Am J Physiol Renal Physiol 291: F654-F662, 2006.
First published April 18, 2006; doi:10.1152/ajprenal.00214.2004
0363-6127/06 $8.00
Upregulation of Id-1 via BMP-2 receptors induces reactive oxygen species in podocytes
Gregor Pache,1
Christina Schäfer,2
Sebastian Wiesemann,1
Erik Springer,2
Max Liebau,1
Hans Christian Reinhardt,2
Christian August,3
Hermann Pavenstädt,2,* and
Martin Johannes Bek2,*
1Department of Medicine, Division of Nephrology and General Medicine, University Clinic of Freiburg, Freiburg; and 2Department of Medicine, Division of Nephrology and General Medicine, and 3Department of Pathology, University Clinic of Münster, Münster, Germany
Submitted 8 June 2004
; accepted in final form 29 March 2006
 |
ABSTRACT
|
|---|
Bone morphogenetic proteins (BMPs) are secreted signaling molecules, which play a major role in kidney development and disease. Here, we show the existence of mRNA for BMP-2 and for the BMP receptors BMPR1A, BMPR1B, BMPRII, ACVR1A, ACVR2, and ACVR2B in differentiated mouse podocytes and the protein expression of BMPR1A in human glomerular podocytes. BMP-2 dose dependently increases the free cytosolic Ca2+ concentration in podocytes proving the existence of a functional receptor in these cells. Recent data indicate that in a myoblastic cell line and in a breast cancer cell line, BMP-2 increases the expression of Id-1, a negative regulator of basic helix-loop-helix transcription factors, but the role of BMP-2 stimulated Id-1 expression in the kidney has not been further characterized. Here, we show that BMP-2 increases the expression of Id-1 in differentiated podocytes. To investigate a role of Id-1 for podocyte function, overexpression of Id-1 was induced in differentiated mouse podocytes. Id-1-overexpressing podocytes show an increased NADPH-dependent production of reactive oxygen species (ROS). This effect can be evoked by BMP-2 and can be antagonized by anti-Id-1 antisense oligonucleotides. The data indicate that BMP-2 may, via an increased expression of Id-1 and an increased generation of ROS, contribute to important cellular functions in podocytes. ROS supposedly play a major role in cell adhesion, cell injury, ion transport, fibrogenesis, angiogenesis and are involved in the pathogenesis of membranous nephropathy.
bone morphogenetic protein-2; cytosolic free calcium concentration
THE FAMILY OF BONE MORPHOGENETIC (BMP) proteins belongs to the transforming growth factor-
superfamily and acts as signaling molecules. They were originally identified by their ability to induce ectopic bone formation (7, 52, 55). So far, more than 12 different members of the BMP superfamily have been identified but knowledge about the role of BMPs and BMP receptors in the kidney is limited. BMPs bind to specific heteromeric complexes of two related serine/threonine kinase receptors, type I and type II receptors. Three BMP type I receptors (BMPRIA/ALK-3, BMPRIB/ALK-6, BMPR2) and three BMP type II receptors (ACVR1, ACVR2, ACVR2B) have been characterized. Different BMPs bind with different affinity to these BMP receptor complexes. BMPs exert profound and specific effects on the organogenesis of mammals. BMP-2, -4, and -7 have direct or indirect roles in regulation of ureteric branching morphogenesis and branch formation (32, 34). In BMP-7-deficient mice, metanephric mesenchymal cells fail to differentiate, resulting in a virtual absence of glomeruli in the kidneys of newborn mice (30). In diabetic rats, BMP-7, a closely related protein with great structural similarities to BMP-2 (46), partially reverses diabetic-induced kidney hypertrophy, hyperfiltration, urine albumin excretion, and glomerular histology (53). This effect could be mediated by TGF-
expression because BMP-7 antagonizes the TGF-
-dependent fibrogenesis in mesangial cells (54). Less is known about the role of BMP-2 in the kidney. Within the glomerulus BMP-2 inhibits mesangial cell proliferation induced by epidermal growth factor and platelet-derived growth factor (9). In addition, BMP-2 expression is increased in cultured mesangial cells exposed to elevated glucose concentrations, suggesting that BMP-2 plays a role in mesangial cell injury during diabetic nephropathy (33). Knowledge of the expression and function of BMPs and their respective receptors in podocytes, which are the target cell of injury in most proteinuric diseases, is limited.
Id gene products were first identified in myoblasts, where they prevent myogenic basic helix-loop-helix transcription factors (bHLH) from binding to muscle-specific regulatory elements (23, 38, 44). Id proteins dimerize with bHLH proteins to form heterodimers which are unable to bind DNA because Id proteins lack the basic domains for DNA interaction. A BMP-responsive element has been identified in the structure of Id-1 that has been implicated in the inhibition of myogenesis (19). Recently, it was shown that BMP-2 increases the expression of Id-1 in a myoblastic cell line and in a breast cancer cell line, but knowledge about the functional role of Id-1 expression in the kidney is limited. Several reports indicate that Id genes are downstream targets of TGF-
signaling (17, 20, 29, 39), which is a critical mediator of glomerulosclerosis (42). Because reactive oxygen species (ROS) can increase TGF-
activity and protein expression (25), we tested the hypothesis of whether BMP-2 stimulation via Id-1 modifies ROS generation in podocytes.
 |
MATERIALS AND METHODS
|
|---|
Culture of podocytes.
Differentiated immortalized mouse podocytes derived from mice that harbor a thermosensitive variant of the SV40 large T-antigen inserted into the mouse genome were used (35). These mouse podocytes proliferate at 33°C in the presence of interferon-
and differentiate at 37°C after removal of interferon-
. Podocytes were maintained in RPMI 1640 medium (Life Technologies, Eggenstein, Germany) supplemented with 5% fetal calf serum (Biochrom, Berlin, Germany), 100 kU/l penicillin, and 100 mg/l streptomycin (Life Technologies). To propagate podocytes, cells were cultivated at 33°C on type I collagen (permissive conditions) in culture medium supplemented with 10 U/ml recombinant interferon-
(Roche, Mannheim, Germany). To induce differentiation, podocytes were maintained on type I collagen (Biochrom) at 37°C without supplementation with interferon-
(nonpermissive conditions) for 1014 days. Only differentiated podocytes between passages 12 and 17 were used in our experiments. Cells were switched to media that contained only 1% fetal calf serum 24 h before the experiments and then stimulated with BMP-2 (Research Diagnostics), vehicle, or various treatments. In Id-1-overexpressing podocytes, geniticin (150 µg/ml) was added to the medium to maintain selective conditions.
RNA preparation.
Total cellular RNA from podocytes was isolated with guanidinium/acid phenol/chloroform extraction as described previously (5). The amount of RNA was measured photometrically. The integrity of RNA was analyzed after electrophoresis in a 1.5% agarose gel, ethidium bromide staining, and UV irradiation visualization.
RT-PCR.
RT-PCR amplification was performed according to the methods described recently. Briefly, 0.2 µg of total RNA was mixed in 5x reverse transcription buffer containing 0.5 mM dNTP, 10 µM random primers, 10 mM dithiothreitol, 4 U ribonuclease inhibitor, and 20 U M-MLV reverse transcriptase (reverse transcriptase was also omitted to control for the amplification of contaminating DNA) for first-strand synthesis, and incubation was performed at 42°C for 1 h followed by 95°C for 5 min. PCR (PE Thermocycler 480, Perkin Elmer, Weiterstadt, Germany) was performed in duplicate in a total volume of 20 µl, each containing 4 µl of reverse transcription reaction, 10 pmol sense and antisense primer each, 1.0 U Taq DNA polymerase, 200 µM each dNTP in PCR buffer (end concentration 0.5 mM MgCl2, 50 mM KCl, 20 mM Tris, pH 8.3).
The cycle profile included denaturation for 60 s at 94°C, annealing for 60 s at temperatures given in Table 1, and extension for 60 s at 72°C. The primers used and the numbers of cycles performed for each primer pair are shown in Table 1. To analyze the amplification products, 10 µl from each PCR reaction were separated in a 1.5% agarose gel, followed by ethidium bromide staining and UV irradiation. PCR amplification of RT reactions without reverse transcriptase revealed no PCR product, thereby excluding amplification of genomic DNA. All PCR products were sequenced to ensure identity of the fragments with published sequences (Table 1).
Measurements of intracellular free Ca2+ concentration.
Measurements of intracellular free Ca2+ concentration ([Ca2+]i) were performed in single podocytes on an inverted fluorescence microscope setup as described recently (43). In brief, podocytes were incubated with the high-affinity, intracellular calcium indicator fura 2-AM (5 mmol/l; Sigma, Deisenhofen, Germany) for 30 min at 37°C and mounted in a bath chamber on the stage of an inverted microscope. Perfusion was performed with a Ringer-like solution (145 mM NaCl, 1.6 mM K2HPO4, 0.4 mM KH2PO4, 1.3 mM CaCl2, 1.03 mM MgCl2, 5 mM D-glucose, pH 7.4). Transmission maxima at 340, 360, and 380 nm were measured with a photomultiplier, digitized with 12-bit resolution, and recorded continuously on the hard disk of an AT computer. Calibration of the fura 2-fluorescence signal was performed using the Ca2+ ionophore ionomycin (5 mmol/l) as well as low- and high-Ca2+ buffers. To vary the free Ca2+ concentration, the solutions were prepared with EGTA as a Ca2+ chelator. [Ca2+]i was calculated from the fluorescence ratio according to Grynkiewicz et al. (13).
Cloning of mouse Id-1 cDNA.
Mouse Id-1 was cloned using mouse podocyte cDNA. A 5'-primer (cgcgggaattcgccaccatgaaggtcgccagtggcagtgc cgcagccg) containing an EcoRI site and a Kozak sequence in combination with a 3'-primer (cgggggatcctcatcagcgacacaagatgcgatcgtcggctggaacac) containing a BamHI site were used to amplify the complete coding sequence of mouse Id-1. The PCR product was fully sequenced and inserted into the expression vector pIRES2-EGFP (Clontech) between the EcoRI and BamHI sites. After transfection of podocyte cells (Superfect, Qiagen, Hilden, Germany) with vector and vector containing the cDNA for Id-1, selection was performed with 150 µg/ml geniticin (Calbiochem, Bad Soden, Germany). Clones were screened for EGFP expression using fluorescence microscopy. EGFP-positive cells stably overexpressing Id-1 were selected, and expression levels of Id-1 were analyzed using Western blotting techniques. To exclude an interfering effect by random insertion of Id-1 on the experimental outcome, two clones for each cell type (Id-1 overexpressing and control cells) were tested in further experiments.
Western blots.
Western blotting was performed using standard techniques (3). Cultured mouse podocytes were washed once with PBS, harvested by centrifugation (14,000 g, 4°C, 5 min). The pellet was resuspended in lysis buffer [2 mM EDTA, 2 mM EGTA, 100 mM NaCl, 20 mM Tris, 0.1% SDS, 1% Nonidet P-40, 2 mM PMSF, and the complete proteinase inhibitor mixture (Roche Diagnostics, Basel, Switzerland)] and disrupted by sonication. Protein concentrations were determined for each sample by Lowry protein assay. The samples were mixed with Laemmli buffer, boiled (5 min), and subjected to SDS-PAGE and transferred electrophoretically to PVDF membranes. The membranes were stained with Ponceau solution to prove equal amounts of protein and probed with a primary rabbit-anti-Id-1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA). The specifically bound proteins were detected by incubation with a peroxidase-labeled secondary antibody (donkey anti-rabbit; Amersham Pharmacia, Piscataway, NJ) and enhanced chemiluminescence reaction (ECL, Amersham Pharmacia). Quantification of Western blot experiments was performed using commercially available quantification software (ImageQuanT, Molecular Dynamics, Krefeld, Germany).
Measurement of NADPH-oxidase activity.
Measurement of superoxide anion (O2) production was performed as described recently (1). Podocytes were rinsed once with cold PBS collected in Krebs solution (99 mM NaCl, 4.7 mM KCl, 1.8 mM CaCl2, 1.2 mM MgCl2, 25 mM NaHCO3, 1.03 mM K2HPO4, 20 mM Na-HEPES, 11.1 mM glucose, pH 7.35) and centrifuged (200 g, 4°C, 5 min). The supernatant was discarded and the cells were resuspended in fresh Krebs solution. The cell suspension (100 µl) was added to 500 µl Krebs solution containing 5 µM lucigenin and stimulated with 100 µM NADPH. Bioluminescence was measured with Lumat LB9501 (Berthold, Wildbad, Germany). To calculate the amount of O2, total counts were analyzed by calculating the areas under the curves (integration). O2 generation was expressed as nanomoles O2 generated per milligram of cellular protein per minute as described earlier (2). Protein content of the cell suspension was measured with the Lowry method.
Antisense experiments.
Antisense experiments were performed using morpholino antisense oligonucleotides. The following oligonucleotides were used: Id-1 antisense oligonucleotide, 5'-GGCACTGCCACTGGCGACCTTCATG-3'; control oligonucleotide (inverse antisense sequence), 5'-GTACTTCCAGCGGTCACCGTCACGG-3' (Gene Tools, Philomath, OR). Mouse podocytes were grown in six-well plates to 80% confluency. Antisense/control oligonucleotide (300 nmol) and ethoxylated-polyethylenimine (200 µM) were mixed in 600 µl reaction volume and incubated for 20 min at room temperature. After addition of 5.4 ml of serum-free culture medium to the oligonucleotide/ethoxylated-polyethylenimine mixture, cells were incubated for 3 h with the oligonucleotide complex. The oligonucleotide complex was replaced by fresh serum-containing medium, and the cells were incubated for 16 h under standard incubator conditions. After stimulation with BMP-2 (10 µmol/l) or vehicle for 1 h, cells were harvested for NADPH-oxidase activity measurement and Western blotting.
Immunohistochemical analysis.
Fixation and preparation of tissue for immunohistochemical analyses were performed as described before (2). To summarize, human kidney tissues from patients after carcinomectomy were incubated in cold (4°C) PBS followed by 4% paraformaldehyde solution for 24 h at 4°C. Thereafter, kidney samples were embedded in paraffin and cut into 2-µm-thick slices. Tissue samples were deparaffinized in xylol for 1 h, gradually hydrated through graded alcohols (100 to 70%), and washed in deionized water. Antigen unmasking was performed by boiling the slices in citrate buffer for 10 min (10 mM sodium citrate). Blocking was performed using 1% BSA in PBS for 10 min. Sections were incubated for 24 h in a humidified chamber at 4°C with antibodies against BMP receptors (rabbit-anti-BMPR1A Abgent, AP2004b; goat-anti-BMPR2, R&D Systems, AF505; rabbit-anti-WT1, Santa Cruz, sc-192, 1:50 dilution). Following the application of a bridging antibody (DAKO, mouse antirabbit/goat, 1:125) and a second bridging antibody against mouse (DAKO 1:30), the immunoreactivity was determined by the APAAP-complex (1:100) using the Neufuchsin chromogene. Sections were examined by an experienced renal pathologist with a conventional light microscope (Zeiss LSM 510). Negative controls were performed by elimination or heat denaturation of the primary antibody. All procedures performed were in accordance with the ethic commission guidelines of The University of Muenster Ethic Commission.
Immunocytochemistry.
Fixation of differentiated podocytes grown on collagen-coated glass slides was performed by incubation with ice-cold methanol for 5 min followed by permeabilization with 0.3% Triton X-100 for 10 min at room temperature. Blocking was performed using a 12% BSA/0.2% fish gelatin solution for 30 min at room temperature. Thereafter, slides were incubated for 24 h in a humidified chamber at 4°C with antibodies against Id-1 (rabbit-anti-Id-1, Santa Cruz, sc-427, 1:200 dilution) followed by incubation with a FITC-labeled secondary antibody (donkey antirabbit, Jackson Immunoresearch).
Statistical analysis.
Data expressed as means ± SE were analyzed by ANOVA for repeated measures for comparisons within groups and one-way ANOVA for comparisons among groups. Student's t-test was used for a two-group comparison. P < 0.05 was considered statistically significant.
 |
RESULTS
|
|---|
Expression of BMP-2 and BMP receptors in mouse podocytes.
Figure 1 shows an ethidium bromide-stained agarose gel with PCR products for BMP-2 and for the BMP receptors BMPR1A, BMPR1B, BMPR2, ACVR1A, ACVR2, and ACVR2B in differentiated mouse podocytes. Studies were performed with primers derived from published mouse cDNA sequences (Table 1). Sequence analysis of the resulting amplification products revealed identity with published sequences.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 1. Ethidium bromide-stained agarose gel electrophoresis of RT-PCR products for bone morphogenetic protein (BMP)-2 and for the BMP receptors BMPR1A, BMPR1B, BMPR2, ACVR1A, ACVR2, and ACVR2B in differentiated mouse podocytes. Studies were performed with primers derived from published mouse cDNA sequences (Table 1). Experiments were performed by using RT (RT+) or no RT (RT) in each set-up (RT not shown). Amplification of GAPDH was used to prove RNA integrity. Sequence analysis of the resulting amplification products confirmed identity of the amplified fragments.
|
|
BMP-2 increases [Ca2+]i in mouse podocytes.
To evaluate the presence of functionally active BMP receptors in podocytes, differentiated podocytes were stimulated with BMP-2. At 108 M, BMP-2 induced a reversible biphasic increase in [Ca2+] (Fig. 2A). Reduction of the extracellular Ca2+ from 2 x 103 to 106 M did not change the BMP-induced peak but significantly diminished the plateau (data not shown), indicating that both Ca2+ release from intracellular Ca2+ stores (peak) and a transmembranous Ca2+ influx (plateau) are responsible for the BMP-induced [Ca2+]i increase. The effect of BMP on [Ca2+]i was concentration dependent with a half-maximal concentration of
1 nM (BMP vs. [Ca2+]i increase: 1011 M = 29 ± 17 nmol/l, n = 10; 1010 M = 190 ± 57 nmol/l, n = 13; 109 M = 273 ± 81 nmol/l, n = 19; 108 M = 422 ± 68 nmol/l, n = 17; 107 M = 372 ± 69 nmol/l, n = 21; Fig. 2B).

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 2. A: effect of BMP-2 (108 M) on intracellular free Ca2+ concentration ([Ca2+]i) in podocytes grown with 1% fetal calf serum for 24 h. B: concentration-response curve of the effect of BMP-2 on [Ca2+]i in podocytes grown with 1% FCS for 24 h (n = 921, values are means ± SE, *P < 0.05 vs. 1011 M, ANOVA, Scheffé's test).
|
|
BMP-2 increases NADPH-dependent generation of O2 in mouse podocytes.
Activation of the NADPH oxidoreductase enzyme complex leading to generation of ROS has been shown in podocytes in vivo and in vitro (2, 11, 12, 36). It has been suggested that this generation of ROS plays a major role in the pathogenesis of proteinuria (36, 47). BMP-7 has been shown to reverse proteinuria in diabetic rats to normal in a dose-dependent manner (53), but no information about the function of BMP-2 on proteinuria is available. However, opposing effects of BMP-2 and BMP-7 have been described (10, 48, 49). To evaluate whether BMP-2 is involved in the generation of ROS, we stimulated mouse podocytes with either vehicle or BMP-2 (10 µmol/l) for 1, 4, and 24 h and measured NADPH-oxidase activity thereafter. The dosage of 10 µmol/l was choosen because 10 µmol/l BMP-2 induced a strong expression of Id-1 in differentiated podocytes (see Fig. 4). The total amount of superoxide anions generated during the experimental period (15 min) was calculated by integration, and control cells were compared with BMP-2-stimulated cells. Figure 3A shows that the addition of NADPH (0.1 mM) to control podocytes led to an increase in O2 production after 1 h of prestimulation with BMP-2. Following addition of NADPH (0.1 mM) to BMP-2-treated podocytes, the generation of O2 production was increased by
1.8-fold after 1 h. Figure 3B shows the time dependency of NADPH production in podocytes treated with either vehicle or BMP-2. Significant upregulation of NADPH production is seen only at 1 h.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 4. A: Western blot showing the time-dependent upregulation of Id-1 after stimulation with BMP-2 for the indicated times. B: normalized summary of 45 experiments. Id-1 expression was significantly elevated after 0.5 and 4 h of stimulation. Ponceau staining confirmed equal amounts of total protein for all lanes (values are means ± SE, *P < 0.05 vs. control, t-test). C: Id-1 in untransfected differentiated podocytes localizes to the nucleus (left). Control experiments with denatured primary antibody reveal no staining (right).
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 3. NADPH-dependent activation of superoxide anion (O2) production is increased in BMP-2 (10 µmol/l)-stimulated podocytes. A: time-dependent NADPH-mediated O2 production in podocytes and controls prestimulated with BMP-2 for 1 h. B: summary of the relative change in O2 production in podocytes stimulated with BMP-2 for 1, 4, and 24 h compared with vehicle (control)-treated cells. There is a significant increase after 1 h (n = 6/5, values are means ± SE, *P < 0.05 controls, t-test).
|
|
BMP-2 induces the expression of Id-1 in podocytes.
To obtain more information about BMP-2-induced functions in podocytes, we determined Id-1 expression in podocytes stimulated with BMP-2 (10 µmol/l) or vehicle. Recent data indicate that BMP-2 increases Id-1 expression in a myoblastic cell line and in a breast cancer cell line, but the role of BMP-2 stimulation on Id-1 expression in podocytes has not been further characterized (6, 20). Western blot analysis of mouse podocytes stimulated with BMP-2 (10 µmol/l) or vehicle indicates that Id-1 protein expression is significantly upregulated in BMP-2-stimulated podocytes compared with controls. An increase in Id-1 expression (Id-1
18 kDa) can be seen at 0.5, 4, and 24 h (Fig. 4A), but significance was reached only at 0.5 and 4 h (Fig. 4B). A doublet band was detected for Id-1, in both untransfected and Id-1-overexpressing cells. This doublet band most likely represents a glycosylated form of Id-1. The protein sequence contains a putative O-glycosylation site at a threonine in position 75, as well as putative phosphorylation sites for protein kinase A, protein kinase C, protein kinase CKI, and protein kinase GSK3, which all might explain the doublet band. To further test expression and localization of Id-1 in differentiated podocytes, immunocytochemistry in unstimulated podocytes was performed. As expected, Id-1 was found exclusively in the nucleus.
Id-1-overexpressing podocytes show an increased NADPH-dependent generation of O2 in podocytes.
To demonstrate that the effects of BMP-2 on cellular ROS generation could be replicated by Id-1, a mouse podocyte cell line overexpressing Id-1 was created. Expression of Id-1 was significantly (
18-fold) increased in Id-1-transfected cells compared with vector only-transfected cells (controls; Fig. 5A). The results of three Western blot experiments are summarized in Fig. 5B. These cell lines were used to measure NADPH-dependent O2 production. Addition of NADPH (0.1 mM) to Id-1-overexpressing podocytes significantly increased O2 production (5-fold) compared with vector only-transfected cells (controls; Fig. 5C). The total amount of O2 generated during the experimental period (15 min) was again calculated by integration and vector only-transfected cells were compared with Id-1-overexpressing cells. Figure 5D summarizes these experiments.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5. NADPH-dependent activation of superoxide anion production is increased in Id-1-overexpressing podocytes. A: Western blot performed with antibodies against Id-1 showing the expression levels of Id-1 in overexpressing podocytes compared with podocytes transfected with vector only. B: summary of 3 experiments (values are means ± SE, *P < 0.05 vs. control, t-test). C: time-dependent NADPH-mediated superoxide anion production in Id-1-overexpressing podocytes and controls. D: summary (n = 6) of calculated integrals in Id-1-overexpressing podocytes and controls after stimulation with NADPH as a substrate. To calculate the amount of superoxide produced, total counts were generated by integration of the signals (values are means ± SE, *P < 0.05 vs. control, t-test).
|
|
Anti-Id-1 antisense oligonucleotides inhibit BMP-2-induced NADPH-dependent generation of O2 in podocytes.
To prove that BMP-2 is responsible for the generation of O2 via the Id-1 pathway, experiments with Id-1-antisense oligonucleotides were performed. Stimulation of untransfected mouse podocytes with vehicle or BMP-2 (10 µmol/l) for 1 h again showed a significant increase in the generation of O2 production in BMP-2-treated cells compared with vehicle-stimulated control cells (Fig. 6). Pretreatment of BMP-2-stimulated (10 µmol/l) podocytes with Id-1-antisense oligonucleotides significantly inhibited the amount of superoxide anions generated by the addition of NADPH and reduced protein expression for Id-1 compared with inverse antisense (control oligonucleotides)-treated cells. The amount of O2 produced in antisense-treated podocytes was not significantly different from vehicle-stimulated control cells (Fig. 6). In contrast, pretreatment of BMP-2-stimulated (10 µmol/l) podocytes with control oligonucleotides had no inhibitory effect on NADPH-induced ROS production and on Id-1 protein expression.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6. Antisense oligonucleotides inhibit BMP-2-induced NADPH-dependent activation of O2 production. Stimulation of untransfected mouse podocytes for 1 h showed the known significant increase in the generation of O2 production in BMP-2 (10 µmol/l)-treated cells compared with vehicle-stimulated control cells (*P < 0.05, control vs. BMP-2-stimulated, t-test, n = 4). Pretreatment of BMP-2 (10 µmol/l)-stimulated podocytes with Id-1 antisense oligonucleotides (AS) reduced the amount of O2 produced (**P < 0.05, Id-1 antisense oligonucleotides + BMP-2 stimulated vs. BMP-2 stimulated, t-test, n = 4). The amount of O2 produced in antisense-treated podocytes was as low as in vehicle-stimulated control cells. Pretreatment of BMP-2 (10 µmol/l)-stimulated podocytes with inverse antisense oligonucleotides (IVAS) had no inhibitory effect on the generation of O2 production in BMP-2-treated cells (***P < 0.05, Id-1 antisense oligonucleotides vs. Id-1 inverse antisense oligonucleotides, t-test, n = 4).
|
|
Expression of BMP receptors in the glomerulus.
To investigate the protein expression of BMP receptors in the glomerulus, immunohistochemical staining was performed with antibodies recognizing all known BMP receptors. Unfortunately, all commercially available antibodies tested were unsuitable for immunohistochemical staining in mouse and rat tissues and most antibodies tested were unsuitable in human tissues despite specific declarations on specification sheets. Figure 7 shows expression of the BMPR1A receptor in human podocytes. In contrast to our PCR data, the BMPR2 receptor was not found in the glomerulus or elsewhere in the kidney but could be clearly distinguished on monocytes found in the glomerulus (Fig. 7).

View larger version (140K):
[in this window]
[in a new window]
|
Fig. 7. Immunohistochemical staining of WT1, a podocyte-specific protein (top), and the BMPR1A receptor (middle) in podocytes of human kidney tissues gained from patients undergoing nephrectomy because of renal cancer. In contrast to the BMPR1A receptor, the BMPR2 receptor was not found in the glomerulus but can be clearly distinguished in monocytes infiltrating the glomerulus (bottom).
|
|
 |
DISCUSSION
|
|---|
BMPs regulate important cellular functions such as differentiation of pluripotent mesenchymal cells into the osteogenic lineage and the function of differentiated osteoblasts (30, 52, 55, 56). Within the kidney, BMP-2 is expressed by metanephric mesenchymal cells and inhibits collecting duct morphogenesis (14). Mesangial cells in the glomerulus synthezise BMP-2 and gremlin, a putative antagonist of BMP-2 (33). Both BMP-2 and gremlin expression is increased under cellular stress induced by high glucose (33), but their functions are unclear. In addition, BMP-2 inhibits cell proliferation in mesangial cells via downregulation of PDGF-induced DNA synthesis (9).
Here, we show that differentiated cultured podocytes express both, mRNA for BMP-2 and mRNA for the BMP receptors BMPR1A, BMPR1B, BMPR2, ACVR1A, ACVR2, and ACVR2B, suggesting a role for BMP-2 in glomerular function. In contrast, our immunohistochemical stainings show that despite mRNA expression of all BMP receptors in cultured mouse podocytes, protein expression in vivo could only be demonstrated for the BMPR1A receptor in human podocytes. In addition, our data indicate that the BMPR2 receptor is not present in the human glomerulus. The expression profiles of the BMP receptors BMPR1B, ACVR1A, ACVR2, and ACVR2B remain unclear because all commercially available antibodies tests were unreliable or unsuitable for immunohistochemistry in mouse, rat, and human tissues.
BMP-2 exerts its effect via type I and type II transmembrane serine threonine kinase receptors to form heteromeric receptor complexes with subsequent phosphorylation of type I receptors and activation of the catalytic activity of type I receptor kinase (21). The simultaneous expression of BMP-2 and BMP type I and type II receptor mRNA in podocytes suggests a modulation of podocyte function by autocrine or paracrine regulation. Recent data indicate that BMP-2 is present in mesangial cells of the glomerulus, too (33).
In the present study, we show that BMP-2 increases [Ca2+]i in podocytes concentration dependently, suggesting the presence of functionally active BMP receptors and a regulatory role of BMP-2 for Ca2+-dependent signaling pathways in podocytes. To our knowledge, a BMP-induced calcium increase has not been shown so far. BMP-2 significantly increased [Ca2+]i at concentrations between 1010 and 107 M, suggesting an interaction with a high-affinity type I receptor such as BMPR1A, BMPR1B, or ACVR1. This fits nicely with the expression of the BMPR1A receptor in podocytes in vivo. BMP-2 induced a biphasic [Ca2+]i response consisting of an initial Ca2+ peak followed by a sustained Ca2+ plateau, the latter being dependent on extracellular Ca2+ influx. Stimulation of calcium-dependent PKC activity by BMP-2 has been shown (4, 16), but the PKC isoform involved has not been further characterized. Recently, we demonstrated that [Ca2+]i-mobilizing agonists induce NADPH-oxidase activity in podocytes, a major source for the production of O2 in these cells (12).
In this study, we can show that BMP-2 increases NADPH-dependent generation of O2 in podocytes, an effect that is mediated by Id-1, a negative regulator of bHLH transcription factors, because pretreatment with Id-1 antisense oligonucleotides abolished this effect. In addition, O2 production was strongly increased in Id-1-overexpressing podocytes. Recently, it was shown that transcription of Id-1 can be mediated by the early response gene Egr-1 (50). These data fit well to our finding in EGR-1-overexpressing human proximal tubule cells where an increase in O2 production similar to that found in BMP-stimulated and Id-1-overexpressing podocytes was found (1). Recent data show that Id-1 is crucial for the formation of intact neovasculature (31, 44). In addition, elevated levels of Id-1 have been found in synovial neovascularization of patients with rheumatoid arthritis (45). ROS might mediate this effect because NAD(P)H oxidase-dependent vascular endothelial growth factor-induced signaling and angiogenesis have been shown (51).
Interestingly, Id genes are downstream targets of TGF-
signaling (17, 20, 29). In the kidney, TGF-
plays an important role in the pathogenesis of glomerulosclerosis, the end stage of many glomerulopathies (18, 42, 54). The BMP-2-induced upregulation of Id-1 protein expression and NADPH-oxidase activity could contribute to glomerulosclerosis, because ROS can increase TGF-
activity and protein expression in the kidney (18, 22, 25, 42). In our experiments, an increased ROS generation following BMP-2 stimulation was present only after 1 h of stimulation while Id-1 protein expression was still markedly increased after 4 h of stimulation. This effect could be caused by the interaction of Id-1 with other transcription factors that alter gene regulation or by signal transduction pathways downstream of Id-1 with deactivation of the NADH/NADPH-oxidase complex. Several signal transduction components essential for the actions of BMP-2 downstream of the serine/threonine kinase receptor have been demonstrated, including SMAD proteins (28), mitogen-activated protein kinase (15), TGF-activated kinase 1 (24, 40), MAPK/ERK kinase (8), and protein kinase C (16). Recent data indicate that the mode of BMP receptor oligomerization seems to determine different BMP-2 signaling pathways (37).
Our data might give additional insight into podocyte function, because ROS seem to play an important role as intra- and extracellular messenger in renal disease. For instance, high glucose-induced activation of PKC supposedly plays an important role in ROS generation and renal injury in diabetic nephropathy. In addition, in Heymann nephritis C5b-9 attack on podocytes causes upregulation and translocation of the NADPH oxidoreductase enzyme complex to the cell membrane. Subsequently, ROS induce lipid peroxidation and degradation of glomerular basal membrane collagen IV, leading to proteinuria (22, 36, 47). BMP-2 may therefore contribute to the pathogenesis of proteinuria via activation of NADPH oxidases. An induction of granulocyte macrophage colony-stimulating factor has been found in podocytes stimulated with ROS (11). However, other roles for BMP-2 in podocytes seem possible, too. A BMP-responsive element has been identified in the structure of Id-1 that has been implicated in the inhibition of myogenesis (19). In addition, a direct suppression of the myogenic phenotype has been shown for BMP-2 (27). This effect might be regulated by ROS, because inhibition of myogenesis through redox-dependent mechanisms has been shown (26, 41). Hence, it seems likely that BMP-2-induced generation of ROS alters gene expression and inhibits cellular functions in podocytes.
In summary, we show in this study that cultured podocytes express mRNA for BMP-2 and BMP receptors. Activation of these receptors by BMP-2 can be demonstrated by an increase of [Ca2+]i and via upregulation of Id-1 to subsequent generation of O2. Further studies will be necessary to determine the mechanisms involved in Id-1-dependent ROS generation.
 |
GRANTS
|
|---|
This study was supported by Deutsche Forschungsgemeinschaft PA 483/51.
 |
ACKNOWLEDGMENTS
|
|---|
We thank C. Hupfer, P. Daemisch, P. Kulick, and M. Wolters for excellent technical assistance. Podocyte cells were a generous gift from P. Mundel (Albert Einstein College of Medicine, New York, NY).
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: H. Pavenstädt, Division of Nephrology, Univ. Clinics Münster, Albert-Schweitzer-Str. 33, 48149 Münster, Germany (e-mail: Hermann.Pavenstaedt{at}ukmuenster.de)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* H. Pavenstädt and M. J. Bek contributed equally to this work. 
 |
REFERENCES
|
|---|
- Bek MJ, Reinhardt HC, Fischer KG, Hirsch JR, Hupfer C, Dayal E, and Pavenstadt H. Upregulation of early growth response gene-1 via the CXCR3 receptor induces reactive oxygen species and inhibits Na+/K+-ATPase activity in an immortalized human proximal tubule cell line. J Immunol 170: 931940, 2003.[Abstract/Free Full Text]
- Bek MJ, Wahle S, Muller B, Benzing T, Huber TB, Kretzler M, Cohen C, Busse-Grawitz A, and Pavenstadt H. Stra13, a prostaglandin E2-induced gene, regulates the cellular redox state of podocytes. FASEB J 17: 682684, 2003.[Abstract/Free Full Text]
- Bek MJ, Zheng S, Xu J, Yamaguchi I, Asico LD, Sun XG, and Jose PA. Differential expression of adenylyl cyclases in the rat nephron. Kidney Int 60: 890899, 2001.[CrossRef][Web of Science][Medline]
- Chan GK, Miao D, Deckelbaum R, Bolivar I, Karaplis A, and Goltzman D. Parathyroid hormone-related peptide interacts with bone morphogenetic protein 2 to increase osteoblastogenesis and decrease adipogenesis in pluripotent C3H10T 1/2 mesenchymal cells. Endocrinology 144: 55115520, 2003.[Abstract/Free Full Text]
- Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156159, 1987.[Web of Science][Medline]
- Clement JH, Marr N, Meissner A, Schwalbe M, Sebald W, Kliche KO, Hoffken K, and Wolfl S. Bone morphogenetic protein 2 (BMP-2) induces sequential changes of Id gene expression in the breast cancer cell line MCF-7. J Cancer Res Clin Oncol 126: 271279, 2000.[CrossRef][Web of Science][Medline]
- Ducy P and Karsenty G. The family of bone morphogenetic proteins. Kidney Int 57: 22072214, 2000.[CrossRef][Web of Science][Medline]
- Fisher CE, Michael L, Barnett MW, and Davies JA. Erk MAP kinase regulates branching morphogenesis in the developing mouse kidney. Development 128: 43294338, 2001.[Abstract/Free Full Text]
- Ghosh Choudhury G, Kim YS, Simon M, Wozney J, Harris S, Ghosh-Choudhury N, Abboud HE, Ghosh Choundhury G, and Ghosh-Choundhury N. Bone morphogenetic protein 2 inhibits platelet-derived growth factor-induced c-fos gene transcription and DNA synthesis in mesangial cells. Involvement of mitogen-activated protein kinase. J Biol Chem 274: 1089710902, 1999.[Abstract/Free Full Text]
- Gratacos E, Checa N, and Alberch J. Bone morphogenetic protein-2, but not bone morphogenetic protein-7, promotes dendritic growth and calbindin phenotype in cultured rat striatal neurons. Neuroscience 104: 783790, 2001.[CrossRef][Web of Science][Medline]
- Greiber S, Muller B, Daemisch P, and Pavenstadt H. Reactive oxygen species alter gene expression in podocytes: induction of granulocyte macrophage-colony-stimulating factor. J Am Soc Nephrol 13: 8695, 2002.[Abstract/Free Full Text]
- Greiber S, Munzel T, Kastner S, Muller B, Schollmeyer P, and Pavenstadt H. NAD(P)H oxidase activity in cultured human podocytes: effects of adenosine triphosphate. Kidney Int 53: 654663, 1998.[CrossRef][Web of Science][Medline]
- Grynkiewicz G, Poenie M, and Tsien RY. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260: 34403450, 1985.[Abstract/Free Full Text]
- Gupta IR, Macias-Silva M, Kim S, Zhou X, Piscione TD, Whiteside C, Wrana JL, and Rosenblum ND. BMP-2/ALK3 and HGF signal in parallel to regulate renal collecting duct morphogenesis. J Cell Sci 113: 269278, 2000.[Abstract]
- Hata K, Nishimura R, Ikeda F, Yamashita K, Matsubara T, Nokubi T, and Yoneda T. Differential roles of Smad1 and p38 kinase in regulation of peroxisome proliferator-activating receptor gamma during bone morphogenetic protein 2-induced adipogenesis. Mol Biol Cell 14: 545555, 2003.[Abstract/Free Full Text]
- Hay E, Lemonnier J, Fromigue O, and Marie PJ. Bone morphogenetic protein-2 promotes osteoblast apoptosis through a Smad-independent, protein kinase C-dependent signaling pathway. J Biol Chem 276: 2902829036, 2001.[Abstract/Free Full Text]
- Hollnagel A, Oehlmann V, Heymer J, Ruther U, and Nordheim A. Id genes are direct targets of bone morphogenetic protein induction in embryonic stem cells. J Biol Chem 274: 1983819845, 1999.[Abstract/Free Full Text]
- Jiang Z, Seo JY, Ha H, Lee EA, Kim YS, Han DC, Uh ST, Park CS, and Lee HB. Reactive oxygen species mediate TGF-
1-induced plasminogen activator inhibitor-1 upregulation in mesangial cells. Biochem Biophys Res Commun 309: 961966, 2003.[CrossRef][Web of Science][Medline] - Katagiri T, Imada M, Yanai T, Suda T, Takahashi N, and Kamijo R. Identification of a BMP-responsive element in Id1, the gene for inhibition of myogenesis. Genes Cells 7: 949960, 2002.[Abstract]
- Katagiri T, Yamaguchi A, Komaki M, Abe E, Takahashi N, Ikeda T, Rosen V, Wozney JM, Fujisawa-Sehara A, and Suda T. Bone morphogenetic protein-2 converts the differentiation pathway of C2C12 myoblasts into the osteoblast lineage. J Cell Biol 127: 17551766, 1994.[Abstract/Free Full Text]
- Kawabata M, Imamura T, and Miyazono K. Signal transduction by bone morphogenetic proteins. Cytokine Growth Factor Rev 9: 4961, 1998.[CrossRef][Web of Science][Medline]
- Kerjaschki D and Neale TJ. Molecular mechanisms of glomerular injury in rat experimental membranous nephropathy (Heymann nephritis). J Am Soc Nephrol 7: 25182526, 1996.[Abstract]
- Kreider BL, Benezra R, Rovera G, and Kadesch T. Inhibition of myeloid differentiation by the helix-loop-helix protein Id. Science 255: 17001702, 1992.[Abstract/Free Full Text]
- Lai CF and Cheng SL. Signal transductions induced by bone morphogenetic protein-2 and transforming growth factor-
in normal human osteoblastic cells. J Biol Chem 277: 1551415522, 2002.[Abstract/Free Full Text] - Lal MA, Brismar H, Eklof AC, and Aperia A. Role of oxidative stress in advanced glycation end product-induced mesangial cell activation. Kidney Int 61: 20062014, 2002.[CrossRef][Web of Science][Medline]
- Langen RC, Schols AM, Kelders MC, Van Der Velden JL, Wouters EF, and Janssen-Heininger YM. Tumor necrosis factor-
inhibits myogenesis through redox-dependent and -independent pathways. Am J Physiol Cell Physiol 283: C714C721, 2002.[Abstract/Free Full Text] - Lee MH, Javed A, Kim HJ, Shin HI, Gutierrez S, Choi JY, Rosen V, Stein JL, van Wijnen AJ, Stein GS, Lian JB, and Ryoo HM. Transient upregulation of CBFA1 in response to bone morphogenetic protein-2 and transforming growth factor
1 in C2C12 myogenic cells coincides with suppression of the myogenic phenotype but is not sufficient for osteoblast differentiation. J Cell Biochem 73: 114125, 1999.[CrossRef][Web of Science][Medline] - Li X, Ionescu AM, Schwarz EM, Zhang X, Drissi H, Puzas JE, Rosier RN, Zuscik MJ, and O'Keefe RJ. Smad6 is induced by BMP-2 and modulates chondrocyte differentiation. J Orthop Res 21: 908913, 2003.[CrossRef][Web of Science][Medline]
- Locklin RM, Riggs BL, Hicok KC, Horton HF, Byrne MC, and Khosla S. Assessment of gene regulation by bone morphogenetic protein 2 in human marrow stromal cells using gene array technology. J Bone Miner Res 16: 21922204, 2001.[CrossRef][Web of Science][Medline]
- Luo G, Hofmann C, Bronckers AL, Sohocki M, Bradley A, and Karsenty G. BMP-7 is an inducer of nephrogenesis and is also required for eye development and skeletal patterning. Genes Dev 9: 28082820, 1995.[Abstract/Free Full Text]
- Lyden D, Young AZ, Zagzag D, Yan W, Gerald W, O'Reilly R, Bader BL, Hynes RO, Zhuang Y, Manova K, and Benezra R. Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization of tumour xenografts. Nature 401: 670677, 1999.[CrossRef][Medline]
- Martinez G, Mishina Y, and Bertram JF. BMPs and BMP receptors in mouse metanephric development: in vivo and in vitro studies. Int J Dev Biol 46: 525533, 2002.[Web of Science][Medline]
- McMahon R, Murphy M, Clarkson M, Taal M, Mackenzie HS, Godson C, Martin F, and Brady HR. IHG-2, a mesangial cell gene induced by high glucose, is human gremlin. Regulation by extracellular glucose concentration, cyclic mechanical strain, and transforming growth factor-
1. J Biol Chem 275: 99019904, 2000.[Abstract/Free Full Text] - Miyazaki Y, Oshima K, Fogo A, and Ichikawa I. Evidence that bone morphogenetic protein 4 has multiple biological functions during kidney and urinary tract development. Kidney Int 63: 835844, 2003.[CrossRef][Web of Science][Medline]
- Mundel P, Reiser J, Zuniga Mejia Borja A, Pavenstadt H, Davidson GR, Kriz W, and Zeller R. Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines. Exp Cell Res 236: 248258, 1997.[CrossRef][Web of Science][Medline]
- Neale TJ, Ullrich R, Ojha P, Poczewski H, Verhoeven AJ, and Kerjaschki D. Reactive oxygen species and neutrophil respiratory burst cytochrome b558 are produced by kidney glomerular cells in passive Heymann nephritis. Proc Natl Acad Sci USA 90: 36453649, 1993.[Abstract/Free Full Text]
- Nohe A, Hassel S, Ehrlich M, Neubauer F, Sebald W, Henis YI, and Knaus P. The mode of bone morphogenetic protein (BMP) receptor oligomerization determines different BMP-2 signaling pathways. J Biol Chem 277: 53305338, 2002.[Abstract/Free Full Text]
- Norton JD. ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis. J Cell Sci 113: 38973905, 2000.[Abstract]
- Ogata T, Wozney JM, Benezra R, and Noda M. Bone morphogenetic protein 2 transiently enhances expression of a gene, Id (inhibitor of differentiation), encoding a helix-loop-helix molecule in osteoblast-like cells. Proc Natl Acad Sci USA 90: 92199222, 1993.[Abstract/Free Full Text]
- Palcy S and Goltzman D. Protein kinase signalling pathways involved in the upregulation of the rat
(I) collagen gene by transforming growth factor
1 and bone morphogenetic protein 2 in osteoblastic cells. Biochem J 343: 2127, 1999. - Reid MB and Li YP. Cytokines and oxidative signalling in skeletal muscle. Acta Physiol Scand 171: 225232, 2001.[CrossRef][Web of Science][Medline]
- Riser BL, Cortes P, Yee J, Sharba AK, Asano K, Rodriguez-Barbero A, and Narins RG. Mechanical strain- and high glucose-induced alterations in mesangial cell collagen metabolism: role of TGF-
. J Am Soc Nephrol 9: 827836, 1998.[Abstract] - Rudiger F, Greger R, Nitschke R, Henger A, Mundel P, and Pavenstadt H. Polycations induce calcium signaling in glomerular podocytes. Kidney Int 56: 17001709, 1999.[CrossRef][Web of Science][Medline]
- Ruzinova MB and Benezra R. Id proteins in development, cell cycle and cancer. Trends Cell Biol 13: 410418, 2003.[CrossRef][Web of Science][Medline]
- Sakurai D, Yamaguchi A, Tsuchiya N, Yamamoto K, and Tokunaga K. Expression of ID family genes in the synovia from patients with rheumatoid arthritis. Biochem Biophys Res Commun 284: 436442, 2001.[CrossRef][Web of Science][Medline]
- Scheufler C, Sebald W, and Hulsmeyer M. Crystal structure of human bone morphogenetic protein-2 at 2.7. A resolution. J Mol Biol 287: 103115, 1999.[CrossRef][Web of Science][Medline]
- Shah SV. Evidence suggesting a role for hydroxyl radical in passive Heymann nephritis in rats. Am J Physiol Renal Fluid Electrolyte Physiol 254: F337F344, 1988.[Abstract/Free Full Text]
- Shou J, Murray RC, Rim PC, and Calof AL. Opposing effects of bone morphogenetic proteins on neuron production and survival in the olfactory receptor neuron lineage. Development 127: 54035413, 2000.[Abstract]
- Terkeltaub RA, Johnson K, Rohnow D, Goomer R, Burton D, and Deftos LJ. Bone morphogenetic proteins and bFGF exert opposing regulatory effects on PTHrP expression and inorganic pyrophosphate elaboration in immortalized murine endochondral hypertrophic chondrocytes (MCT cells). J Bone Miner Res 13: 931941, 1998.[CrossRef][Web of Science][Medline]
- Tournay O and Benezra R. Transcription of the dominant-negative helix-loop-helix protein Id1 is regulated by a protein complex containing the immediate-early response gene Egr-1. Mol Cell Biol 16: 24182430, 1996.[Abstract/Free Full Text]
- Ushio-Fukai M, Tang Y, Fukai T, Dikalov SI, Ma Y, Fujimoto M, Quinn MT, Pagano PJ, Johnson C, and Alexander RW. Novel role of gp91(phox)-containing NAD(P)H oxidase in vascular endothelial growth factor-induced signaling and angiogenesis. Circ Res 91: 11601167, 2002.[Abstract/Free Full Text]
- Wang EA, Rosen V, D'Alessandro JS, Bauduy M, Cordes P, Harada T, Israel DI, Hewick RM, Kerns KM, LaPan P, Luxenberg DP, McQuaid D, Moutsatsos IK, Nove J, and Wozney JM. Recombinant human bone morphogenetic protein induces bone formation. Proc Natl Acad Sci USA 87: 22202224, 1990.[Abstract/Free Full Text]
- Wang S, Chen Q, Simon TC, Strebeck F, Chaudhary L, Morrissey J, Liapis H, Klahr S, and Hruska KA. Bone morphogenic protein-7 (BMP-7), a novel therapy for diabetic nephropathy. Kidney Int 63: 20372049, 2003.[CrossRef][Web of Science][Medline]
- Wang S and Hirschberg R. BMP7 antagonizes TGF-
-dependent fibrogenesis in mesangial cells. Am J Physiol Renal Physiol 284: F1006F1013, 2003.[Abstract/Free Full Text] - Yoshikawa H, Takaoka K, Shimizu N, and Ono K. Solubility of a bone-inducing substance from a murine osteosarcoma. Clin Orthop 182: 231235, 1984.
- Zhao GQ. Consequences of knocking out BMP signaling in the mouse. Genesis 35: 4356, 2003.[CrossRef][Web of Science][Medline]
Copyright © 2006 by the American Physiological Society.