATTGGC. For pLuc-MCS 72–167 mut PGRE, the insert was homologous to –167 to –72 within the 1 promoter but had mutations in PGRE3, CAGCG ATCCAAGCGG CCCCTCTAGC CCCGGCGGCT CCTTTGTGCC GGCCCCGAAC CCGCCCTCTC GGGCCGATTA GTAAACCCTG GCGCCGGCGA TTGGC. For pLuc-MCS 72–167 mut GC Bx 1, the insert was homologous to –167 to –72 within the 1 promoter, with mutations in the GC box (–111 to –117), CAGCG ATCCAAGCGG CCCCTCTAGC CCCGGCGGCT CCTTTGTGCC GGCCCCGAAA ATTACATCTC GGGCCGAGTC CCTGCCCCTG GCGCCGGCGA TTGGC. pLuc-MCS-72–167-2GCtrans (25) contained CGATGGCGGCCCGCCCCCA AGCGGCCCCT CTAGCCCC^CTCCTTT GTGCCGGCCC CGAA^T CTCGGGCC GAGTCCCTGC CCCTGGCGCC GGCGATTGGC, in which the two GC boxes immediately upstream of PGRE3 were translocated farther upstream, as indicated in bold. Synthetic oligodeoxynucleotides containing PGRE1 (–456 to –421; GGCGTCCCGG AGTGACCTTC CCCCACCCCG CCAGC), PGRE2 (–240 to –211; GCGGCGCTGC CTGCGCGTCC CTCACCGCC), and PGRE3 (–115 to –82; CCCGCC CTCTCGGGCC GAGTCCCTGC CCCTGG C) were similarly individually ligated into pLuc-MCS, creating the vectors pLuc-MCS-421–456, pLuc-MCS-211–240, and pLuc-MCS-85–117, respectively. The composition of the recombinant pLuc-MCS vectors was confirmed by sequencing.
Animal Cell Culture Conditions
The basal medium for MDCK cells was DMEM/F-12 (50:50) supplemented with 15 mM HEPES (pH 7.4), 20 mM sodium bicarbonate, 92 U/ml penicillin, and 200 µg/ml streptomycin (DMEM/F-12). The basal medium was further supplemented with growth factors immediately before use (39). Stock MDCK cell cultures were grown in basal medium supplemented with 5 µg/ml bovine insulin, 5 µg/ml human transferrin, 5 x 10–12 M triiodothyronine (T3), 5 x 10–8 M hydrocortisone, 25 ng/ml PGE1, and 5 x 10–8 M selenium (Medium K-1) in a humidified 5% CO2-95% air environment at 37°C (39), and MDCK cells were routinely subcultured using EDTA/trypsin, as described previously (39). For experimental studies, MDCK cells were cultured in basal medium supplemented with 5 µg/ml insulin and 5 µg/ml transferrin. Drosophila SL2 cells were maintained in Schneider's medium supplemented with 46 U/ml penicillin, 50 µg/ml streptomycin, and 10% heat-inactivated FBS in a humidified environment at 25°C. SL2 cells were detached from culture flasks by mechanical shaking.
Transient Transfection Studies
MDCK cells were transiently transfected using Lipofectamine, as previously described (37). To summarize, MDCK cells (plated at 105 cells/35-mm dish) were cotransfected with 1 µg of the appropriate vector(s), as well as pSVgal (0.2 µg). The next day, the medium was changed, and 2 h later appropriate effector molecules were added. After an additional 4-h incubation, the monolayers were solubilized in reporter lysis buffer and centrifuged (14,000 rpm, 1 min).
Drosophila SL2 cells (106 cells/35-mm dish) were transiently transfected using Cellfectin with appropriate vectors (including pPacgal) in 1 ml of Schneider's medium lacking antibiotics and FBS. After the initial 4 h of transfection, FBS was added to a final concentration of 10%. The next day, an additional 1 ml of Schneider's medium containing 10% FBS was added to the cultures. Twenty-four hours later, the medium was removed by aspiration and monolayers were solubilized in reporter lysis buffer.
The luciferase activity of cell lysates was determined using luciferase assay buffer [20 mM Tricine, 1.07 mM MgCO3·4 Mg(OH)2, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM DTT, 270 µM coenzyme A, 470 µM luciferin, and 530 µM ATP]. Emitted light was measured in a Packard Tri-Carb 4530 Scintillation Counter with the coincidence circuit turned off. -Galactosidase activity was determined using the Galacto-Star System. The -galactosidase activity of experimental cultures was expressed as a fraction of the activity in control cultures. Each luciferase assay determination was normalized with respect to its -galactosidase activity. Each luciferase value was the mean ± SE of quadruplicate determinations. In each experimental set, the mean value was divided by the indicated control value to obtain the fold-stimulation/inhibition. The experimental results were then subjected to a one-way ANOVA and the Newman-Keuls multiple comparison test (Prism 4 software). Differences were significant when P < 0.05.
Preparation of Nuclear Extracts
Nuclear extracts were prepared from MDCK cells by a modification (1, 25) of the procedure of Dignam et al. (11). Confluent MDCK monolayers in 100-mm dishes were washed twice with PBS at 4°C, removed from culture dishes with a rubber policeman, and transferred into microcentrifuge tubes. After centrifugation (2,000 rpm, 10 s, 4°C), the pellet was resuspended in a hypotonic buffer [10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.2 mM phenylmethylsulfonyl fluoride (PMSF), and 0.5 µg/ml leupeptin] at 4°C (using 
2x the packed cell volume). After swelling (4°C, 10 min), the material was vortexed (20 s) and centrifuged (2,000 rpm, 10 s, 4°C). The pellet was resuspended in a high-salt buffer (20 mM HEPES, pH 7.9, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 25% glycerol, 0.2 mM PMSF, 0.5 mM DTT, 0.5 µg/ml leupeptin). After 20 min at 4°C, the suspension was centrifuged (14,000 rpm, 2 min, 4°C), and aliquots of supernatant were quickly frozen in liquid nitrogen. Protein determinations were made using the Bradford method (3).
EMSAs
Synthetic double-stranded oligonucleotides were 32P-labeled by random priming, using [-32P]dCTP. Consensus CRE, mutant CRE, and consensus Sp1 oligos were 5'-end-labeled using [-32P]dCTP. Included among the oligonucleotides were 1) CTCTCGGGCC GAGTCCCTGC CCCTGGCGCC G (–81 to –111, PGRE3); 2) GCTGCCTGCG CGTCCCTCAC CGC (–235 to –213, PGRE2); 3) GCGTCCCGGA GTGACCTTCC CCCAC (–456 to –432, PGRE1); 4) AGAGATTGCC TGACGTCAGA GAGCTAG (a consensus CRE); 5) AGAGATTGCC TGTGGTCAGA GAGCTAG (a mutant CRE); and 6) ATTCGATCGG GGCGGGGCGA GC (a consensus Sp1 site).
Nuclear extracts (2–6 µg) were first incubated in 9 µl binding buffer containing 10 mM Tris (pH 7.5), 50 mM NaCl, 1 mM MgCl2, 0.5 mM EDTA, 4% glycerol, 0.5 mM DTT, and 0.05 mg/ml poly(dI-dC) in either the presence or absence of unlabeled oligonucleotide (50–200-fold, 37°C, 10 min). Then, a 32P-labeled probe was added, and the incubation continued (20 min, 37°C). In supershift studies, antibody was either added simultaneously with the 32P-labeled probe or following a 20-min incubation with the probe, as specified. The binding reaction was terminated by addition of gel loading buffer [25 mM Tris·HCl (pH 7.5), 0.02% bromophenol blue, 4% glycerol], and samples were separated on nondenaturing 4% acrylamide/0.001% bisacrylamide gels at 35 mA. The gels were dried, subjected to autoradiography, and autoradiograms were scanned with a Bio-Rad scanning densitometer. Band intensities were quantified using the Quantity One program.
DNA Affinity Precipitation Studies
Confluent MDCK monolayers in 100-mm culture dishes were lysed at 4°C in 600 µl HKMG (10 mM HEPES, pH 7.9, 100 mM KCl, 5 mM MgCl2, 10% glycerol, 1 mM DTT, 0.1% Nonidet P-40) containing 1 mM NaF, 1 mM Na3VO4, 1 mM PMSF, 1 µg/ml leupeptin, 1 µg/ml aprotinin, 1 µg/ml pepstatin, and 1 mM EDTA (6). Cells were sonicated (10 s, 4°C) and centrifuged (10,000 g, 5 min, 4°C, 2x). Cell extracts were incubated for 16 h with biotinylated double-stranded oligonucleotides (1 or 5 µg), including 1) 5'-GTCCCGGAGT GACCTTCCCC CAC-3' (–432 to –454, PGRE1); 2) 5'-GCTGCCTGCG CGTCCCTCAC CGC-3' (–213 to –235, PGRE2); and 3) 5'-CTCTCGGGCC GAGTCCCTGC CCCTGG-3' (–86 to –111, PGRE3). Control cell extracts were incubated either in the absence of oligo or with a biotinylated control oligo, 5'-CTACTGCTAT TCTAGTAACT GAC-3'. The results obtained with the control oligo indicated the specificity of binding. Biotinylated DNA-protein complexes were precipitated with streptavidin-agarose beads (1 h), washed with HKMG buffer (3x), separated by SDS-PAGE, and transferred to nitrocellulose. Western blots were analyzed using either anti-CREB, anti-Sp1, anti-Sp3, or anti-TBP antibodies (6, 30).
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
Previously, we have shown that Na-K-ATPase 1-subunit gene expression is regulated by PGE1, 8-bromo-cAMP (8-BrcAMP), and phorbol 12-myristate 13-acetate (TPA) (25, 37). Our previous studies with 5'-deletion mutants indicated that the region between –83 and –182 within the human 1-subunit promoter was sufficient to observe a PGE1 stimulation. A putative PGRE, AGTCCCTGC, was identified within this region (–100 to –92). However, the 5'-deletion analysis did not exclude the possibility that other PGREs were also present in the human 1-subunit promoter. Thus here the possibility is examined that additional PGREs are present in the 1-subunit promoter, including a putative PGRE1 at position –445 to –438 (TGACCTTC) and PGRE2 at position –226 to –216 (GTCCCTCA), in addition to the previously identified PGRE (PGRE3) at –100 to –92 (AGTCCCTGC) (Fig. 1A).
To determine whether these PGREs are individually functional, transient transfection studies were conducted with expression vectors containing each of these three specific elements, including pLuc-MCS 421–456, pLuc-MCS 211–240, and pLuc-MCS 85–117 (containing PGRE1, PGRE2, and PGRE3, respectively). The effect of 1.4 µM PGE1, 1 mM 8-BrcAMP, and 1 nM TPA was examined in MDCK cells transiently transfected with these expression vectors. Figure 1B shows that PGE1 and 8-BrcAMP caused equivalent stimulations, 100 ± 15- and 98 ± 12-fold, respectively, in transient transfections with pLuc-MCS 85–117 (containing PGRE3). TPA similarly caused a stimulation with pLuc-MCS 85–117, albeit to a lower extent (2.0 ± 0.8-fold, P < 0.05), indicating that the PKC pathway is also involved. In transient transfection studies with pLuc-MCS 421–456 (containing PGRE1) and pLuc-MCS 211–240 (containing PGRE2), significant stimulatory effects of PGE1 and 8-BrcAMP were also observed. However, with pLuc-MCS 421–456, the PGE1 stimulation (31 ± 13-fold vs. pLuc-MCS 421 controls) was lower than that obtained with pLuc-MCS 85–117 (100 ± 15-fold compared with pLuc-MCS 85–117 controls). A similar observation was made with regard to the 8-BrcAMP stimulation obtained with pLuc-MCS 421–456 (51 ± 8-fold vs. pLuc-MCS 421–456 controls), which was lower in magnitude than that obtained with pLuc MCS 85–117 under these conditions (98 ± 12-fold compared with pLuc MCS 85–117 controls). Luciferase activity was substantially lower with pLuc-MCS 211–240 (containing PGRE2); nevertheless, a significant PGE1 and 8-BrcAMP stimulation was observed relative to untreated pLuc-MCS 211–240 controls (30 ± 13- and 23 ± 2-fold, respectively).
Our previous 5'-deletion analysis indicated that stimulatory effects of PGE1, 8-BrcAMP, and TPA were retained in a 5'-deletion mutant (pH83–182 Luc) containing PGRE3, but lacking PGRE1 and PGRE2 (25). The magnitude of the PGE1, 8-BrcAMP, and TPA stimulation did not differ from that obtained with pH1–1141 Luc, the construct containing the entire 1-subunit promoter. To determine whether PGRE3 was required to obtain a PGE1 stimulation through the 1 promoter, we conducted transient transfection studies with pH1–1141Luc (72–299), with a deletion mutation, removing both PGRE2 and PGRE3 (illustrated by arrows in Fig. 1A), while retaining putative PGRE1.
Figure 1C shows a stimulatory effect of 1.4 µM PGE1, 1 mM 8-BrcAMP, and TPA in MDCK cells transiently transfected with pH1–1141Luc (72–299), as well as with pH1–1141Luc. The total luciferase activity obtained with PGE1, 8-BrcAMP, and TPA was higher with pH1–1141Luc (72–299) than with pH1–1141Luc. However, when the stimulatory effects of PGE1, 8-BrcAMP, and TPA obtained in MDCK cells transfected with pH1–1141Luc (72–299) are compared with the level obtained in untreated control cells similarly transfected with pH1–1141 Luc (72–299), the observed stimulation by PGE1, 8-BrcAMP, and TPA (4.0 ± 0.4-, 6.7 ± 1.3-, and 2.3 ± 0.3-fold), respectively, was no greater than the stimulation obtained in parallel cultures transfected with pH1–1141Luc, relative to the pH1–1141Luc control (6.1 ± 0.5-, 8.8 ± 0.4-, and 2.5 ± 0.2-fold for PGE1, 8-BrcAMP, and TPA, respectively).
Binding of Nuclear CREB and Sp1 to PGRE1 and PGRE3 In Vitro
EMSA studies.
Previously, we conducted a number of studies including EMSAs, which indicated that both CREB and Sp1 bind to the region of the 1 promoter region containing PGRE3 (25). EMSAs were similarly conducted to determine whether CREB and Sp1 also bind to the 1 promoter regions containing either PGRE1 or PGRE2. Synthetic 32P-labeled oligonucleotide probes utilized in these studies include 1) 32P-CTCTCGGGCC GAGTCCCTGC CCCTGGCGCC G (–81 to –111), 2) 32P-GCTGCCTGCG CGTCCCTCAC CGC (–235 to –213), and 3) 32P-GCGTCCCGGA GTGACCTTCC CCCAC (–456 to –432), which are homologous to regions on the 1 promoter containing PGRE3, PGRE2, and PGRE1, respectively. Following binding reactions with nuclear extracts and these labeled probes, the products were separated by PAGE and subjected to autoradiography (Fig. 2). The autoradiograms showed multiple 32P-labeled bands in each gel, each band presumably representing a unique nuclear protein-DNA complex.
|
The results of the competition study with excess unlabeled CRE oligo indicated that the intensity of a number of the 32P-labeled bands was reduced, primarily when 32P-labeled oligos containing either PGRE1 or PGRE3 were utilized. For example, when an excess of unlabeled CRE oligo was used, an 81% reduction in the intensity of band A was obtained with 32P-labeled 32P-GCGTCCCGGA GTGACCTTCC CCCAC (containing PGRE1), and a 92% reduction in the intensity of band A'' was obtained with 32P-labeled CTCTCGGGCC GAGTCCCTGC CCCTGGCGCC G (containing PGRE3). However, the ability of the unlabeled CRE oligo to compete with 32P-labeled GCTGCCTGCG CGTCCCTCAC CGC (containing PGRE2) was considerably lower (exemplified by a 49% reduction in the intensity of band A'). Similar results were obtained when the ability of an unlabeled consensus Sp1 oligonucleotide to compete with labeled oligos containing either PGRE1, PGRE2, or PGRE3 was examined, as shown in Fig. 2B.
Our previous EMSA results with a 32P-labeled PGRE3 oligo indicated that both an anti-CREB and anti-Sp1 antibody caused supershifts (25). Similar studies were conducted to determine whether an anti-CREB or anti-Sp1 antibody could supershift 32P-DNA-nuclear protein complexes that formed when either 32P-GCGTCCCGGA GTGACCTTCC CCCAC (containing PGRE1) or 32P-GCTGCCTGCG CGTCCCTCAC CGC (containing PGRE2) was used.
Figure 2C shows the supershifted bands that formed when EMSAs were conducted with an anti-CREB antibody and 32P-labeled GCGTCCCGGA GTGACCTTCC CCCAC (containing PGRE1) and 32P-GCTGCCTGCG CGTCCCTCAC CGC (containing PGRE2). However, a supershift with an anti-Sp1 antibody was only obtained when 32P-labeled GCGTCCCGGA GTGACCTTCC CCCAC (containing PGRE1), rather than 32P-GCTGCCTGCG CGTCCCTCAC CGC (containing PGRE2), was used. The specificity of the antibody reactions was indicated in control EMSAs conducted with either an anti-CREB or anti-Sp1 antibody as well as either 1) a labeled consensus CRE oligo (AGAGATTGCC TGACGTCAGA GAGCTAG), 2) a labeled mutant CRE oligo (AGAGATTGCC TGTGGTCAGA GAGCTAG), or 3) a labeled consensus Sp1 oligo (ATTCGATCGG GGCGGGGCGA GC) (Fig. 2D).
DNA affinity precipitation studies. To further investigate the ability of PGREs to bind transcription factors, DNA affinity precipitation assays were conducted. A biotinylated oligo, 5'-CTCTCGGGCC GAGTCCCTGC CCCTGG-3' (–86 to –111), which contained PGRE3, was incubated with an MDCK nuclear extract, followed by streptavidin-agarose precipitation, electrophoresis, and transfer of the nuclear proteins to nitrocellulose. The results of Western blot analysis (Fig. 3A) indicate that CREB, Sp1, Sp3, and TBP (a component of TFIID) all coprecipitate with biotinylated CTCTCGGGCC GAGTCCCTGC CCCTGG, which contained PGRE3.
|
Similarly, 3.8-fold more Sp1 binding was obtained with biotinylated 5'-CTCTCGGGCC GAGTCCCTGC CCCTGG-3' (–86 to –111) containing PGRE3 than with biotinylated 5'-GCTGCCTGCG CGTCCCTCAC CGC-3' (–213 to –235) containing PGRE2. Sp1 binding to biotinylated 5'-GTCCCGGAGT GACCTTCCCC CAC-3' (–432 to –454) containing PGRE1 was only 1.4-fold higher than the binding obtained with biotinylated 5'-GCTGCCTGCG CGTCCCTCAC CGC-3' (–213 to –235) containing PGRE2. These results are consistent with the EMSA results and the hypothesis that a nuclear protein complex containing CREB and Sp1 associates with PGRE1 and PGRE3 on the Na-K-ATPase 1-subunit promoter.
Functional Role of CREB and Sp1 in Regulation by PGRE1 and PGRE3
Because the results of our EMSAs and DNA precipitation assays suggested that CREB and Sp1 bind PGRE1 and PGRE3, the functional significance of these observations was evaluated. Initially, the effect of a dominant negative CREB (KCREB) on the PGE1 stimulation was examined. MDCK cells were transiently transfected with either pLuc-MCS 421–456 (which contains PGRE1) or pLuc-MCS 82–115 (that contains PGRE3), and KCREB, followed by a 36-h incubation to allow for KCREB expression. Figure 4A shows that when MDCK cells were cotransfected with KCREB and pLuc-MCS 421–456, or with KCREB and pLuc-MCS 82–115, the PGE1 stimulation was substantially reduced compared with untreated controls. In the case of pLuc-MCS 421–456, the PGE1 stimulation was 3.8 ± 0.2-fold (following the extended incubation). In the presence of KCREB, luciferase gene expression was below basal levels observed with the empty vector, although a modest PGE1 stimulation was still observed relative to the KCREB control (to 1.6 ± 0.1-fold). Similar observations were made in the case of pLuc-MCS 82–115. In the absence of KCREB, a 5.1 ± 0.7-fold PGE1 stimulation was observed. In the presence of KCREB, the PGE1 stimulation was only observed relative to the PGE1 controls transfected with KCREB (1.4 ± 0.3). These observations are consistent with the involvement of CREB in mediating the PGE1 stimulation through PGRE1- and PGRE3-regulatory elements.
|
1-subunit promoter (14). Previously, the T3-thyroid hormone receptor (TR) complex was observed to antagonize the effect of CREB on transcription of the human prepro TRH gene, which has a promoter with a similar overlap of TRE/CRE bases (31). For this reason, the effect of T3 on the PGE1 stimulation by pLuc-MCS 421–456 was examined. As shown in Fig. 4B, incubation with T3 reduced this PGE1 stimulation by 66 ± 11%. However, T3 similarly reduced the PGE1 stimulation observed with pLuc-MCS 85–117 by 60 ± 1%. Thus the inhibitory effect of T3 on the PGE1 stimulation could not necessarily be attributed to the binding of T3 to a TRE on the DNA. Dependence of Transcription on Sp1
To determine whether Sp1 is involved in regulating transcription through either PGRE1 or PGRE3, transient transfection studies were conducted with Drosophila SL2 cells (which are generally deficient in Sp proteins, including Sp1) (9). The expression vectors pLuc-MCS 421–456 (which contains PGRE1) and pLuc-MCS 85–117 (which contains PGRE3) were employed, as well as the Sp1 expression vector pPacSp1. Figure 5 shows that when SL2 cells were cotransfected with pLuc-MCS 421–456 and pPacSp1, luciferase gene expression increased 10 ± 1-fold relative to expression levels obtained with control cells cotransfected with the empty vector pPacO. Although this effect was significant, the effect of cotransfecting with pPacSp1 and pLuc-MCS 85–117 resulted in stimulation of a much greater magnitude (708 ± 103-fold vs. the pPacO control).
|
421–456 and pLuc-MCS 85–117 gene expression in SL2 cells is presumably due to Sp1 binding to the GC boxes adjacent to the PGREs on these promoters. However, Sp1 binding to these GC boxes may also be required for PGRE function, which also affects transcription. These possibilities were further evaluated by means of transient transfection studies in SL2 cells with pLuc-MCS 72–167, containing the sequence illustrated in Fig. 6A, which includes PGRE3. In addition, Fig. 6A shows the sequences inserted into the other pLuc-MCS vectors utilized here, including –167 to –72 mut PGRE3 (contained within pLuc-MCS 72–167 mut PGRE3 and with mutations in PGRE3), and –167 to –72 mut GC box 1 (contained within pLuc-MCS 72–167 mut GC Bx1 and with mutations in GC box adjacent to PGRE3).
|
72–167 and pPacSp1, a 1,326 ± 192-fold increase in gene expression was obtained compared with control SL2 cells cotransfected with pLuc MCS 72–167 and the empty vector pPacO. However, Fig. 6B also shows that the level of gene expression obtained with pLuc-MCS 72–167 with a GC box mutation was only 6% of the level obtained with cotransfection with wild-type pLuc-MCS 72–167 and pPacSp1 (an 84 ± 13-fold stimulation was obtained).
Possibly, the stimulatory effect of pPacSp1 is simply due to Sp1 binding to the Sp1 site located at –111 to –117, independent of any interaction with the PGRE. However, Fig. 6B shows that in SL2 cells cotransfected with pPacSp1 and pLuc-MCS 72–167 mut PGRE3 (a vector with mutations in the PGRE3 site), the level of luciferase gene expression was substantially reduced compared with the wild-type phenotype. Although cotransfection of pLuc-MCS 72–167 mut PGRE3 with pPacSp1 still caused a 166 ± 27-fold increase relative to the pLuc-MCS 72–167 mut PGRE3 control (cotransfected with pPacO), this level of stimulation was only 13 ± 2% of the stimulation obtained with the normal genotype, pLuc-MCS 72–167, in the presence of pPacSp1.
Effects of Mutations in Sp1 and PGRE3 on the PGE1 Response
To study the role of PGRE3 and Sp1 in mediating the prostaglandin response, transient transfection studies were conducted with normal and mutant pLuc-MCS 72–167 vectors in MDCK cells. Figure 7A shows that both the PGRE3 mutation and the mutation in the adjacent GC box resulted in a complete loss of PGE1 stimulation. Figure 7A also shows that the same result was obtained when the two GC boxes immediately upstream of PGRE3 were translocated farther upstream (the translocation as illustrated in Fig. 6A). These results support the hypothesis that both PGRE3 and the adjacent GC boxes (located at –117 to –112 and at –143 to –139, respectively) are required for a prostaglandin response.
|
72–167 and pCRE-Luc, a pLuc-MCS vector containing a minimal promoter with four consensus CRE sites (in tandem) immediately upstream from a TATA box. Figure 7B shows that equivalent PGE1 stimulation was obtained with pLuc-MCS 72–167 and pLuc-MCS CRE (31 ± 4- and 39 ± 9-fold, respectively). |
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
- and -subunits of the Na-K-ATPase are subject to differential regulation by a number of hormones and effector molecules (16, 24). The differential regulation of the - and -subunits can be explained, at least in part, by their discoordinate regulation at the transcriptional level. External factors that primarily affect Na-K-ATPase -subunit gene expression have received particular attention in those cases where the level of newly synthesized -subunits are limiting to the formation of / heterodimers (15, 40). For example, in LLC-PK1 cells incubation in medium with low-K+ concentrations resulted in a selective increase in -subunit mRNA levels, without a significant effect on -subunit mRNA levels (22). Thus the consequent increase in Na-K-ATPase levels was attributed to the selective increase in -subunits. However, the Na-K-ATPase -subunit is not necessarily rate limiting for / assembly.
Indeed, changes in the external milieu result often result in changes in both - and -subunit mRNA levels. In MDCK cells, low external K+ caused a 1.9-fold increase in -subunit mRNA levels in addition to a 2.3-fold increase in -subunit mRNA levels (2). Similarly, hyperoxia caused a 3.4-fold increase in -subunit mRNA levels and a 1.4-fold increase in -subunit levels in MDCK cells (43). Although veratridine caused a 1.6-fold increase in -subunit mRNA levels in primary rat myoblasts, in addition to a 2.6-fold increase in -subunit mRNA (36), the investigators nonetheless propose that the increase in -subunit mRNA was responsible for the consequent increase in / heterodimer formation.
Nevertheless, different sets of stimuli can modulate - and -subunit levels in very different manners, even in a manner such that an increase in the -subunit is the predominant change. Thus a detailed examination of both - and -subunit gene regulation may ultimately be required both in vitro and in vivo to obtain a full understanding of the phenomenon. Previously, we observed that PGE1 and 8-BrcAMP increase Na-K-ATPase 1-subunit mRNA levels to a greater extent than 1 mRNA levels (37). These changes were associated with an increase in Na-K-ATPase activity (37, 40). For this reason, we initiated our investigations with an analysis of Na-K-ATPase 1-subunit gene expression in MDCK cells.
Previously, we presented evidence indicating that PGE1 stimulates transcription of the human 1-subunit gene and that regulation could be attributed, at least in part, to a PGRE, AGTCCCTGC (located at –92 to –100) (25, 37). In this study, we have presented evidence indicating that additional PGREs are involved in mediating the regulation of the Na-K-ATPase 1-subunit gene by prostaglandins, including PGRE1 (TGACCTTC; located at –445 to –438); PGRE2 (GTCCCTCA; located at –226 to –216); as well as the previously identified PGRE (AGTCCCTGC; located at –92 to –100, referred to in this report as PGRE3). Although the PGE1 stimulation was also obtained with pLuc-MCS 211–240 (containing PGRE2), we have examined the regulation through the PGRE1 element in greater detail than PGRE2.
Our experimental results indicate that the PGE1 response occurring through both PGRE1 and PGRE3 is dependent on CREB. Exposure to agonists that activate adenylate cyclase stimulates CREB phosphorylation (48). CREB phosphorylation may also occur in response to agonists that act through Ca2+ and/or PKC. A consequence of CREB phosphorylation at Ser 133 is the recruitment of CBP to the promoter region, and the binding of CBP to CREB (33). However, CREB phosphorylation is not a necessary indicator of target gene activation (48). In a number of promoter systems, CREB binding to a single CRE site is not sufficient to mediate a significant functional response to cAMP (34). In these cases, a strong regulatory effect of CREB is observed only if multiple CREB binding sites were present (35), or if additional regulatory elements are present. Included among such regulatory elements are the hepatic nuclear factor 4 binding site in the tyrosine aminotransferase promoter (32) and C/EBP in the phosphenolpyruvate carboxykinase promoter (34). Thus a number of investigators have concluded that CREB requires additional regulatory partners, including Sp1, to recruit the transcriptional apparatus to the promoter region of CREB-activated genes (48).
Our results also indicate that Sp1 is involved in mediating the effects of PGE1 on Na-K-ATPase 1-subunit gene transcription. Previously, Sp1 was reported to play a critical role in the upregulation of the Na-K-ATPase 1-subunit gene. However, in this case the Sp1 binding site was different (located at –59 on the rat promoter) and was sufficient for the increased transcription (which occurred in response to hyperoxia) (42). An Sp1-Sp3 interaction was proposed to occur in this case, rather than an Sp1-CREB interaction. In contrast, synergism between an ATF/CRE site and an adjacent downstream GC box was proposed to be required for basal transcription of the rat Na-K-ATPase 1-subunit gene (21). Regulatory interactions between transcription factors observed under basal conditions may be altered during the upregulation of transcription. For example, basal transcription of the folate receptor type gene depends on a synergistic interaction between Sp1 and ets, as well as repression by upstream AP-1 like elements (17). Upregulation [which occurs in response to all trans-retinoic acid (RA)] involves the binding of RA receptor (RAR) to the Sp1 site and reduced association of RAR and - to the AP-1 site. Similarly, under basal conditions the transcription of the plasminogen activator inhibitor-1 gene is minimal in vascular smooth muscle cells, due to a binding complex between a transcriptional repressor and Sp1 (which involves 2 Sp1 sites) (7). Upregulation of the plasminogen activator inhibitor-1 gene by glucose in vascular smooth muscle cells involves the release of the transcriptional repressor from this complex.
Our DNA affinity precipitation studies indicate that Sp3, like Sp1, binds to PGRE3 in the human Na-K-ATPase 1 promoter. Sp3 may act as either a transcriptional repressor or a transcriptional activator. While Sp3 represses Sp1 transcriptional activation of the human thrombin receptor (46), Sp3 has been observed to upregulate Sp1 transcriptional activation of the hepatic growth factor promoter (47). Further investigations are needed to evaluate whether Sp3 acts as either an activator or a repressor in mediating regulation through PGREs.
The TR was previously reported as being a CREB binding partner and regulating transcription of the Na-K-ATPase 1 promoter (14). In GH4C1 rat pituitary cells, the TR was observed to antagonize CREB-mediated transcription of the pituitary-specific transcription factor GHF-1/Pit-1 (28). CREB binds to two CRES in the GHF-1/Pit-1 promoter. Following treatment with a cAMP agonist, CREB is phosphorylated by cAMP-dependent protein kinase, while binding to two CRE sites. Although the TR does not bind to the GHF-1/Pit-1 promoter, an interaction of the TR with CREB prevents CREB phosphorylation and gene activation. Similarly, in the human prepro TRH promoter, the TR can bind to four different TREs, including two TREs with overlapping TRE/CRE bases (44). In this case, the TR-T3 complex was similarly inhibitory to cAMP-mediated regulation, while unliganded TR was stimulatory. In this report, T3 antagonized the PGE1 stimulation observed with pLuc MCS 421–526 (which contains PGRE1). PGRE1 (–438 to –445) is overlapping with the TRE in this region. However, T3 also antagonized the PGE1 stimulation obtained with pLuc MCS 85–117 (which contains PGRE3), suggesting that the inhibitory effect of T3 is not necessarily the result of a TR-T3 complex binding to a TRE.
Here, we have observed that the PGE1 stimulation obtained with pLuc-MCS 72–167 (that contains PGRE3) and pLuc-MCS 421–526 (that contains PGRE3) is of a much greater magnitude than that with pH1–1141Luc. Possibly, additional (but as of yet undefined) regulatory elements are present on the entire Na-K-ATPase 1-subunit promoter that modulate the amplitude of the PGE1 response. Other regulatory elements on the 1 promoter, which may play a role in mediating prostaglandin's effects, include a CAAT box, several Sp1 sites, a CREB binding site, and a TATA box, which are clustered close to the initiation site for transcription in the Na-K-ATPase 1-subunit promoter, in addition to other elements more distal from the transcription initiation start site. Thus the ability of either PGRE1 and/or PGRE3 to mediate a prostaglandin response is dependent on the complexities of the local hormonal milieu (as exemplified by the case of thyroid hormone and PGRE1). Future studies will be concerned with delineating the nature of these complex hormonal interactions.
|
GRANTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
|
ACKNOWLEDGMENTS |
|---|
1–1141 Luc, Dr. Richard Goodman for Rc/RSV-KCREB and Rc/RSV, as well as Dr. Robert Tjian for pPacO, pPacSp1, and pPacgal. |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
1 gene promoter by mineralocorticoid and glucocorticoid receptors. J Biol Chem 273: 20702–20711, 1998.1 gene. Nucleic Acids Res 21: 2619–2626, 1993.1 subunit gene is essential for constitutive expression. Biochem Biophys Res Commun 241: 169–174, 1997.[CrossRef][Web of Science][Medline], and not , subunit mRNA. J Biol Chem 265: 17935–17940, 1990.1 promoter that is regulated by cAMP and Ca2+: evidence for an interactive role of cAMP regulatory element-binding protein and Sp1. J Biol Chem 280: 334–346, 2005.1 transcription by hyperoxia is mediated by SP1/SP3 binding. J Biol Chem 275: 41396–41404, 2000.This article has been cited by other articles:
|
|
 |
|
  R. Tan, X. Zhang, J. Yang, Y. Li, and Y. Liu Molecular Basis for the Cell Type Specific Induction of SnoN Expression by Hepatocyte Growth Factor J. Am. Soc. Nephrol., August 1, 2007; 18(8): 2340 - 2349. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
