AJP - Renal Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 291: F635-F646, 2006. First published February 14, 2006; doi:10.1152/ajprenal.00452.2005
0363-6127/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/3/F635    most recent
00452.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matlhagela, K.
Right arrow Articles by Taub, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matlhagela, K.
Right arrow Articles by Taub, M.

Regulation of the Na-K-ATPase beta1-subunit promoter by multiple prostaglandin-responsive elements

Keikantse Matlhagela and Mary Taub

Biochemistry Department, School of Medicine and Biomedical Sciences, State University of New York at Buffalo, Buffalo, New York

Submitted 14 November 2005 ; accepted in final form 7 February 2006


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Renal prostaglandins modulate the activity of a number of the transport systems in the kidney, including the Na-K-ATPase. Not only do prostaglandins have acute affects on renal Na-K-ATPase, but in addition prostaglandins have chronic affects, which include regulation at the transcriptional level. Previously, we have presented evidence that one such prostaglandin, PGE1, stimulates the transcription of the human Na-K-ATPase beta1-subunit gene in Madin-Darby canine kidney cells via cAMP- and Ca2+-mediated pathways (Taub M, Borsick M, Geisel J, Matlhagela K, Rajkhowa T, and Allen C. Exp Cell Res 299: 1–14, 2004; Matlhagela K, Borsick M, Rajkhowa T, and Taub M. J Biol Chem 280: 334–346, 2005). Evidence was presented indicating that PGE1 stimulation was mediated through the binding of cAMP-regulatory element binding protein (CREB) to a prostaglandin-responsive element (PGRE) as well as Sp1 binding to an adjacent Sp1 site. In this report, we present evidence from EMSAs and DNA affinity precipitation studies that another PGRE present in the Na-K-ATPase beta1-subunit promoter similarly binds CREB and Sp1. The evidence that indicates a requirement for CREB as well as Sp1 for gene activation through both PGREs (PGRE1 and PGRE3) includes studies with a dominant negative CREB (KCREB), Drosophila SL2 cells, and PGRE mutants. The results of these studies are indicative of a synergism between Sp1 and CREB in mediating regulation by PGRE3; while regulation occurring through PGRE1 also involves Sp1 and CREB, the mechanism appears to be distinct.

Madin-Darby canine kidney cells; transport; gene regulation; kidney; eicosanoids


RENAL PROSTAGLANDINS ARE PRODUCTS of arachidonic acid (AA) metabolism by cyclooxygenase, which act as modulators of a number of renal functions, including Na+ transport (29). Investigations concerning prostaglandins' effects on Na+ transport in tubule epithelial cells in the intact kidney have been complicated by the varying responses of different types of tubule epithelial cells to prostaglandins, as well as by the distinct modes of regulation of prostaglandins by cyclooxygenase 1 (COX-1), as well as by COX-2, which are present in distinct locales in the kidney (20). In addition to responding to exogenous prostaglandins, tubule epithelial cells produce prostaglandins, which act in an autocrine manner (29). This is exemplified in the case of principal cells in the collecting duct, in which endogenous AA is released following the activation of phospholipase A2. The released AA may then either act directly to inhibit apical Na+ influx by the epithelial Na+ channel (ENaC), or the AA may be metabolized to PGE2, so as to maximize basolateral Na+ efflux (45). Of particular interest to this report are the mechanisms by which prostaglandins affect one such basolateral membrane transport system, the Na-K-ATPase.

The Na-K-ATPase is an integral membrane protein that plays an essential role in the physiology of animal cells. The Na-K-ATPase maintains an electrochemical gradient by transporting three intracellular Na+ molecules out of the cells in exchange for three extracellular K+ molecules, in an ATP-dependent manner (18). The electrochemical gradient established by the Na-K-ATPase is required for a number of cellular processes, including cell volume regulation, maintenance of the action potential in excitable cells, and the activity of a number of membrane transport systems (19). In the kidney, the Na-K-ATPase is localized in the basolateral membrane and is integral to the process of sodium reabsorption (12, 13, 18, 24, 27). The electrochemical gradient established by the renal Na-K-ATPase acts as the driving force for the translocation of glucose, phosphate, and amino acids across the apical membrane by Na+/solute cotransport systems (23). Subsequently, these solutes are transported out of the cells' basolateral membrane by means of another set of transport systems.

The Na-K-ATPase is composed of an {alpha}-subunit (110 kDa), responsible for the transport activity, as well as a glycosylated beta-subunit (60 kDa). The beta-subunit facilitates the correct assembly and transport of the {alpha}-subunit into the basolateral membrane of epithelial cells. This process is dependent on {alpha}/beta heterodimer formation, which is limited by the levels of newly synthesized {alpha}- and beta-subunits (4, 15). The level of the newly synthesized beta-subunit has been found in some cases to be a limiting factor in {alpha}/beta heterodimer formation (15). In those cases in which the newly synthesized beta-subunit is limiting, regulatory changes that affect beta-subunit levels ultimately affect overall Na-K-ATPase levels and sodium reabsorption by the kidney.

The activity of the Na-K-ATPase changes in response to changes in the extracellular environment. Acute regulation of the enzyme, which occurs within minutes to hours of a stimulus, generally occurs posttranslationally. Chronic regulation, which occurs within hours to days, involves changes in the numbers of Na-K-ATPases. Included among the regulatory changes that affect the numbers of Na-K-ATPases are changes in the general hormonal milieu as well as in more localized, organ-specific signals (16, 24). In the kidney, hormones that regulate the level of expression of the Na-K-ATPase {alpha}- and beta-subunit genes (and ultimately modulate Na-K-ATPase levels) include glucocorticoids, mineralocorticoids, and thyroid hormone (5, 10, 14). In addition, endogenously produced effector molecules that play a role in regulating the renal Na-K-ATPase include dopamine, angiotensin, and prostaglandins, the products of AA metabolism by COX (25, 37).

Transcriptional regulation of the Na-K-ATPase may occur via a number of mechanisms. Hormones such as glucocorticoids, minerolocorticoids, and thyroid hormone bind to specific cytoplasmic receptors, which then enter the nucleus as a hormone-receptor complex, and then the hormone-receptor complex binds to regulatory elements located in the promoter region of the target genes (5, 14). Ultimately, changes observed at the transcriptional level affect the level of the Na-K-ATPase in the plasma membrane, which are in addition to any posttranscriptional affects, which may occur as a consequence of hormone treatment. In contrast, effector molecules that act via G protein-coupled receptors, such as prostaglandins, activate signaling pathways including cAMP, PKC, and/or other Ca2+-regulated signaling pathways, which ultimately also affect transcription (8).

Previously, we reported that PGE1 stimulates the activity of the Na-K-ATPase in Madin-Darby canine kidney (MDCK) cells (37, 40) and that the increase in Na-K-ATPase activity caused by PGE1 can be explained by regulation at the transcriptional level (37). The regulation of beta-subunit transcription by prostaglandins was examined in detail, using a human Na-K-ATPase beta1 promoter/luciferase construct, pHbeta1–1141Luc (Fig. 1A) (14, 25, 37). We defined a region within the Na-K-ATPase beta1-subunit promoter (–83 to –182) that is required to elicit the effects of PGE1, as well as a prostaglandin-responsive element (PGRE) within this region (AGTCCCTGC; –92 to –100) that was required to elicit a PGE1 stimulation (25). EMSAs indicated that both the cAMP-regulatory element binding protein (CREB) and Sp1 are involved in mediating a PGE1 stimulation by binding to the PGRE and an adjacent Sp1 site, respectively (25). The involvement of the PGRE and adjacent Sp1 sites was also indicated by studies with mutant constructs (25).


Figure 1
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Regulation by prostaglandin-responsive elements (PGREs). A: human Na-K-ATPase beta1-subunit promoter. Three possible PGRE sites on the human Na-K-ATPase beta1-subunit promoter are illustrated. Previously, a mineralocorticoid-response element/glucocorticoid-response element (MRE/GRE), a thyroid hormone-response element (TRE), a CAAT box, and a TATA box were identified. The sequences of PGRE1, PGRE2, and PGRE3 are shown. B: regulation of transcription by PGRE1, PGRE2, and PGRE3. C: effect of deletion of PGRE2 and PGRE3 on transcription. Madin-Darby canine kidney (MDCK) cells were transiently transfected with either pLuc-MCS beta421–456, pLuc-MCS beta211–240, or pLuc-MCS beta85–117 (B) or either pHbeta1–1141Luc or pHbeta1–1141Luc ({Delta}72–299; C). For each expression vector, the effect of a 4-h incubation with either 1.4 µM PGE1, 1 mM 8-bromo-cAMP (8-BrcAMP), or 1 nM phorbol 12-myristate 13-acetate (TPA) on luciferase gene expression was examined. Values are the averages ± SE of quadruplicate determinations.

 
While these previous studies indicated the presence of a PGRE with the sequence AGTCCCTGC within the human beta1-subunit promoter (–92 to –100), the 5' deletion analysis did not necessarily exclude the presence of additional PGREs within the beta1-subunit promoter. In this study, we examine the possibility that there are indeed additional PGRE sites. Evidence is presented indicating that indeed a second PGRE is present within the human beta1-subunit promoter and that regulation through this PGRE is via a similar, albeit distinct mechanism from that occurring by the previously identified PGRE (at –92 to –100).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials

Hormones, human transferrin, PGE1, and other chemicals were from Sigma (St. Louis, MO). Synthetic double-stranded oligonucleotides, medium, fetal bovine serum, soybean trypsin inhibitor, lipofectamine, and Cellfectin Reagent were from Invitrogen (Carlsbad, CA). BioMax MS-2 film, [{gamma}-32P]dCTP and [{alpha}-32P]dATP were from PerkinElmer Life Sciences. The Galacto-Star system was from Applied Biosystems (Bedford, MA). The pSVbetagal plasmid, reporter lysis buffer, as well as the consensus Sp1 and CRE oligonucleotides were from Promega (Madison, WI). The Prism 4 program was obtained from GraphPad Software (San Diego, CA). Nitrocellulose membranes, the Immun-Star AP Detection Kit, and other reagents for electrophoresis were from Bio-Rad (Hercules, CA). Streptavidin-agarose was from Pharmingen (San Diego, CA), and Drosophila SL2 cells were from the American Type Culture Collection (Manassas, VA).

The affinity-purified rabbit polyclonal antibodies, which were employed in these studies, were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-human CREB-1 antibody (C-21, sc-186) recognizes dog CREB, which has an identical sequence to human CREB (NCBI database). Anti-CREB-1 also recognizes ATF-1 and CREM-1, although these proteins have molecular masses below 40 kDa. The epitope recognized by the anti-human Sp1 antibody (H-225, sc-1402X) includes the NH2-terminal amino acids 121–345. The corresponding epitope in dog Sp1 is 98% identical to sequence 121–345 of the human protein (NCBI database), unlike other members of the Sp1 family (the most similar protein dog Sp4 having only a 36% identity). The anti-human Sp3 antibody recognizes the COOH terminus of Sp3 (99% homology between dog and human), whereas the anti-human CREB antibody (A-22, sc-369) is against an NH2-terminal epitope (95% homology between dog and human). The anti-TFIID antibody (N-12, sc-204) is against an epitope mapping at the NH2 terminus of TFIID binding protein (TBP; 96% homology between dog and human). TBP is a component of human TFIID.

Expression Vectors

The Rc/RSV-KCREB vector, containing a dominant negative CREB (KCREB), and the empty vector Rc/RSV were obtained from Dr. Richard Goodman (Univ. of Oregon) (41). The Drosophila expression vectors pPacO, pPacSp1, and pPacbetagal were obtained from Dr. Robert Tjian (UC Berkeley) (9). The human Na-K-ATPase beta1 promoter/luciferase construct pHbeta1–1141Luc (Fig. 1A) was obtained from Dr. Jerry Lingrel (Univ. of Cincinnati) (14). The deletion mutant pHbeta1–1141Luc{Delta}71–298, pHbeta1–1141Luc was obtained by the digestion of pHbeta1–1141Luc with BamH1 and BalI and ligation using T4 DNA ligase.

The vector pLuc-MCS (Stratagene, La Jolla, CA) contained a minimal promoter with a TATA box linked to the luciferase gene. The cis-reporting plasmid pCRE-Luc (Stratagene) contains four consensus CRE elements (AGCCTGACGTCAGAG) in tandem, immediately upstream of the TATA box in pLuc-MCS. Other constructs were created by ligating synthetic oligos into the HindIII/XhoI site immediately upstream of the TATA box. For pLuc-MCS-beta72–167, the synthetic oligo (homologous to –167 to –72 of the beta1 promoter) (Fig. 1A) was CAGCGATCCA AGCGGCCCCT CTAGCCCCGGCGGCTCCTTT GTGCCGGCCC CGAACCCGCC CTCTCGGGCC GAGTCCCTGC CCCTGGCGCC GGCGATTGGC. For pLuc-MCS beta72–167 mut PGRE, the insert was homologous to –167 to –72 within the beta1 promoter but had mutations in PGRE3, CAGCG ATCCAAGCGG CCCCTCTAGC CCCGGCGGCT CCTTTGTGCC GGCCCCGAAC CCGCCCTCTC GGGCCGATTA GTAAACCCTG GCGCCGGCGA TTGGC. For pLuc-MCS 72–167 mut GC Bx 1, the insert was homologous to –167 to –72 within the beta1 promoter, with mutations in the GC box (–111 to –117), CAGCG ATCCAAGCGG CCCCTCTAGC CCCGGCGGCT CCTTTGTGCC GGCCCCGAAA ATTACATCTC GGGCCGAGTC CCTGCCCCTG GCGCCGGCGA TTGGC. pLuc-MCS-beta72–167-2GCtrans (25) contained CGATGGCGGCCCGCCCCCA AGCGGCCCCT CTAGCCCC^CTCCTTT GTGCCGGCCC CGAA^T CTCGGGCC GAGTCCCTGC CCCTGGCGCC GGCGATTGGC, in which the two GC boxes immediately upstream of PGRE3 were translocated farther upstream, as indicated in bold. Synthetic oligodeoxynucleotides containing PGRE1 (–456 to –421; GGCGTCCCGG AGTGACCTTC CCCCACCCCG CCAGC), PGRE2 (–240 to –211; GCGGCGCTGC CTGCGCGTCC CTCACCGCC), and PGRE3 (–115 to –82; CCCGCC CTCTCGGGCC GAGTCCCTGC CCCTGG C) were similarly individually ligated into pLuc-MCS, creating the vectors pLuc-MCS-beta421–456, pLuc-MCS-beta211–240, and pLuc-MCS-beta85–117, respectively. The composition of the recombinant pLuc-MCS vectors was confirmed by sequencing.

Animal Cell Culture Conditions

The basal medium for MDCK cells was DMEM/F-12 (50:50) supplemented with 15 mM HEPES (pH 7.4), 20 mM sodium bicarbonate, 92 U/ml penicillin, and 200 µg/ml streptomycin (DMEM/F-12). The basal medium was further supplemented with growth factors immediately before use (39). Stock MDCK cell cultures were grown in basal medium supplemented with 5 µg/ml bovine insulin, 5 µg/ml human transferrin, 5 x 10–12 M triiodothyronine (T3), 5 x 10–8 M hydrocortisone, 25 ng/ml PGE1, and 5 x 10–8 M selenium (Medium K-1) in a humidified 5% CO2-95% air environment at 37°C (39), and MDCK cells were routinely subcultured using EDTA/trypsin, as described previously (39). For experimental studies, MDCK cells were cultured in basal medium supplemented with 5 µg/ml insulin and 5 µg/ml transferrin. Drosophila SL2 cells were maintained in Schneider's medium supplemented with 46 U/ml penicillin, 50 µg/ml streptomycin, and 10% heat-inactivated FBS in a humidified environment at 25°C. SL2 cells were detached from culture flasks by mechanical shaking.

Transient Transfection Studies

MDCK cells were transiently transfected using Lipofectamine, as previously described (37). To summarize, MDCK cells (plated at 105 cells/35-mm dish) were cotransfected with 1 µg of the appropriate vector(s), as well as pSVbetagal (0.2 µg). The next day, the medium was changed, and 2 h later appropriate effector molecules were added. After an additional 4-h incubation, the monolayers were solubilized in reporter lysis buffer and centrifuged (14,000 rpm, 1 min).

Drosophila SL2 cells (106 cells/35-mm dish) were transiently transfected using Cellfectin with appropriate vectors (including pPacbetagal) in 1 ml of Schneider's medium lacking antibiotics and FBS. After the initial 4 h of transfection, FBS was added to a final concentration of 10%. The next day, an additional 1 ml of Schneider's medium containing 10% FBS was added to the cultures. Twenty-four hours later, the medium was removed by aspiration and monolayers were solubilized in reporter lysis buffer.

The luciferase activity of cell lysates was determined using luciferase assay buffer [20 mM Tricine, 1.07 mM MgCO3·4 Mg(OH)2, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM DTT, 270 µM coenzyme A, 470 µM luciferin, and 530 µM ATP]. Emitted light was measured in a Packard Tri-Carb 4530 Scintillation Counter with the coincidence circuit turned off. beta-Galactosidase activity was determined using the Galacto-Star System. The beta-galactosidase activity of experimental cultures was expressed as a fraction of the activity in control cultures. Each luciferase assay determination was normalized with respect to its beta-galactosidase activity. Each luciferase value was the mean ± SE of quadruplicate determinations. In each experimental set, the mean value was divided by the indicated control value to obtain the fold-stimulation/inhibition. The experimental results were then subjected to a one-way ANOVA and the Newman-Keuls multiple comparison test (Prism 4 software). Differences were significant when P < 0.05.

Preparation of Nuclear Extracts

Nuclear extracts were prepared from MDCK cells by a modification (1, 25) of the procedure of Dignam et al. (11). Confluent MDCK monolayers in 100-mm dishes were washed twice with PBS at 4°C, removed from culture dishes with a rubber policeman, and transferred into microcentrifuge tubes. After centrifugation (2,000 rpm, 10 s, 4°C), the pellet was resuspended in a hypotonic buffer [10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.2 mM phenylmethylsulfonyl fluoride (PMSF), and 0.5 µg/ml leupeptin] at 4°C (using ≥2x the packed cell volume). After swelling (4°C, 10 min), the material was vortexed (20 s) and centrifuged (2,000 rpm, 10 s, 4°C). The pellet was resuspended in a high-salt buffer (20 mM HEPES, pH 7.9, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 25% glycerol, 0.2 mM PMSF, 0.5 mM DTT, 0.5 µg/ml leupeptin). After 20 min at 4°C, the suspension was centrifuged (14,000 rpm, 2 min, 4°C), and aliquots of supernatant were quickly frozen in liquid nitrogen. Protein determinations were made using the Bradford method (3).

EMSAs

Synthetic double-stranded oligonucleotides were 32P-labeled by random priming, using [{gamma}-32P]dCTP. Consensus CRE, mutant CRE, and consensus Sp1 oligos were 5'-end-labeled using [{alpha}-32P]dCTP. Included among the oligonucleotides were 1) CTCTCGGGCC GAGTCCCTGC CCCTGGCGCC G (–81 to –111, PGRE3); 2) GCTGCCTGCG CGTCCCTCAC CGC (–235 to –213, PGRE2); 3) GCGTCCCGGA GTGACCTTCC CCCAC (–456 to –432, PGRE1); 4) AGAGATTGCC TGACGTCAGA GAGCTAG (a consensus CRE); 5) AGAGATTGCC TGTGGTCAGA GAGCTAG (a mutant CRE); and 6) ATTCGATCGG GGCGGGGCGA GC (a consensus Sp1 site).

Nuclear extracts (2–6 µg) were first incubated in 9 µl binding buffer containing 10 mM Tris (pH 7.5), 50 mM NaCl, 1 mM MgCl2, 0.5 mM EDTA, 4% glycerol, 0.5 mM DTT, and 0.05 mg/ml poly(dI-dC) in either the presence or absence of unlabeled oligonucleotide (50–200-fold, 37°C, 10 min). Then, a 32P-labeled probe was added, and the incubation continued (20 min, 37°C). In supershift studies, antibody was either added simultaneously with the 32P-labeled probe or following a 20-min incubation with the probe, as specified. The binding reaction was terminated by addition of gel loading buffer [25 mM Tris·HCl (pH 7.5), 0.02% bromophenol blue, 4% glycerol], and samples were separated on nondenaturing 4% acrylamide/0.001% bisacrylamide gels at 35 mA. The gels were dried, subjected to autoradiography, and autoradiograms were scanned with a Bio-Rad scanning densitometer. Band intensities were quantified using the Quantity One program.

DNA Affinity Precipitation Studies

Confluent MDCK monolayers in 100-mm culture dishes were lysed at 4°C in 600 µl HKMG (10 mM HEPES, pH 7.9, 100 mM KCl, 5 mM MgCl2, 10% glycerol, 1 mM DTT, 0.1% Nonidet P-40) containing 1 mM NaF, 1 mM Na3VO4, 1 mM PMSF, 1 µg/ml leupeptin, 1 µg/ml aprotinin, 1 µg/ml pepstatin, and 1 mM EDTA (6). Cells were sonicated (10 s, 4°C) and centrifuged (10,000 g, 5 min, 4°C, 2x). Cell extracts were incubated for 16 h with biotinylated double-stranded oligonucleotides (1 or 5 µg), including 1) 5'-GTCCCGGAGT GACCTTCCCC CAC-3' (–432 to –454, PGRE1); 2) 5'-GCTGCCTGCG CGTCCCTCAC CGC-3' (–213 to –235, PGRE2); and 3) 5'-CTCTCGGGCC GAGTCCCTGC CCCTGG-3' (–86 to –111, PGRE3). Control cell extracts were incubated either in the absence of oligo or with a biotinylated control oligo, 5'-CTACTGCTAT TCTAGTAACT GAC-3'. The results obtained with the control oligo indicated the specificity of binding. Biotinylated DNA-protein complexes were precipitated with streptavidin-agarose beads (1 h), washed with HKMG buffer (3x), separated by SDS-PAGE, and transferred to nitrocellulose. Western blots were analyzed using either anti-CREB, anti-Sp1, anti-Sp3, or anti-TBP antibodies (6, 30).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Role of PGRE1, PGRE2, and PGRE3 in PGE1 Stimulation

Previously, we have shown that Na-K-ATPase beta1-subunit gene expression is regulated by PGE1, 8-bromo-cAMP (8-BrcAMP), and phorbol 12-myristate 13-acetate (TPA) (25, 37). Our previous studies with 5'-deletion mutants indicated that the region between –83 and –182 within the human beta1-subunit promoter was sufficient to observe a PGE1 stimulation. A putative PGRE, AGTCCCTGC, was identified within this region (–100 to –92). However, the 5'-deletion analysis did not exclude the possibility that other PGREs were also present in the human beta1-subunit promoter. Thus here the possibility is examined that additional PGREs are present in the beta1-subunit promoter, including a putative PGRE1 at position –445 to –438 (TGACCTTC) and PGRE2 at position –226 to –216 (GTCCCTCA), in addition to the previously identified PGRE (PGRE3) at –100 to –92 (AGTCCCTGC) (Fig. 1A).

To determine whether these PGREs are individually functional, transient transfection studies were conducted with expression vectors containing each of these three specific elements, including pLuc-MCS beta421–456, pLuc-MCS beta211–240, and pLuc-MCS beta85–117 (containing PGRE1, PGRE2, and PGRE3, respectively). The effect of 1.4 µM PGE1, 1 mM 8-BrcAMP, and 1 nM TPA was examined in MDCK cells transiently transfected with these expression vectors. Figure 1B shows that PGE1 and 8-BrcAMP caused equivalent stimulations, 100 ± 15- and 98 ± 12-fold, respectively, in transient transfections with pLuc-MCS beta85–117 (containing PGRE3). TPA similarly caused a stimulation with pLuc-MCS beta85–117, albeit to a lower extent (2.0 ± 0.8-fold, P < 0.05), indicating that the PKC pathway is also involved. In transient transfection studies with pLuc-MCS beta421–456 (containing PGRE1) and pLuc-MCS beta211–240 (containing PGRE2), significant stimulatory effects of PGE1 and 8-BrcAMP were also observed. However, with pLuc-MCS beta421–456, the PGE1 stimulation (31 ± 13-fold vs. pLuc-MCS beta421 controls) was lower than that obtained with pLuc-MCS beta85–117 (100 ± 15-fold compared with pLuc-MCS beta85–117 controls). A similar observation was made with regard to the 8-BrcAMP stimulation obtained with pLuc-MCS beta421–456 (51 ± 8-fold vs. pLuc-MCS beta421–456 controls), which was lower in magnitude than that obtained with pLuc MCS beta85–117 under these conditions (98 ± 12-fold compared with pLuc MCS beta85–117 controls). Luciferase activity was substantially lower with pLuc-MCS beta211–240 (containing PGRE2); nevertheless, a significant PGE1 and 8-BrcAMP stimulation was observed relative to untreated pLuc-MCS beta211–240 controls (30 ± 13- and 23 ± 2-fold, respectively).

Our previous 5'-deletion analysis indicated that stimulatory effects of PGE1, 8-BrcAMP, and TPA were retained in a 5'-deletion mutant (pHbeta83–182 Luc) containing PGRE3, but lacking PGRE1 and PGRE2 (25). The magnitude of the PGE1, 8-BrcAMP, and TPA stimulation did not differ from that obtained with pHbeta1–1141 Luc, the construct containing the entire beta1-subunit promoter. To determine whether PGRE3 was required to obtain a PGE1 stimulation through the beta1 promoter, we conducted transient transfection studies with pHbeta1–1141Luc ({Delta}72–299), with a deletion mutation, removing both PGRE2 and PGRE3 (illustrated by arrows in Fig. 1A), while retaining putative PGRE1.

Figure 1C shows a stimulatory effect of 1.4 µM PGE1, 1 mM 8-BrcAMP, and TPA in MDCK cells transiently transfected with pHbeta1–1141Luc ({Delta}72–299), as well as with pHbeta1–1141Luc. The total luciferase activity obtained with PGE1, 8-BrcAMP, and TPA was higher with pHbeta1–1141Luc ({Delta}72–299) than with pHbeta1–1141Luc. However, when the stimulatory effects of PGE1, 8-BrcAMP, and TPA obtained in MDCK cells transfected with pHbeta1–1141Luc ({Delta}72–299) are compared with the level obtained in untreated control cells similarly transfected with pHbeta1–1141 Luc ({Delta}72–299), the observed stimulation by PGE1, 8-BrcAMP, and TPA (4.0 ± 0.4-, 6.7 ± 1.3-, and 2.3 ± 0.3-fold), respectively, was no greater than the stimulation obtained in parallel cultures transfected with pHbeta1–1141Luc, relative to the pHbeta1–1141Luc control (6.1 ± 0.5-, 8.8 ± 0.4-, and 2.5 ± 0.2-fold for PGE1, 8-BrcAMP, and TPA, respectively).

Binding of Nuclear CREB and Sp1 to PGRE1 and PGRE3 In Vitro

EMSA studies. Previously, we conducted a number of studies including EMSAs, which indicated that both CREB and Sp1 bind to the region of the beta1 promoter region containing PGRE3 (25). EMSAs were similarly conducted to determine whether CREB and Sp1 also bind to the beta1 promoter regions containing either PGRE1 or PGRE2. Synthetic 32P-labeled oligonucleotide probes utilized in these studies include 1) 32P-CTCTCGGGCC GAGTCCCTGC CCCTGGCGCC G (–81 to –111), 2) 32P-GCTGCCTGCG CGTCCCTCAC CGC (–235 to –213), and 3) 32P-GCGTCCCGGA GTGACCTTCC CCCAC (–456 to –432), which are homologous to regions on the beta1 promoter containing PGRE3, PGRE2, and PGRE1, respectively. Following binding reactions with nuclear extracts and these labeled probes, the products were separated by PAGE and subjected to autoradiography (Fig. 2). The autoradiograms showed multiple 32P-labeled bands in each gel, each band presumably representing a unique nuclear protein-DNA complex.


Figure 2
View larger version (70K):
[in this window]
[in a new window]
 
Fig. 2. EMSAs with PGRE1, PGRE2, and PGRE3 oligos. A: EMSAs were conducted with 32P-labeled PGRE oligonucleotide probes complementary to either PGRE1, PGRE2, or PGRE3 (as indicated in MATERIALS AND METHODS) in both the presence and absence of a 200-fold excess of unlabeled CRE oligo. The band reduction obtained by the addition of a 200-fold excess of unlabeled consensus CRE was in the case of PGRE1 (81%, band A and 66%, band B). In the case of labeled PGRE2, 200-fold excess of the CRE oligo caused the band intensity to be reduced by 49 (band A'), 36 (band B'), and 48% (band C'). Finally, in the case of labeled PGRE3, following the addition of excess unlabeled CRE oligo, the band intensity was reduced by 92 (band A'') and 55% (band B''). B: EMSAs were conducted with 32P-labeled PGRE oligonucleotide probes complementary to either PGRE1, PGRE2, or PGRE3 in both the presence and absence of a 200-fold excess of unlabeled Sp1 oligo. A reduction in the intensity of bands A, B, and C were observed with the addition of a 200-fold excess of Sp1 to the nuclear extract incubated with labeled PGRE1 (reduction by 96%, band A; 98%, band B; and 44%, band C), labeled PGRE3 (reduction by 28%, band A''; 25%, band B''; and 11%, band C''), and labeled PGRE2 (reduction by 15%, band A'; 13%, band B'; and 16%, band C'). C: supershifts were obtained by adding a rabbit polyclonal antibody against CREB to the binding reaction 20 min after the addition of 32P-labeled PGRE1 or PGRE2. D: supershifts were obtained by adding a rabbit polyclonal antibody against Sp1 to the binding reaction 20 min after the addition of 32P-labeled consensus CRE, mutant CRE, or consensus Sp1 oligo. Each experiment is representative of at least 3 determinations.

 
In previous EMSAs, we showed that an unlabeled consensus CRE oligo was able to compete against a 32P-labeled oligo containing PGRE3 for binding to nuclear proteins in MDCK cells. These results suggested that nuclear proteins such as CREB bind to this PGRE (25). A similar competition study was conducted to determine whether PGRE1 and PGRE2 could function in a similar manner. The effect of a 200-fold excess of unlabeled consensus CRE oligo (AGAGATTGCCTGACGTCAGAGAGCTAG) on the binding of 32P-labeled oligos (containing either PGRE1, PGRE2, or PGRE3) to nuclear proteins was examined (Fig. 2A).

The results of the competition study with excess unlabeled CRE oligo indicated that the intensity of a number of the 32P-labeled bands was reduced, primarily when 32P-labeled oligos containing either PGRE1 or PGRE3 were utilized. For example, when an excess of unlabeled CRE oligo was used, an 81% reduction in the intensity of band A was obtained with 32P-labeled 32P-GCGTCCCGGA GTGACCTTCC CCCAC (containing PGRE1), and a 92% reduction in the intensity of band A'' was obtained with 32P-labeled CTCTCGGGCC GAGTCCCTGC CCCTGGCGCC G (containing PGRE3). However, the ability of the unlabeled CRE oligo to compete with 32P-labeled GCTGCCTGCG CGTCCCTCAC CGC (containing PGRE2) was considerably lower (exemplified by a 49% reduction in the intensity of band A'). Similar results were obtained when the ability of an unlabeled consensus Sp1 oligonucleotide to compete with labeled oligos containing either PGRE1, PGRE2, or PGRE3 was examined, as shown in Fig. 2B.

Our previous EMSA results with a 32P-labeled PGRE3 oligo indicated that both an anti-CREB and anti-Sp1 antibody caused supershifts (25). Similar studies were conducted to determine whether an anti-CREB or anti-Sp1 antibody could supershift 32P-DNA-nuclear protein complexes that formed when either 32P-GCGTCCCGGA GTGACCTTCC CCCAC (containing PGRE1) or 32P-GCTGCCTGCG CGTCCCTCAC CGC (containing PGRE2) was used.

Figure 2C shows the supershifted bands that formed when EMSAs were conducted with an anti-CREB antibody and 32P-labeled GCGTCCCGGA GTGACCTTCC CCCAC (containing PGRE1) and 32P-GCTGCCTGCG CGTCCCTCAC CGC (containing PGRE2). However, a supershift with an anti-Sp1 antibody was only obtained when 32P-labeled GCGTCCCGGA GTGACCTTCC CCCAC (containing PGRE1), rather than 32P-GCTGCCTGCG CGTCCCTCAC CGC (containing PGRE2), was used. The specificity of the antibody reactions was indicated in control EMSAs conducted with either an anti-CREB or anti-Sp1 antibody as well as either 1) a labeled consensus CRE oligo (AGAGATTGCC TGACGTCAGA GAGCTAG), 2) a labeled mutant CRE oligo (AGAGATTGCC TGTGGTCAGA GAGCTAG), or 3) a labeled consensus Sp1 oligo (ATTCGATCGG GGCGGGGCGA GC) (Fig. 2D).

DNA affinity precipitation studies. To further investigate the ability of PGREs to bind transcription factors, DNA affinity precipitation assays were conducted. A biotinylated oligo, 5'-CTCTCGGGCC GAGTCCCTGC CCCTGG-3' (–86 to –111), which contained PGRE3, was incubated with an MDCK nuclear extract, followed by streptavidin-agarose precipitation, electrophoresis, and transfer of the nuclear proteins to nitrocellulose. The results of Western blot analysis (Fig. 3A) indicate that CREB, Sp1, Sp3, and TBP (a component of TFIID) all coprecipitate with biotinylated CTCTCGGGCC GAGTCCCTGC CCCTGG, which contained PGRE3.


Figure 3
View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. DNA affinity precipitation of nuclear proteins. A: nuclear extracts from MDCK cells were incubated with a biotinylated PGRE3 oligonucleotide. Nuclear protein/oligo complexes were purified with streptavidin-agarose beads, separated on SDS/PAGE, and subjected to a Western blot analysis using either anti-CREB, anti-Sp1, anti-Sp3, or anti-TFIID polyclonal antibodies. *, Specific band of interest; –, No Oligo; +, PGRE3. B: nuclear extracts from MDCK cells were incubated with biotinylated PGRE1, PGRE2, or PGRE3 oligonucleotide (as indicated in MATERIALS AND METHODS). Nuclear protein/oligo complexes were purified with streptavidin-agarose beads, separated by SDS/PAGE, and subjected to Western blot analysis using either anti-CREB or anti-Sp1 polyclonal antibodies. –, Specific band of interest. Experiments are representative of at least 3 determinations.

 
The ability of PGRE1 (TGACCTTC), PGRE2 (GTCCCTCA), and PGRE3 (AGTCCCTGC) to bind CREB and Sp1 was similarly assessed. The results of Western blot analysis (Fig. 3B) indicate that a 10-fold higher level of CREB binding was obtained with biotinylated 5'-CTCTCGGGCC GAGTCCCTGC CCCTGG-3' (–86 to –111) containing PGRE3 than with biotinylated 5'-GCTGCCTGCG CGTCCCTCAC CGC-3' (–213 to –235) containing PGRE2. A threefold higher level of CREB binding was obtained with biotinylated 5'-GTCCCGGAGT GACCTTCCCC CAC-3' (–432 to –454) containing PGRE1 than the CREB binding obtained with biotinylated 5'-GCTGCCTGCG CGTCCCTCAC CGC-3' (–213 to –235) containing PGRE2.

Similarly, 3.8-fold more Sp1 binding was obtained with biotinylated 5'-CTCTCGGGCC GAGTCCCTGC CCCTGG-3' (–86 to –111) containing PGRE3 than with biotinylated 5'-GCTGCCTGCG CGTCCCTCAC CGC-3' (–213 to –235) containing PGRE2. Sp1 binding to biotinylated 5'-GTCCCGGAGT GACCTTCCCC CAC-3' (–432 to –454) containing PGRE1 was only 1.4-fold higher than the binding obtained with biotinylated 5'-GCTGCCTGCG CGTCCCTCAC CGC-3' (–213 to –235) containing PGRE2. These results are consistent with the EMSA results and the hypothesis that a nuclear protein complex containing CREB and Sp1 associates with PGRE1 and PGRE3 on the Na-K-ATPase beta1-subunit promoter.

Functional Role of CREB and Sp1 in Regulation by PGRE1 and PGRE3

Because the results of our EMSAs and DNA precipitation assays suggested that CREB and Sp1 bind PGRE1 and PGRE3, the functional significance of these observations was evaluated. Initially, the effect of a dominant negative CREB (KCREB) on the PGE1 stimulation was examined. MDCK cells were transiently transfected with either pLuc-MCS beta421–456 (which contains PGRE1) or pLuc-MCS beta82–115 (that contains PGRE3), and KCREB, followed by a 36-h incubation to allow for KCREB expression. Figure 4A shows that when MDCK cells were cotransfected with KCREB and pLuc-MCS beta421–456, or with KCREB and pLuc-MCS 82–115, the PGE1 stimulation was substantially reduced compared with untreated controls. In the case of pLuc-MCS beta421–456, the PGE1 stimulation was 3.8 ± 0.2-fold (following the extended incubation). In the presence of KCREB, luciferase gene expression was below basal levels observed with the empty vector, although a modest PGE1 stimulation was still observed relative to the KCREB control (to 1.6 ± 0.1-fold). Similar observations were made in the case of pLuc-MCS beta82–115. In the absence of KCREB, a 5.1 ± 0.7-fold PGE1 stimulation was observed. In the presence of KCREB, the PGE1 stimulation was only observed relative to the PGE1 controls transfected with KCREB (1.4 ± 0.3). These observations are consistent with the involvement of CREB in mediating the PGE1 stimulation through PGRE1- and PGRE3-regulatory elements.


Figure 4
View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4. Role of CREB in regulation. A: role of CREB. MDCK cells were transiently transfected either with pLuc MCS beta421–456 and either Rc/RSV (empty vector; EV) or Rc/RSV-KCREB (KCREB) or pLuc-MCS beta85–117 and either EV or KCREB. Subsequently, cultures were incubated 4 h in either the presence or the absence of 1.4 µM PGE1. Luciferase activity was compared with the activity in the control condition (–PGE1) with pLuc MCS beta421–456 and Rc/RSV-EV. B: role of T3. MDCK cells were transiently transfected with either pLuc MCS beta421–456 or pLuc MCS beta85–117 and maintained in DME/F-12 with either 5 µg/ml insulin and 5 µg/ml transferrin, or with 5 µg/ml insulin, 5 µg/ml transferrin, and 50 nM T3. The effect of a 4-h incubation with 1.4 µM PGE1 was examined in both the presence and absence of T3. Luciferase activity was compared with the control condition (–PGE1, –T3). Results are representative of at least 3 independent experiments.

 
The PGRE1 site (–438 to –445) overlaps a half-site of the thyroid hormone regulatory element (TRE), located between –438 and –459 on the beta1-subunit promoter (14). Previously, the T3-thyroid hormone receptor (TR) complex was observed to antagonize the effect of CREB on transcription of the human prepro TRH gene, which has a promoter with a similar overlap of TRE/CRE bases (31). For this reason, the effect of T3 on the PGE1 stimulation by pLuc-MCS beta421–456 was examined. As shown in Fig. 4B, incubation with T3 reduced this PGE1 stimulation by 66 ± 11%. However, T3 similarly reduced the PGE1 stimulation observed with pLuc-MCS beta85–117 by 60 ± 1%. Thus the inhibitory effect of T3 on the PGE1 stimulation could not necessarily be attributed to the binding of T3 to a TRE on the DNA.

Dependence of Transcription on Sp1

To determine whether Sp1 is involved in regulating transcription through either PGRE1 or PGRE3, transient transfection studies were conducted with Drosophila SL2 cells (which are generally deficient in Sp proteins, including Sp1) (9). The expression vectors pLuc-MCS beta421–456 (which contains PGRE1) and pLuc-MCS beta85–117 (which contains PGRE3) were employed, as well as the Sp1 expression vector pPacSp1. Figure 5 shows that when SL2 cells were cotransfected with pLuc-MCS beta421–456 and pPacSp1, luciferase gene expression increased 10 ± 1-fold relative to expression levels obtained with control cells cotransfected with the empty vector pPacO. Although this effect was significant, the effect of cotransfecting with pPacSp1 and pLuc-MCS beta85–117 resulted in stimulation of a much greater magnitude (708 ± 103-fold vs. the pPacO control).


Figure 5
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. Role of Sp1. SL2 cells were transiently transfected with either pLuc-MCS PGRE1 and pPacO, pLuc-MCS PGRE1 and pPacSp1, pLuc-MCS PGRE3 and pPacO, or pLuc-MCS PGRE3 and pPacSp1. The next day, the luciferase activity of the cultures was determined. The luciferase activity in experimental conditions was compared with the luciferase activity obtained with the control (either with pLuc-MCS PGRE1 and pPacO or pLuc-MCS PGRE3 and pPacO). Values are means ± SE of quadruplicate determinations.

 
The stimulatory effect of Sp1 on pLuc-MCS beta421–456 and pLuc-MCS beta85–117 gene expression in SL2 cells is presumably due to Sp1 binding to the GC boxes adjacent to the PGREs on these promoters. However, Sp1 binding to these GC boxes may also be required for PGRE function, which also affects transcription. These possibilities were further evaluated by means of transient transfection studies in SL2 cells with pLuc-MCS beta72–167, containing the sequence illustrated in Fig. 6A, which includes PGRE3. In addition, Fig. 6A shows the sequences inserted into the other pLuc-MCS vectors utilized here, including –167 to –72 mut PGRE3 (contained within pLuc-MCS beta72–167 mut PGRE3 and with mutations in PGRE3), and –167 to –72 mut GC box 1 (contained within pLuc-MCS beta72–167 mut GC Bx1 and with mutations in GC box adjacent to PGRE3).


Figure 6
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6. Effects of mutations in PGRE3 in SL2 cells. A: sequence of wild-type human Na+-K+-ATPase beta1-subunit promoter from –167 to –72 (denoted PGRE3 WT) of the sequence from –176 to –72 with a mutation in PGRE3 (denoted mut PGRE3), the sequence from –167 to –72 with a mutation in GC box 1 (denoted PGRE GC mutant), and the sequence from –176 to –72 with the translocation of 2 GC boxes (denoted 2xGC trans mutant). B: SL2 cells were transiently transfected with either pLuc-MCS containing –167 to –72 in the beta1-subunit promoter (pLuc-MCS PGRE3), pLuc-MCS –167 to –72 with a mutation in GC box 1 (pLuc-MCS PGRE3 GC mutant), or pLuc-MCS –176 to –72 with a PGRE3 mutation (pLuc-MCS PGRE3 mutant). The next day, the luciferase activity of the cultures was determined and compared with the luciferase activity obtained with pLuc-MCS –167 to –72 and pPacO. Values are averages ± SE of quadruplicate determinations.

 
Figure 6B shows that when SL2 cells were cotransfected with pLuc-MCS beta72–167 and pPacSp1, a 1,326 ± 192-fold increase in gene expression was obtained compared with control SL2 cells cotransfected with pLuc MCS beta72–167 and the empty vector pPacO. However, Fig. 6B also shows that the level of gene expression obtained with pLuc-MCS beta72–167 with a GC box mutation was only 6% of the level obtained with cotransfection with wild-type pLuc-MCS beta72–167 and pPacSp1 (an 84 ± 13-fold stimulation was obtained).

Possibly, the stimulatory effect of pPacSp1 is simply due to Sp1 binding to the Sp1 site located at –111 to –117, independent of any interaction with the PGRE. However, Fig. 6B shows that in SL2 cells cotransfected with pPacSp1 and pLuc-MCS beta72–167 mut PGRE3 (a vector with mutations in the PGRE3 site), the level of luciferase gene expression was substantially reduced compared with the wild-type phenotype. Although cotransfection of pLuc-MCS beta72–167 mut PGRE3 with pPacSp1 still caused a 166 ± 27-fold increase relative to the pLuc-MCS beta72–167 mut PGRE3 control (cotransfected with pPacO), this level of stimulation was only 13 ± 2% of the stimulation obtained with the normal genotype, pLuc-MCS beta72–167, in the presence of pPacSp1.

Effects of Mutations in Sp1 and PGRE3 on the PGE1 Response

To study the role of PGRE3 and Sp1 in mediating the prostaglandin response, transient transfection studies were conducted with normal and mutant pLuc-MCS beta72–167 vectors in MDCK cells. Figure 7A shows that both the PGRE3 mutation and the mutation in the adjacent GC box resulted in a complete loss of PGE1 stimulation. Figure 7A also shows that the same result was obtained when the two GC boxes immediately upstream of PGRE3 were translocated farther upstream (the translocation as illustrated in Fig. 6A). These results support the hypothesis that both PGRE3 and the adjacent GC boxes (located at –117 to –112 and at –143 to –139, respectively) are required for a prostaglandin response.


Figure 7
View larger version (24K):
[in this window]
[in a new window]
 
Fig. 7. Effects of mutations in PGRE3 in MDCK cells. A: MDCK cells were transiently transfected either with the vector pLuc-MCS, which contains a minimal promoter with a TATA box, pLuc-MCS containing –167 to –72 in the beta1-subunit promoter (pLuc-MCS PGRE3), pLuc-MCS –167 to –72 with the 2X GC trans mutation (pLuc-MCS2xGCTrans), with pLuc-MCS –167 to –72 with a mutation in GC Box 1 (pLuc-MCSPGRE3GCmutant), or with pLuc-MCS –176 to –72 with a PGRE3 mutation (pLuc-MCSPGRE3mutant). B: transient transfection studies were conducted in MDCK cells with pLuc-MCS, pLuc-MCS CRE, and pLuc-MCS PGRE3. Transfected MDCK cells were treated for 4 h with either 1.4 µM PGE1 or were untreated. Values for all the experiments are the mean luciferase activity (light units) ± SE of experiments performed in quadruplicate and normalized with respect to beta-galactosidase activity. At least 3 experiments were performed. *P < 0.001,·P > 0.5 relative to pLuc-MCS control.

 
To study the effectiveness of PGRE3 relative to a consensus CRE, a study was conducted comparing the PGE1 response obtained with pLuc-MCS beta72–167 and pCRE-Luc, a pLuc-MCS vector containing a minimal promoter with four consensus CRE sites (in tandem) immediately upstream from a TATA box. Figure 7B shows that equivalent PGE1 stimulation was obtained with pLuc-MCS beta72–167 and pLuc-MCS CRE (31 ± 4- and 39 ± 9-fold, respectively).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The {alpha}- and beta-subunits of the Na-K-ATPase are subject to differential regulation by a number of hormones and effector molecules (16, 24). The differential regulation of the {alpha}- and beta-subunits can be explained, at least in part, by their discoordinate regulation at the transcriptional level. External factors that primarily affect Na-K-ATPase beta-subunit gene expression have received particular attention in those cases where the level of newly synthesized beta-subunits are limiting to the formation of {alpha}/beta heterodimers (15, 40). For example, in LLC-PK1 cells incubation in medium with low-K+ concentrations resulted in a selective increase in beta-subunit mRNA levels, without a significant effect on {alpha}-subunit mRNA levels (22). Thus the consequent increase in Na-K-ATPase levels was attributed to the selective increase in beta-subunits. However, the Na-K-ATPase beta-subunit is not necessarily rate limiting for {alpha}/beta assembly.

Indeed, changes in the external milieu result often result in changes in both {alpha}- and beta-subunit mRNA levels. In MDCK cells, low external K+ caused a 1.9-fold increase in {alpha}-subunit mRNA levels in addition to a 2.3-fold increase in beta-subunit mRNA levels (2). Similarly, hyperoxia caused a 3.4-fold increase in beta-subunit mRNA levels and a 1.4-fold increase in {alpha}-subunit levels in MDCK cells (43). Although veratridine caused a 1.6-fold increase in {alpha}-subunit mRNA levels in primary rat myoblasts, in addition to a 2.6-fold increase in beta-subunit mRNA (36), the investigators nonetheless propose that the increase in beta-subunit mRNA was responsible for the consequent increase in {alpha}/beta heterodimer formation.

Nevertheless, different sets of stimuli can modulate {alpha}- and beta-subunit levels in very different manners, even in a manner such that an increase in the {alpha}-subunit is the predominant change. Thus a detailed examination of both {alpha}- and beta-subunit gene regulation may ultimately be required both in vitro and in vivo to obtain a full understanding of the phenomenon. Previously, we observed that PGE1 and 8-BrcAMP increase Na-K-ATPase beta1-subunit mRNA levels to a greater extent than beta1 mRNA levels (37). These changes were associated with an increase in Na-K-ATPase activity (37, 40). For this reason, we initiated our investigations with an analysis of Na-K-ATPase beta1-subunit gene expression in MDCK cells.

Previously, we presented evidence indicating that PGE1 stimulates transcription of the human beta1-subunit gene and that regulation could be attributed, at least in part, to a PGRE, AGTCCCTGC (located at –92 to –100) (25, 37). In this study, we have presented evidence indicating that additional PGREs are involved in mediating the regulation of the Na-K-ATPase beta1-subunit gene by prostaglandins, including PGRE1 (TGACCTTC; located at –445 to –438); PGRE2 (GTCCCTCA; located at –226 to –216); as well as the previously identified PGRE (AGTCCCTGC; located at –92 to –100, referred to in this report as PGRE3). Although the PGE1 stimulation was also obtained with pLuc-MCS beta211–240 (containing PGRE2), we have examined the regulation through the PGRE1 element in greater detail than PGRE2.

Our experimental results indicate that the PGE1 response occurring through both PGRE1 and PGRE3 is dependent on CREB. Exposure to agonists that activate adenylate cyclase stimulates CREB phosphorylation (48). CREB phosphorylation may also occur in response to agonists that act through Ca2+ and/or PKC. A consequence of CREB phosphorylation at Ser 133 is the recruitment of CBP to the promoter region, and the binding of CBP to CREB (33). However, CREB phosphorylation is not a necessary indicator of target gene activation (48). In a number of promoter systems, CREB binding to a single CRE site is not sufficient to mediate a significant functional response to cAMP (34). In these cases, a strong regulatory effect of CREB is observed only if multiple CREB binding sites were present (35), or if additional regulatory elements are present. Included among such regulatory elements are the hepatic nuclear factor 4 binding site in the tyrosine aminotransferase promoter (32) and C/EBP in the phosphenolpyruvate carboxykinase promoter (34). Thus a number of investigators have concluded that CREB requires additional regulatory partners, including Sp1, to recruit the transcriptional apparatus to the promoter region of CREB-activated genes (48).

Our results also indicate that Sp1 is involved in mediating the effects of PGE1 on Na-K-ATPase beta1-subunit gene transcription. Previously, Sp1 was reported to play a critical role in the upregulation of the Na-K-ATPase beta1-subunit gene. However, in this case the Sp1 binding site was different (located at –59 on the rat promoter) and was sufficient for the increased transcription (which occurred in response to hyperoxia) (42). An Sp1-Sp3 interaction was proposed to occur in this case, rather than an Sp1-CREB interaction. In contrast, synergism between an ATF/CRE site and an adjacent downstream GC box was proposed to be required for basal transcription of the rat Na-K-ATPase {alpha}1-subunit gene (21). Regulatory interactions between transcription factors observed under basal conditions may be altered during the upregulation of transcription. For example, basal transcription of the folate receptor type beta gene depends on a synergistic interaction between Sp1 and ets, as well as repression by upstream AP-1 like elements (17). Upregulation [which occurs in response to all trans-retinoic acid (RA)] involves the binding of RA receptor {alpha} (RAR{alpha}) to the Sp1 site and reduced association of RARbeta and -{gamma} to the AP-1 site. Similarly, under basal conditions the transcription of the plasminogen activator inhibitor-1 gene is minimal in vascular smooth muscle cells, due to a binding complex between a transcriptional repressor and Sp1 (which involves 2 Sp1 sites) (7). Upregulation of the plasminogen activator inhibitor-1 gene by glucose in vascular smooth muscle cells involves the release of the transcriptional repressor from this complex.

Our DNA affinity precipitation studies indicate that Sp3, like Sp1, binds to PGRE3 in the human Na-K-ATPase beta1 promoter. Sp3 may act as either a transcriptional repressor or a transcriptional activator. While Sp3 represses Sp1 transcriptional activation of the human thrombin receptor (46), Sp3 has been observed to upregulate Sp1 transcriptional activation of the hepatic growth factor promoter (47). Further investigations are needed to evaluate whether Sp3 acts as either an activator or a repressor in mediating regulation through PGREs.

The TR was previously reported as being a CREB binding partner and regulating transcription of the Na-K-ATPase beta1 promoter (14). In GH4C1 rat pituitary cells, the TR was observed to antagonize CREB-mediated transcription of the pituitary-specific transcription factor GHF-1/Pit-1 (28). CREB binds to two CRES in the GHF-1/Pit-1 promoter. Following treatment with a cAMP agonist, CREB is phosphorylated by cAMP-dependent protein kinase, while binding to two CRE sites. Although the TR does not bind to the GHF-1/Pit-1 promoter, an interaction of the TR with CREB prevents CREB phosphorylation and gene activation. Similarly, in the human prepro TRH promoter, the TR can bind to four different TREs, including two TREs with overlapping TRE/CRE bases (44). In this case, the TR-T3 complex was similarly inhibitory to cAMP-mediated regulation, while unliganded TR was stimulatory. In this report, T3 antagonized the PGE1 stimulation observed with pLuc MCS beta421–526 (which contains PGRE1). PGRE1 (–438 to –445) is overlapping with the TRE in this region. However, T3 also antagonized the PGE1 stimulation obtained with pLuc MCS beta85–117 (which contains PGRE3), suggesting that the inhibitory effect of T3 is not necessarily the result of a TR-T3 complex binding to a TRE.

Here, we have observed that the PGE1 stimulation obtained with pLuc-MCS beta72–167 (that contains PGRE3) and pLuc-MCS beta421–526 (that contains PGRE3) is of a much greater magnitude than that with pHbeta1–1141Luc. Possibly, additional (but as of yet undefined) regulatory elements are present on the entire Na-K-ATPase beta1-subunit promoter that modulate the amplitude of the PGE1 response. Other regulatory elements on the beta1 promoter, which may play a role in mediating prostaglandin's effects, include a CAAT box, several Sp1 sites, a CREB binding site, and a TATA box, which are clustered close to the initiation site for transcription in the Na-K-ATPase beta1-subunit promoter, in addition to other elements more distal from the transcription initiation start site. Thus the ability of either PGRE1 and/or PGRE3 to mediate a prostaglandin response is dependent on the complexities of the local hormonal milieu (as exemplified by the case of thyroid hormone and PGRE1). Future studies will be concerned with delineating the nature of these complex hormonal interactions.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was support by National Heart, Lung, and Blood Institute Grant 1RO1-HL-69676–01 to M. Taub.


    ACKNOWLEDGMENTS
 
We thank Dr. Jerry Lingrel for pHbeta1–1141 Luc, Dr. Richard Goodman for Rc/RSV-KCREB and Rc/RSV, as well as Dr. Robert Tjian for pPacO, pPacSp1, and pPacbetagal.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. Taub, Biochemistry Dept., School of Medicine and Biomedical Sciences, State Univ. of New York at Buffalo, 3435 Main St., Buffalo, NY 14214 (e-mail: biochtau{at}buffalo.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Andrews NC and Faller DV. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells (Abstract). Nucleic Acids Res 19: 2499, 1991.[Free Full Text]
  2. Bowen JW. Regulation of Na+-K+-ATPase expression in cultured renal cells by incubation in hypertonic medium. Am J Physiol Cell Physiol 262: C845–C853, 1992.[Abstract/Free Full Text]
  3. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254, 1976.[CrossRef][Web of Science][Medline]
  4. Carter EP, Wangensteen OD, O'Grady SM, and Ingbar DH. Effects of hyperoxia on type II cell Na-K-ATPase function and expression. Am J Physiol Lung Cell Mol Physiol 272: L542–L551, 1997.[Abstract/Free Full Text]
  5. Chaudhury S, Ismail-Beigi F, Gick GG, Levenson R, and Edelman IS. Effect of thyroid hormone on the abundance of Na,K-adenosine triphosphatase alpha-subunit messenger ribonucleic acid. Mol Endocrinol 1: 83–89, 1987.[Abstract/Free Full Text]
  6. Chen CR, Kang Y, and Massague J. Defective repression of c-myc in breast cancer cells: a loss at the core of the transforming growth factor beta growth arrest program. Proc Natl Acad Sci USA 98: 992–999, 2001.[Abstract/Free Full Text]
  7. Chen YQ, Su M, Walia RR, Hao Q, Covington JW, and Vaughan DE. Sp1 sites mediate activation of the plasminogen activator inhibitor-1 promoter by glucose in vascular smooth muscle cells. J Biol Chem 273: 8225–8231, 1998.[Abstract/Free Full Text]
  8. Coleman RA, Smith WL, and Narumiya S. International Union of Pharmacology classification of prostanoid receptors: properties, distribution, and structure of the receptors and their subtypes. Pharmacol Rev 46: 205–229, 1994.[Web of Science][Medline]
  9. Courey AJ and Tjian R. Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55: 887–898, 1988.[CrossRef][Web of Science][Medline]
  10. Derfoul A, Robertson NM, Lingrel JB, Hall DJ, and Litwack G. Regulation of the human Na/K-ATPase beta1 gene promoter by mineralocorticoid and glucocorticoid receptors. J Biol Chem 273: 20702–20711, 1998.[Abstract/Free Full Text]
  11. Dignam JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475–1489, 1983.[Abstract/Free Full Text]
  12. Dunbar LA and Caplan MJ. Ion pumps in polarized cells: sorting and regulation of the Na+, K+- and H+, K+-ATPases. J Biol Chem 276: 29617–29620, 2001.[Abstract/Free Full Text]
  13. Dunbar LA and Caplan MJ. The cell biology of ion pumps: sorting and regulation. Eur J Cell Biol 79: 557–563, 2000.[CrossRef][Web of Science][Medline]
  14. Feng J, Orlowski J, and Lingrel JB. Identification of a functional thyroid hormone response element in the upstream flanking region of the human Na,K-ATPase beta1 gene. Nucleic Acids Res 21: 2619–2626, 1993.[Abstract/Free Full Text]
  15. Geering K. The functional role of the beta-subunit in the maturation and intracellular transport of Na,K-ATPase. FEBS Lett 285: 189–193, 1991.[CrossRef][Web of Science][Medline]
  16. Gick GG, Ismail-Beigi F, and Edelman IS. Hormonal regulation of Na,K-ATPase. Prog Clin Biol Res 268: 277–295, 1988.
  17. Hao H, Qi H, and Ratnam M. Modulation of the folate receptor type beta gene by coordinate actions of retinoic acid receptors at activator Sp1/ets and repressor AP-1 sites. Blood 101: 4551–4560, 2003.[Abstract/Free Full Text]
  18. Horisberger JD. Recent insights into the structure and mechanism of the sodium pump. Physiology (Bethesda) 19: 377–387, 2004.[CrossRef][Medline]
  19. Kaplan JH. Biochemistry of Na,K-ATPase. Annu Rev Biochem 71: 511–535, 2002.[CrossRef][Web of Science][Medline]
  20. Kèomhoff M, Grone HJ, Klein T, Seyberth HW, and Nèusing RM. Localization of cyclooxygenase-1 and -2 in adult and fetal human kidney: implication for renal function. Am J Physiol Renal Physiol 272: F460–F468, 1997.[Abstract/Free Full Text]
  21. Kobayashi M and Kawakami K. Synergism of the ATF/CRE site and GC box in the housekeeping Na,K-ATPase {alpha}1 subunit gene is essential for constitutive expression. Biochem Biophys Res Commun 241: 169–174, 1997.[CrossRef][Web of Science][Medline]
  22. Lescale-Matys L, Hensley CB, Crnkovic-Markovic R, Putnam DS, and McDonough AA. Low K+ increases Na,K-ATPase abundance in LLC-PK1/Cl4 cells by differentially increasing beta, and not {alpha}, subunit mRNA. J Biol Chem 265: 17935–17940, 1990.[Abstract/Free Full Text]
  23. Lingrel JB and Kuntzweiler T. Na-ATPase. J Biol Chem 269: 19659–19662, 1994.[Free Full Text]
  24. Lingrel JB, Orlowski J, Shull MM, and Price EM. Molecular genetics of Na,K-ATPase. Prog Nucleic Acid Res Mol Biol 38: 37–89, 1990.[Web of Science][Medline]
  25. Matlhagela K, Borsick M, Rajkhowa T, and Taub M. Identification of a prostaglandin-responsive element in the Na,K-ATPase beta1 promoter that is regulated by cAMP and Ca2+: evidence for an interactive role of cAMP regulatory element-binding protein and Sp1. J Biol Chem 280: 334–346, 2005.[Abstract/Free Full Text]
  26. Mays RW, Siemers KA, Fritz BA, Lowe AW, van Meer G, and Nelson WJ. Hierarchy of mechanisms involved in generating Na/K-ATPase polarity in MDCK epithelial cells. J Cell Biol 130: 1105–1115, 1995.[Abstract/Free Full Text]
  27. Mendez-Pertuz M, Sanchez-Pacheco A, and Aranda A. The thyroid hormone receptor antagonizes CREB-mediated transcription. EMBO J 22: 3102–3112, 2003.[CrossRef][Web of Science][Medline]
  28. Morel F. Sites of hormone action in the mammalian nephron. Am J Physiol Renal Fluid Electrolyte Physiol 240: F159–F164, 1981.[Abstract/Free Full Text]
  29. Nielsen M, Kaltoft K, Nordahl M, Ropke C, Geisler C, Mustelin T, Dobson P, Svejgaard A, and Odum N. Constitutive activation of a slowly migrating isoform of Stat3 in mycosis fungoides: tyrphostin AG490 inhibits Stat3 activation and growth of mycosis fungoides tumor cell lines. Proc Natl Acad Sci USA 94: 6764–6769, 1997.[Abstract/Free Full Text]
  30. Nillni EA and Sevarino KA. The biology of pro-thyrotropin-releasing hormone-derived peptides. Endocr Rev 20: 599–648, 1999.[Abstract/Free Full Text]
  31. Nitsch D, Boshart M, and Schutz G. Activation of the tyrosine aminotransferase gene is dependent on synergy between liver-specific and hormone-responsive elements. Proc Natl Acad Sci USA 90: 5479–5483, 1993.[Abstract/Free Full Text]
  32. Parker D, Ferreri K, Nakajima T, LaMorte VJ, Evans R, Koerber SC, Hoeger C, and Montminy MR. Phosphorylation of CREB at Ser-133 induces complex formation with CREB-binding protein via a direct mechanism. Mol Cell Biol 16: 694–703, 1996.[Abstract]
  33. Roesler WJ, Graham JG, Kolen R, Klemm DJ, and McFie PJ. The cAMP response element binding protein synergizes with other transcription factors to mediate cAMP responsiveness. J Biol Chem 270: 8225–8232, 1995.[Abstract/Free Full Text]
  34. Silver BJ, Bokar JA, Virgin JB, Vallen EA, Milsted A, and Nilson JH. Cyclic AMP regulation of the human glycoprotein hormone alpha-subunit gene is mediated by an 18-base-pair element. Proc Natl Acad Sci USA 84: 2198–2202, 1987.[Abstract/Free Full Text]
  35. Taormino JP and Fambrough DM. Pre-translational regulation of the (Na+ + K+)-ATPase in response to demand for ion transport in cultured chicken skeletal muscle. J Biol Chem 265: 4116–4123, 1990.[Abstract/Free Full Text]
  36. Taub M, Borsick M, Geisel J, Matlhagela K, Rajkhowa T, and Allen C. Regulation of the Na,K-ATPase in MDCK cells by prostaglandin E1: a role for calcium as well as cAMP. Exp Cell Res 299: 1–14, 2004.[CrossRef][Web of Science][Medline]
  37. Taub M, Chuman L, Saier MH Jr, and Sato G. Growth of Madin-Darby canine kidney epithelial cell (MDCK) line in hormone-supplemented, serum-free medium. Proc Natl Acad Sci USA 76: 3338–3342, 1979.[Abstract/Free Full Text]
  38. Taub ML, Wang Y, Yang IS, Fiorella P, and Lee SM. Regulation of the Na,K-ATPase activity of Madin-Darby canine kidney cells in defined medium by prostaglandin E1 and 8-bromocyclic AMP. J Cell Physiol 151: 337–346, 1992.[CrossRef][Web of Science][Medline]
  39. Walton KM, Rehfuss RP, Chrivia JC, Lochner JE, and Goodman RH. A dominant repressor of cyclic adenosine 3',5'-monophosphate (cAMP)-regulated enhancer-binding protein activity inhibits the cAMP-mediated induction of the somatostatin promoter in vivo. Mol Endocrinol 6: 647–655, 1992.[Abstract/Free Full Text]
  40. Wendt CH, Gick G, Sharma R, Zhuang Y, Deng W, and Ingbar DH. Up-regulation of Na,K-ATPase beta1 transcription by hyperoxia is mediated by SP1/SP3 binding. J Biol Chem 275: 41396–41404, 2000.[Abstract/Free Full Text]
  41. Wendt CH, Towle H, Sharma R, Duvick S, Kawakami K, Gick G, and Ingbar DH. Regulation of Na-K-ATPase gene expression by hyperoxia in MDCK cells. Am J Physiol Cell Physiol 274: C356–C364, 1998.[Abstract/Free Full Text]
  42. Wilber JF and Xu AH. The thyrotropin-releasing hormone gene 1998: cloning, characterization, and transcriptional regulation in the central nervous system, heart, and testis. Thyroid 8: 897–901, 1998.[Web of Science][Medline]
  43. Worrell RT, Bao HF, Denson DD, and Eaton DC. Contrasting effects of cPLA2 on epithelial Na+ transport. Am J Physiol Cell Physiol 281: C147–C156, 2001.[Abstract/Free Full Text]
  44. Wu Y, Ruef J, Rao GN, Patterson C, and Runge MS. Differential transcriptional regulation of the human thrombin receptor gene by the Sp family of transcription factors in human endothelial cells. Biochem J 330: 1469–1474, 1998.[Medline]
  45. Zhang X, Li Y, Dai C, Yang J, Mundel P, and Liu Y. Sp1 and Sp3 transcription factors synergistically regulate HGF receptor gene expression in kidney. Am J Physiol Renal Physiol 284: F82–F94, 2003.[Abstract/Free Full Text]
  46. Zhang X, Odom DT, Koo SH, Conkright MD, Canettieri G, Best J, Chen H, Jenner R, Herbolsheimer E, Jacobsen E, Kadam S, Ecker JR, Emerson B, Hogenesch JB, Unterman T, Young RA, and Montminy M. Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc Natl Acad Sci USA 102: 4459–4464, 2005.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
R. Tan, X. Zhang, J. Yang, Y. Li, and Y. Liu
Molecular Basis for the Cell Type Specific Induction of SnoN Expression by Hepatocyte Growth Factor
J. Am. Soc. Nephrol., August 1, 2007; 18(8): 2340 - 2349.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/3/F635    most recent
00452.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matlhagela, K.
Right arrow Articles by Taub, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matlhagela, K.
Right arrow Articles by Taub, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.