AJP - Renal AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 292: F660-F666, 2007. First published September 5, 2006; doi:10.1152/ajprenal.00178.2006
0363-6127/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/2/F660    most recent
00178.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marinovic, A. C.
Right arrow Articles by Price, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marinovic, A. C.
Right arrow Articles by Price, S. R.

Tissue-specific regulation of ubiquitin (UbC) transcription by glucocorticoids: in vivo and in vitro analyses

Anne C. Marinovic,1,2 Bin Zheng,1 William E. Mitch,3 and S. Russ Price1

1Renal Division and 2Graduate Program in Biochemistry, Cell and Developmental Biology, Emory University, Atlanta, Georgia; and 3Division of Nephrology, Baylor College of Medicine, Houston, Texas

Submitted 23 May 2006 ; accepted in final form 19 August 2006


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In uremia, muscle wasting involves increased glucocorticoid production and activation of the ubiquitin-proteasome proteolytic pathway, including increased expression of ubiquitin. Previously, we reported that glucocorticoids stimulate ubiquitin transcription by a mechanism involving Sp1 in L6 muscle cells (Marinovic AC, Zheng B, Mitch WE, Price SR. J Biol Chem 277: 16673–16681, 2002). This finding was surprising because Sp1 is a general transcriptional activator. To better understand the mechanism of glucocorticoid-induced ubiquitin (UbC) gene transcription, we examined whether this response occurs in many organs or uniquely in skeletal muscle. Glucocorticoid-responsive cells of different organs were transfected with a human UbC promoter-luciferase reporter plasmid; dexamethasone stimulated UbC reporter activity 220% (P < 0.05) in L6 skeletal muscle cells but not in HepG2 hepatocytes, NRK kidney cells, CaCo-2 colon cells, or H9c2 cardiomyocytes. Transactivation of the Sp1-responsive SV40 viral promoter was also increased in muscle but not in other nonmuscle cells. The muscle-specific nature of the UbC response was confirmed in vivo in rats with insulin deficiency, a condition associated with high glucocorticoid production: UbC mRNA was elevated in skeletal muscle but not in liver, kidney, intestine, or heart. Electrophoretic mobility shift assays and in vivo genomic footprinting demonstrated that insulin deficiency increased Sp1 binding to GC-rich elements in the UbC promoter. Thus glucocorticoids increase UbC transcription by a mechanism involving Sp1 that is unique to muscle.

skeletal muscle; atrophy; gene expression


A SERIOUS AND FREQUENT COMPLICATION of chronic kidney disease (CKD) is loss of muscle mass. This muscle atrophy is the result of catabolic signals arising from complications of CKD: metabolic acidosis, increased glucocorticoid production, and impaired insulin action (11). In experimental animals, these signals stimulate proteolysis by the ubiquitin-proteasome proteolytic system (UPP) and increase transcription of genes encoding ubiquitin and other components of proteasome system in muscle (1, 16, 23, 29). These findings are applicable in the clinical setting as well. In continuous ambulatory peritoneal dialysis patients, correction of metabolic acidosis increased muscle mass presumably by downregulating the UPP system since the level of ubiquitin mRNA in muscle declined when acidosis was corrected (27).

During muscle atrophy, a program of transcriptional responses occurs that increase expression of genes encoding ubiquitin, E2 ubiquitin conjugating enzymes (e.g., E214k), E3 ubiquitin ligases, and 26S proteasome subunits. Current evidence indicates that multiple transactivation mechanisms are responsible for these genetic responses. For example, Sp1 regulates the ubiquitin UbC gene (20) while FOXO1/3 are activators of the muscle-specific E3 ligases atrogin-1 and muscle ring finger (MuRF)-1 (18, 32, 34). NF-{kappa}B can regulate the transcription of the MuRF-1 and C3 20S proteasome subunit (also known as {alpha}2) genes (3, 9). Of these gene targets, only UbC and the C3 subunit have been shown to undergo transactivation by glucocorticoids (9, 20).

Previously, we reported that glucocorticoids simultaneously induce muscle proteolysis and UbC expression in both experimental animals and cultured muscle cells (21, 23, 30). Both responses were blocked by adrenalectomy or a glucocorticoid receptor inhibitor in rats with metabolic acidosis, insulin deficiency, sepsis, or starvation (21, 23, 30, 36, 39). In L6 muscle cells, glucocorticoids also stimulated proteolysis and the transcription of the proteasome C3 subunit and UbC genes (9, 20). While investigating the activation mechanism for UbC, we found that glucocorticoids increase the binding of the transcription factor Sp1 to the UbC promoter region by a mechanism requiring MEK1/2 (20). Since Sp1 is generally considered to be a ubiquitous transcription factor, the glucocorticoid-induced increase in UbC transcription in muscle could represent a general "stress" response that increases ubiquitin, a stress-related protein, in multiple organs. Therefore, we studied the regulation of UbC transcription by glucocorticoids in both muscle and nonmuscle cell types. To examine the physiological relevance of Sp1 in UbC expression in muscle, we investigated the transcriptional activation of UbC in vivo by studying muscle of rats rendered insulin-deficient by streptozotocin (STZ). This model was chosen because in earlier studies, we found that glucocorticoids are necessary for the increase in muscle ubiquitin mRNA in insulin-deficient rats (23).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
DNA reporter constructs. A human UbC promoter fragment (–930 to +3, with +1 as transcription start site, GenBank accession no. D63791) was amplified from human genomic DNA (Boehringer-Mannheim; Indianapolis, IN) using PCR and a forward primer (5'-GTGGTACCG ATCCTGCTTACAATAATCG-3') and reverse primer (5'-CACGCTAGCAACTAGCTG TGCCACACCCG-3') containing a KpnI and NheI restriction site, respectively. The resulting DNA fragment was subcloned into the pGL2-basic firefly reporter plasmid (Promega, Madison, WI). The glucocorticoid-responsive TAT3-TATA firefly luciferase reporter plasmid (pTAT3-TATA) containing three hormone-response elements was provided by O. Froelich (14). The Spl-responsive SV40-promoter firefly luciferase reporter plasmid, pGL2-Control, was purchased from Promega. Sp1 was transiently overexpressed using the expression plasmid pGCN-Sp1, which was provided by T. Shenk (26). A plasmid composed of the human thromboxane synthase minimal promoter (–90 to +30) linked to the Renilla luciferase gene (pTS-RL) served as an internal control for transfection efficiency (14).

Cell culture and transient transfection assays. Cell lines (ATCC, Rockville, MD) were maintained in cell-appropriate media (20) except for NRK kidney cells, which were kept in DMEM (Cambrex, Rockland, ME). Cells were plated at 1.5 x 104 cells per 4-cm2 well and after 15 h were transfected with 0.5 µg/well of either the human UbC promoter-luciferase reporter plasmid or the TAT3-TATA promoter-luciferase reporter plasmid plus 0.1 µg/well of pTS-RL Renilla luciferase control plasmid using the Fugene 6 transfection reagent (Roche Diagnostics, Indianapolis, IN). The ratio of DNA to Fugene 6 was 1 µg/3 µl. After 24 h, the media were replaced and supplemented with 2% horse serum; cells were maintained for 48 h, and some were treated with dexamethasone (100 nM, Sigma, St. Louis, MO). Firefly and Renilla luciferase activities were measured using the Dual Luciferase Assay system (Promega) and a Turner TD 20/20 luminometer.

Rat model of insulin deficiency. STZ (125 mg/kg) was injected into the tail vein of male Sprague-Dawley rats (~200 g, Charles River, Wilmington, MA) as described (29). Control rats were injected with vehicle and pair-fed to STZ-diabetic rats; 3 days later, tissues were harvested after an overnight fast. All studies were performed in accordance with the guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by Emory University’s Institutional Animal Care and Use Committee.

Northern Blot hybridizations. RNA was isolated using TriReagent (Molecular Research Center, Cincinnati, OH) and separated as described (29). Blots were hybridized with a rat UbC-specific cDNA probe labeled with [32P]dCTP using the random primer Prime-It II kit (Stratagene, La Jolla, CA) (19, 20). Membranes were hybridized in Rapid-hyb buffer (Amersham Pharmacia Biotech, Piscataway, NJ) at 65°C for 2 h, washed once with 1x standard saline citrate (SSC)/0.5% SDS, twice with 0.5x SSC/0.5% SDS, and once with 0.2x SSC/0.5% SDS at 65°C before autoradiography.

Nuclear extract preparation. Nuclei were isolated from ~12 g of hindquarter muscle, and nuclear protein extracts were prepared as described (1, 8). Briefly, nuclei were isolated and pooled from hindquarter muscle of three rats, washed in 5 ml of a buffer containing 36.5 mM HEPES (pH 7.9), 4.0 mM MgCl2, 130 mM KCl, 0.5 mM DTT, and 0.5 mM PMSF, and resuspended in 350 µl of a buffer containing 20 mM HEPES (pH 7.9), 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 25% glycerol, 0.5 mM DTT, and 0.5 mM PMSF. The resuspended nuclei were dounced in a chilled, ground glass homogenizer; the resulting extract was transferred to a microfuge tube and rocked at 4°C for 50 min. The extract was dialyzed against 500 ml of 20 mM HEPES (pH 7.9), 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 0.25 mM DTT, and 0.5 mM PMSF buffer for 5 h with one change of buffer. After dialysis, the samples were centrifuged at 14,000 rpm for 20 min at 4°C; supernatants were stored at –80°C.

Electrophoretic mobility shift assays. Protein-DNA binding reactions and gel electrophoresis was performed as described by Ping et al. (28). Nuclear extracts (1 µg protein) from muscle of insulin-deficient and pair-fed control rats were preincubated for 5 min on ice with or without double-stranded competitor probes (0.7 pmol) or an anti-Sp1 antibody (2 µg) (Santa Cruz Biotechnology, Santa Cruz, CA) in a reaction buffer containing 15 mM HEPES (pH 7.9), 50 mM KCl, 5 mM MgCl2, 0.12 mM EDTA, 10% glycerol, 0.25 mg/ml BSA, 0.05% NP-40, 10 mM DTT, and 200 ng poly(dI/dC). Fifty-thousand counts per minute of a [{gamma}-32P]ATP end-labeled, gel-purified, double-stranded oligonucleotide probe were added, and each binding reaction was incubated for an additional 25 min on ice before electrophoresis in a 5% nondenaturing acrylamide gel. Competitor oligonucleotide probes were created by annealing 40 complementary base sequences: sense strands of DNAs were rat UbC (rUbC) (–67 to –30), 5'- CGGAGGAATCCAGGGGTGGGCGGGGCTCCCGATGACTATA–3'; rUbC{Delta}Sp1 (–67 to –30), 5'-CGGAGGAATCCAGGTTTGTTCGGGGCTCCCCGATGACTAT-3' (bases that are different from the corresponding wild-type sequence are underlined). The Sp1 and Sp1 mutant sequences were described by Jones et al. (15).

In vivo genomic footprinting. Methylation of skeletal muscle DNA was achieved by injection of 50 µl of dimethyl sulfate (DMS) into the lower aorta of deeply anesthetized control and diabetic rats. After 2 min, 50 µl of beta-mercaptoethanol was injected, and the gastrocnemius muscle was immediately removed and finely minced. The tissue (~500 µg) was dissolved overnight at room temperature in DNAzol genomic DNA isolation reagent (Molecular Research Center, Cincinnati, OH) supplemented with 100 µg/ml proteinase K according to the manufacturer’s protocol. Genomic DNA was isolated, and the pellet was resuspended in water before subjecting it to four consecutive phenol/chloroform extractions followed by ethanol precipitation. Protein-free, genomic DNA was cleaved with piperidine, and in vivo genomic footprinting (IVGF) was performed (25, 28). The sequences for the forward (fwd) and reverse (rev) coding strand primers for the rUbC gene are rUbCfwd-1, 5'-CACACAAAGCCCCTCACTCT-3'; rUbcfwd-2, 5'-GTTTTAGCCTGTCGCTTCCATTGCA-3'; and rUbCfwd-3, 5'-CTTCCATTGCAGAGATTGGACCGGG-3'. The sequences for the noncoding strand primers are rUbCrev-1, 5'-GTGTTGGCTGCAGTCCTC-3'; rUbCrev-2, 5'-GAACTGGCGGTCTCGACG-3'; rUbCrev-3, 5'-CTGGCGGTCTCGACGGAGCTA-3'. In each IVGF amplification analysis, primer 1 was used in the first step. Following ligation of a common linker (25), primer 2 was used for amplification with the common linker primer, and primer 3 was end-labeled and used for the final extension.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Glucocorticoids induce UbC promoter activity selectively in skeletal muscle cells. To determine whether glucocorticoids increase UbC transcription in muscle and nonmuscle cells, cultured cell lines were examined after transient transfection with a human UbC promoter-luciferase reporter plasmid and treatment with 100 nM dexamethasone for 48 h. Consistent with previous studies (19, 20), dexamethasone stimulated UbC promoter activity 220% over basal activity in L6 muscle cells (P < 0.05 vs. no dexamethasone; Fig. 1A). In contrast, dexamethasone did not stimulate UbC transcription in transfected HepG2 hepatocytes, NRK kidney cells, CaCo2 colon cells, or H9c2 cardiomyocytes (Fig. 1A).


Figure 1
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 1. Dexamethasone induces ubiquitin (UbC) promoter activity in skeletal muscle cells but not other glucocorticoid (GC)-responsive cell lines. HepG2 hepatocytes, NRK kidney cells, CaCo-2 colon cells, and L6 skeletal myocytes were transiently transfected with a human UbC (–930 to +3) promoter-firefly luciferase reporter (A) or the dexamethasone-responsive firefly luciferase reporter plasmid, TAT3-TATA (B). In each experiment, the pTS-RL Renilla luciferase plasmid was cotransfected to assess transfection efficiency. Firefly luciferase activity was normalized for transfection efficiency, and the mean activity in control cells was calculated. This value was then used to calculate the percentage activity for each plate of dexamethasone-treated cells (100 nM, 48 h) relative to untreated, control cells (n = 6 independent transfections/group per experiment). Results in dexamethasone-treated cells are reported as means ± SE of the mean percentage of the activity in control cells and are representative of 3 independent experiments. Note: the scales of the y-axes in the 2 panels are different. The dashed line in each panel indicates 100% of the activity in control cells. B: *glucocorticoids increased luciferase activity at least several hundred fold relative to control in all cell lines.

 
To confirm that the tested cells respond to glucocorticoids, they were transfected with a glucocorticoid-inducible luciferase reporter plasmid, pTAT3-TATA, that contains three glucocorticoid-responsive elements in tandem (4). Dexamethasone increased (P < 0.05) luciferase activity in each cell line (Fig. 1B). Thus the lack of UbC transactivation in nonmuscle cells was not due to an inability of cells to respond to glucocorticoids.

Insulin deficiency increases UbC mRNA in skeletal muscle only. Acute insulin deficiency increases glucocorticoid production, stimulates muscle proteolysis, and increases UbC transcription in muscle in a glucocorticoid-dependent manner (17, 23, 29). To determine whether insulin deficiency increases UbC mRNA in other organs, the level of UbC mRNA was evaluated by Northern blot analysis. With insulin deficiency, UbC mRNA increased 600% (P < 0.05) in skeletal muscle and 150% (P < 0.05) in heart muscle but did not increase in liver, kidney, or intestine of insulin-deficient rats (Fig. 2).


Figure 2
View larger version (40K):
[in this window]
[in a new window]

 
Fig. 2. Insulin deficiency increases UbC mRNA in skeletal muscle. Total RNA was isolated from different organs of control (CTL) and insulin-deficient [streptozotocin (STZ)] rats. Northern blot analysis was performed by using a UbC-specific {alpha}-32P radiolabeled probe. Top: the UbC hybridization autoradiograph and methylene blue-stained 28S ribosomal RNA. Densitometric measurements of UbC mRNA were made, and means ± SE of the percentage of control values (n = 4 pairs) are shown graphically at bottom. The experiment was repeated twice with similar results.

 
Sp1 binds to the UbC promoter. In our earlier experiments with cultured muscle cells, the results of in vitro binding assays suggested that Sp1 can interact with GC-rich sequences in either the rat and human UbC promoter (20). To test the relevance of these findings in a model of muscle atrophy associated with increased glucocorticoid production, we isolated nuclear proteins from control and insulin-deficient rat muscles because we found that glucocorticoids are necessary for increased ubiquitin mRNA expression in muscle of STZ-injected rats (23). We then performed electrophoretic mobility shift assays (EMSA) to evaluate Sp1 DNA binding activity in vitro. A protein in extracts from muscle of control rats formed a complex with a DNA probe corresponding to bases –67 to –30 in the rat UbC gene; two overlapping, putative Sp1 binding sites are present in the sequence (Fig. 3, lane 1 and bottom). The amount of this DNA-protein complex was substantially greater when equal amounts of nuclear proteins from insulin-deficient rat muscle were used (Fig. 3, lane 2). Several results demonstrate that the protein-DNA interaction was specific for the UbC sequence. First, no complex was detected when a 100-fold excess of cold UbC probe was added to the binding reaction (Fig. 3, lane 3). Moreover, when an UbC probe with mutations in both Sp1 binding sites (UbC{Delta}Sp1) was added as competitor DNA, protein binding to the wild-type UbC probe was not diminished (Fig. 3, lane 4). Second, the protein-DNA interaction was prevented by a 100-fold excess of a generic Sp1 competitor probe containing three consensus Sp1 sites; addition of a mutant Sp1 competitor did not prevent protein binding (Fig. 3, lanes 5 and 6, respectively). Finally, when polyclonal anti-Sp1 antibodies were added to the muscle nuclear extract before the EMSA analysis, a supershifted protein-DNA complex was detected (Fig. 3, lane 7). The anti-Spl antibodies also interfered with formation of the DNA-protein complex because the amount of Sp1-DNA complex was reduced (Fig. 3, lane 7). Other antibodies (e.g., anti-NF-{kappa}B p65) did not alter the amount of protein-DNA complex (data shown).


Figure 3
View larger version (48K):
[in this window]
[in a new window]

 
Fig. 3. Insulin deficiency increases the binding of Sp1 to a UbC promoter probe in vitro. Nuclear extracts from skeletal muscles of insulin-deficient (STZ) and pair-fed CTL rats were isolated, and equal amounts of nuclear proteins (1 µg protein) were incubated with a 32P-labeled rat UbC DNA probe (bases –67 to –30, which contain 2 Sp1 sites) before separation by nondenaturing polyacrylamide electrophoresis. Lane 1, nuclear extracts from muscle of pair-fed control rats; lane 2, extracts from muscle of insulin-deficient rats; lanes 3–6, extracts from muscle of insulin-deficient rats plus 100-fold excess of the following competing DNA probes: rUbC, rUbC{Delta}Sp1, consensus Sp1, or mutant Sp1, respectively; lane 7, nuclear extract from muscle of insulin-deficient rats plus anti-Sp1 antibody ({alpha}-Spl). Positions of the free probe (Unbound) and DNA-protein complex (Bound) are indicated at right. The arrow at right indicates the position of the supershifted DNA-protein complex. Results are representative of 3 independent experiments.

 
Sp1 activation occurs only in muscle cells. Sp1 was described originally as a required transcription factor for SV40 viral early promoter activity and has been characterized as a ubiquitous protein that typically participates in the activation of a variety of mammalian genes, including "housekeeping" genes (2). The SV40 viral promoter contains six GC boxes that bind Sp1 but no glucocorticoid response element, making it a useful tool for evaluating general Sp1-mediated transcriptional responses (7, 35). We reasoned that if dexamethasone increases the activity of Sp1, it should stimulate the activity of the SV40 early promoter. Moreover, if the transactivation occurs by a nonspecific mechanism, then dexamethasone should enhance SV40 promoter activity in both muscle and nonmuscle cells. To test these hypotheses, cells were transfected with pGL2-Control, a SV40 early promoter-firefly luciferase reporter plasmid. In L6 muscle cells, dexamethasone (100 nM, 48 h) increased luciferase activity 300% (P < 0.05 vs. no dexamethasone; Fig. 4). In contrast, dexamethasone did not increase luciferase activity in NRK kidney cells, CaCo-2 colon cells, or HepG2 hepatocytes (Fig. 4A). Thus the unidentified mechanism of Spl activation by dexamethasone is specific for skeletal muscle.


Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 4. Glucocorticoids enhance SV40 early promoter activity in a muscle-specific manner. A: HepG2 hepatocytes, NRK kidney cells, CaCo-2 colon cells, and L6 skeletal myocytes were transiently cotransfected with the Spl-responsive SV40 early promoter-firefly luciferase reporter, pGL2-Control, plus the pTS-RL Renilla luciferase control plasmid. Luciferase activities in control and dexamethasone-treated cells (100 nM, 48 h) were measured. The firefly luciferase activity (normalized for transfection efficiency) in untreated control cells was averaged and then used to calculate the percentage activity for each plate of dexamethasone-treated cells. Results in dexamethasone-treated cells are reported as mean ± SE (n = 6 independent transfections/group per experiment) of the mean percentage of the activity in control cells and are representative of 2 independent experiments. B: L6 cells were transfected with pGL2-Control, pTS-RL, and either pEGFP or pGCN-Sp1 encoding enhanced green fluorescence protein (EGFP) or Sp1, respectively. Some cells were treated with dexamethasone (DEX; 100 nM, 48 h) or U-0126 (50 µM, 48 h) as indicated. Results in dexamethasone-treated cells are reported as means ± SE (n = 6 independent transfections/group per experiment) of the mean percentage of the activity in the EGFP-transfected, untreated control cells; results are representative of 2 independent experiments. *P < 0.05 vs. paired treatment control; {ddagger}P < 0.05 vs. the untreated EGFP control. C: L6 cells were either treated with dexamethasone (100 nM, 48 h) or transiently transfected to express Sp1; some cells were treated with 100 nM mithramycin (Mith) for 48 h. Results are reported as means ± SE (n = 6 independent transfections/group per experiment) of the percentage of the activity measured in untreated, control cells and are representative of 2 independent experiments. *P < 0.05 vs. the paired treatment controls.

 
To verify that the SV40 response to dexamethasone was mediated by Sp1, we performed two experiments in L6 cells. First, we tested whether overexpression of Sp1 would augment SV40 promoter-driven luciferase expression. In cells overexpressing Sp1, luciferase activity was significantly increased (Fig. 4B) compared with the luciferase activity measured in cells transfected to express the enhanced green fluorescence protein (EGFP). Dexamethasone also increased luciferase activity in both EGFP- and Sp1-expressing cells, but the increase was much greater in cells ectopically expressing the transcription factor. Interestingly, the MEK1/2 inhibitor U0126 prevented the increase in luciferase induced by glucocorticoids or Sp1. These results are consistent with our previous finding that MEK1/2 mediates the stimulatory effects of dexamethasone on Sp1 (20). In a second experiment, we tested whether inhibiting Sp1 function would attenuate the glucocorticoid-induced increase in SV40-driven luciferase activity. Previously, we found that treating L6 cells with mithramycin, a compound that interferes with Sp1-DNA interactions specifically (12, 13), prevented the increase in UbC promoter activity and ubiquitin protein. As seen in Fig. 4C, the inhibitor significantly diminished the stimulatory responses to either dexamethasone treatment or overexpression of Sp1. Importantly, mithramycin did not affect the induction of luciferase activity from two other glucocorticoid-responsive reporter gene constructs, pTAT3-TATA (4) and the proteasome C3 subunit (9) (data not shown). Hormone responses by these genes are mediated by factors other than Sp1. On the basis of the outcomes of these control studies, we conclude that glucocorticoids increases SV40 promoter activity by enhancing Sp1 activity.

IVGF analysis of the UbC promoter in rat muscle. To evaluate whether Sp1 binds to the UbC promoter in vivo, we performed an IVGF analysis of the UbC promoter region. The basis of this assay is that protein-DNA interactions alter chromatin structure and thus increase or decrease the accessibility of guanine residues to methylation by DMS. When the methylation is performed in vivo, protein-DNA interactions occurring at the chromatin level in living cells or tissue can be detected, and binding occupancy can be assessed. We performed IVGF of both strands of the UbC promoter adjacent to the transcription start site in skeletal muscle of control and insulin-deficient rats. The analysis of the sense strand (i.e., contiguous with the coding strand of mRNA) indicated that several guanine residues between –34 and –62 bp, relative to the start transcription site, were either hypermethylated or hypomethylated in vivo compared with DNA methylated in vitro. Notably, the hypermethylation of the guanine at position –45 was 165% greater in skeletal muscle of STZ-treated vs. pair-fed, control rats (Fig. 5). The hypomethylation pattern between control and insulin-deficient rats did not differ substantially. Notably, many of the observed hypomethylated and hypermethylated guanines, including position –45, were located in two putative overlapping Sp1 binding sites in the UbC promoter. A summary of the sense strand IVGF results is depicted in Fig. 5, bottom.


Figure 5
View larger version (59K):
[in this window]
[in a new window]

 
Fig. 5. Insulin deficiency increases Sp1 binding to the UbC promoter in vivo. Top: anesthetized control and insulin-deficient (STZ) rats were injected with dimethyl sulfate, and genomic DNA was isolated. Results of the in vivo genomic footprinting analysis of the rat UbC gene "sense" strand are shown. Guanine residues are numbered relative to the transcription start site of the rat UbC gene. Bottom: schematic diagram of the rat UbC promoter region from –70 to –34 is shown; putative Sp1 sites are indicated by arrows. Open circles indicate the guanine residues that are hypomethylated in vivo compared with in vitro; closed circles indicate hypermethylated sites. An asterisk indicates the guanine at –45 bp that is more hypermethylated in insulin-deficient rat muscle compared with control rat muscle. Results are representative of 3 independent experiments (n = 1 pair/experiment).

 
IVGF analysis of the opposite strand of the UbC promoter in the region of the Sp1 sites revealed no distinctive methylation pattern in either control or insulin-deficient rat muscle. However, a distinctive footprint would be difficult to detect because there are only two guanine residues in the region of the antisense strand where the potential Spl binding sites are located (data not shown).

In summary, these IVGF results indicate that a GC-rich region located ~50 bp upstream of the start transcription site of the rat UbC promoter is occupied in vivo. Moreover, methylation of the guanine at –45 bp was increased in insulin-deficient rats which have increased glucocorticoid production. These data are indicative of increased binding of Sp1 to the UbC promoter in vivo in muscle of insulin-deficient rats.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In experimental animals and patients with CKD, activation of the UPP system is one of several mechanisms causing muscle atrophy (1, 27). Activation of this proteolytic pathway in muscle is invariably associated with augmented glucocorticoid production and increased expression of ubiquitin (24). In the absence of kidney disease, acidosis and impaired insulin action (i.e., insulin resistance) also increase glucocorticoid production and yield the same proteolytic responses (10, 11, 18, 21, 23, 24, 29, 30). In contrast to skeletal muscle, acidosis and reduced growth factor sensitivity induce hypertrophic growth of the kidney (33, 37). These opposing responses to the same stimuli in muscle and kidney underscore the importance of understanding the regulation of genes like UbC that are involved in protein turnover.

Earlier we reported that glucocorticoids are necessary for the increase in UbC mRNA that occurs in muscle of rats with metabolic acidosis or insulin deficiency (23, 30). The present data provide new insights into the mechanisms that regulate ubiquitin gene expression by demonstrating that glucocorticoids increase transcription of UbC in cultured muscle cells only. Furthermore, in rats with insulin deficiency, a condition characterized by glucocorticoid-dependent UbC transcription (23), UbC mRNA was increased in skeletal muscle and to a limited extent in cardiac muscle but not in other tested organs (Figs. 1 and 2). Results from EMSA, UbC promoter-reporter gene transfection studies in L6 muscle cells, and IVGF experiments in insulin-deficient rat muscle provide specific evidence for involvement of Sp1 in the induction of UbC transcription.

To our knowledge, this is the first report of the IVGF method being used in muscle of anesthetized animals. Our present results prove that this technique can yield highly informative data regarding the genomic sequences that participate in the regulation of specific genes and candidate regulatory proteins that influence their expression. Notably, the results of the rat muscle IVGF analysis are very similar to those obtained with L6 muscle cells (20). Specifically, methylation of the guanine at position –45 was increased to a similar degree by either dexamethasone treatment in L6 muscle cells or by acute insulin deficiency in rat muscle. Moreover, Sp1 interacted in vitro with a DNA probe that contains the same Sp1 sites that were identified in vivo by the IVGF analysis. Thus the data are consistent with increased Sp1 binding to a GC-rich region in the UbC gene immediately upstream of the transcription start site.

Typically, Sp1 is a ubiquitous transcription factor that is involved in the transcription of a variety of housekeeping genes. In some cases, however, Sp1 has been found to be an inducible regulator of gene activity (5, 31). We evaluated the muscle-specific nature of Sp1 activation by using reporter genes driven by either the rat UbC or SV40 promoters; the SV40 promoter has frequently been used to study Sp1 function (7, 35). Only in skeletal muscle cells was the activity of both promoters increased by glucocorticoids.

How do glucocorticoids regulate Sp1 activity? Sp1 can undergo phosphorylation at several sites by a variety of kinases; as with our results, these phosphorylation events frequently occur in a cell-specific manner (5). Earlier, we found that the glucocorticoid-induced increase in UbC transcription in L6 muscle cells required an intact MEK1/ERK signaling pathway (20). Others have reported that ERK-mediated phosphorylation of Sp1 increases its ability to bind DNA (6, 22, 38). Although we did not directly test for Sp1 phosphorylation in our earlier study, the transcription factor was detected as a doublet by Western blot analysis of both cytosolic and nuclear extracts, suggesting that a portion of Sp1 had undergone a posttranslational modification (e.g., phosphorylation). Another mechanism whereby glucocorticoids could modulate the transcription of genes involves interactions between the glucocorticoid receptor and other transcription factors. We believe this possibility is unlikely in muscle because we have found no evidence, either presently or previously (20), indicating that other proteins (e.g., glucocorticoid receptor) interact with Sp1 or its cis-elements in the proximal region of the UbC promoter. In fact, the protein-DNA complexes detected with recombinant Sp1 and endogenous proteins had identical mobilities in our in vitro binding experiments. If other proteins were interacting with Sp1, we would have expected to see mobility differences between recombinant and endogenous Sp1. Thus the available data are consistent with a model in which Sp1 undergoes modification by an effector of the MEK/ERK signaling pathway. The fact that signal transduction pathways can be activated in a cell-specific manner is also in agreement with this hypothesis.

In conclusion, our data prove that mature skeletal muscle responds uniquely to glucocorticoids by increasing UbC transcription in conditions that are associated with muscle atrophy. The results are consistent with the apparent tissue-specific activation of the UPP in skeletal muscle during kidney disease. Further examination of the biochemical mechanisms that activate proteolytic responses in muscle cells might lead to therapeutic approaches that will attenuate excessive muscle wasting in uremia and other catabolic conditions.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-61521 (S. R. Price), DK-63658 (S. R. Price), and DK-37175 (W. E. Mitch).


    ACKNOWLEDGMENTS
 
We thank Dr. James L. Bailey and Bin Zheng for helpful technical assistance.

Some of these data were presented as a poster at the 1999 American Society of Nephrology Meeting, Miami Beach, FL.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. R. Price, Renal Division, Rm. 338 WMB, 1639 Pierce Dr., Emory Univ., Atlanta, GA 30322 (e-mail: medrp{at}emory.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bailey JL, Wang X, England BK, Price SR, Ding X, Mitch WE. The acidosis of chronic renal failure activates muscle proteolysis in rats by augmenting transcription of genes encoding proteins of the ATP-dependent, ubiquitin-proteasome pathway. J Clin Invest 97: 1447–1453, 1996.[Web of Science][Medline]
  2. Briggs MR, Kadonaga JT, Bell SP, Tjian R. Purification and biochemical characterization of the promoter-specific transcription factor, Sp1. Science 234: 47–52, 1986.[Abstract/Free Full Text]
  3. Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass DJ, Shoelson SE. IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell 119: 285–298, 2004.[CrossRef][Web of Science][Medline]
  4. Chen S, Wang J, Yu G, Liu W, Pearce D. Androgen and glucocorticoid receptor heterodimer formation. A possible mechanism for mutual inhibition of transcriptional activity. J Biol Chem 272: 14087–14092, 1997.[Abstract/Free Full Text]
  5. Chu S, Ferro TJ. Sp1: regulation of gene expression by phosphorylation. Gene 348: 1–11, 2005.[CrossRef][Web of Science][Medline]
  6. Chupreta S, Du M, Todisco A, Merchant JL. EGF stimulates gastrin promoter through activation of Sp1 kinase activity. Am J Physiol Cell Physiol 278: C697–C708, 2000.[Abstract/Free Full Text]
  7. Courey AJ, Tjian R. Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55: 887–898, 1988.[CrossRef][Web of Science][Medline]
  8. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475–1489, 1983.[Abstract/Free Full Text]
  9. Du J, Mitch WE, Wang X, Price SR. Glucocorticoids induce proteasome C3 subunit expression in L6 muscle cells by opposing the suppression of its transcription by NF-{kappa}B. J Biol Chem 275: 19661–19666, 2000.[Abstract/Free Full Text]
  10. Du J, Wang X, Miereles C, Bailey JL, Debigare R, Zheng B, Price SR, Mitch WE. Activation of caspase-3 is an initial step triggering accelerated muscle proteolysis in catabolic conditions. J Clin Invest 113: 115–123, 2004.[CrossRef][Web of Science][Medline]
  11. Franch HA, Raissi S, Wang X, Zheng B, Bailey JL, Price SR. Acidosis impairs insulin receptor substrate-1-associated phosphoinositide 3-kinase signaling in muscle cells: Consequences on proteolysis. Am J Physiol Renal Physiol 287: F700–F706, 2004.[Abstract/Free Full Text]
  12. Gambari R, Feriotto G, Rutigliano C, Bianchi N, Mischiati C. Biospecific interaction analysis (BIA) of low-molecular weight DNA-binding drugs. J Pharmacol Exp Ther 294: 370–377, 2000.[Abstract/Free Full Text]
  13. Greenwel P, Inagaki Y, Hu W, Walsh M, Ramirez F. Sp1 is required for the early response of alpha2(I) collagen to transforming growth factor-beta1. J Biol Chem 272: 19738–19745, 1997.[Abstract/Free Full Text]
  14. Ibrahim NM, Marinovic AC, Price SR, Young LG, Froehlich O. Pitfall of an internal control plasmid: response of Renilla luciferase (pRL-TK) plasmid to dihydrotestosterone and dexamethasone. Biotechniques 29: 782–784, 2000.[Web of Science][Medline]
  15. Jones KA, Kadonaga JT, Luciw PA, Tjian R. Activation of the AIDS retrovirus promoter by the cellular transcription factor, Sp1. Science 232: 755–759, 1986.[Abstract/Free Full Text]
  16. Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR, Mitch WE, Goldberg AL. Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J 18: 39–51, 2004.[Abstract/Free Full Text]
  17. Lecker SH, Solomon V, Price SR, Kwon YT, Mitch WE, Goldberg AL. Ubiquitin conjugation by the N-end rule pathway and mRNAs for its components increase in muscles of diabetic rats. J Clin Invest 104: 1411–1420, 1999.[Web of Science][Medline]
  18. Lee SW, Dai G, Hu Z, Wang X, Du J, Mitch WE. Regulation of muscle protein degradation: coordinated control of apoptotic and ubiquitin-proteasome systems by phosphatidylinositol 3 kinase. J Am Soc Nephrol 15: 1537–1545, 2004.[Abstract/Free Full Text]
  19. Marinovic AC, Mitch WE, Price SR. Tools for evaluating ubiquitin (UbC) gene expression: characterization of the rat UbC promoter and use of an unique 3' mRNA sequence. Biochem Biophys Res Commun 274: 537–541, 2000.[CrossRef][Web of Science][Medline]
  20. Marinovic AC, Zheng B, Mitch WE, Price SR. Ubiquitin (UbC) expression in muscle cells Is increased by glucocorticoids through a mechanism involving Sp1 and MEK1. J Biol Chem 277: 16673–16681, 2002.[Abstract/Free Full Text]
  21. May RC, Kelly RA, Mitch WE. Metabolic acidosis stimulates protein degradation in rat muscle by a glucocorticoid-dependent mechanism. J Clin Invest 77: 614–621, 1986.[Web of Science][Medline]
  22. Milanini-Mongiat J, Pouyssegur J, Pages G. Identification of two Sp1 phosphorylation sites for p42/p44 mitogen-activated protein kinases: their implication in vascular endothelial growth factor gene transcription. J Biol Chem 277: 20631–20639, 2002.[Abstract/Free Full Text]
  23. Mitch WE, Bailey JL, Wang X, Jurkovitz C, Newby D, Price SR. Evaluation of signals activating ubiquitin-proteasome proteolysis in a model of muscle wasting. Am J Physiol Cell Physiol 276: C1132–C1138, 1999.[Abstract/Free Full Text]
  24. Mitch WE, Goldberg AL. Mechanisms of muscle wasting: the role of the ubiquitin-proteasome pathway. N Engl J Med 335: 1897–1905, 1996.[Free Full Text]
  25. Mueller PR, Garrity PA, Wold B. Ligation-mediated PCR for genomic sequencing and footprinting. In: Current Protocols in Molecular Biology, edited by Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Boston, MA: Wiley, 1994, p. 15.5.1–15.5.26.
  26. Parks CL, Shenk T. The serotonin 1a receptor gene contains a TATA-less promoter that responds to MAZ and Sp1. J Biol Chem 271: 4417–4430, 1996.[Abstract/Free Full Text]
  27. Pickering WP, Price SR, Bircher G, Marinovic AC, Mitch WE, Walls J. Nutrition in CAPD: serum bicarbonate and the ubiquitin-proteasome system in muscle. Kidney Int 61: 1286–1292, 2002.[CrossRef][Web of Science][Medline]
  28. Ping D, Jones PL, Boss JM. TNF regulates the in vivo occupancy of both distal and proximal regulatory regions of the MCP-1/JE gene. Immunity 4: 455–469, 1996.[CrossRef][Web of Science][Medline]
  29. Price SR, Bailey JL, Wang X, Jurkovitz C, England BK, Ding X, Phillips LS, Mitch WE. Muscle wasting in insulinopenic rats results from activation of the ATP-dependent, ubiquitin proteasome proteolytic pathway by a mechanism including gene transcription. J Clin Invest 98: 1703–1708, 1996.[Web of Science][Medline]
  30. Price SR, England BK, Bailey JL, Van Vreede K, Mitch WE. Acidosis and glucocorticoids concomitantly increase ubiquitin and proteasome subunit mRNAs levels in rat muscle. Am J Physiol Cell Physiol 267: C955–C960, 1994.[Abstract/Free Full Text]
  31. Samson SL, Wong NC. Role of Sp1 in insulin regulation of gene expression. J Mol Endocrinol 29: 265–279, 2002.[Abstract]
  32. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S, Lecker SH, Goldberg AL. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 117: 399–412, 2004.[CrossRef][Web of Science][Medline]
  33. Sooparb S, Price SR, Shaoguang J, Franch HA. Suppression of chaperone-mediated autophagy in the renal cortex during acute diabetes mellitus. Kidney Int 65: 2135–2144, 2004.[CrossRef][Web of Science][Medline]
  34. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M, Yancopoulos GD, Glass DJ. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell 14: 395–403, 2004.[CrossRef][Web of Science][Medline]
  35. Swick AG, Blake MC, Kahn JW, Azizkhan JC. Functional analysis of GC element binding and transcription in the hamster dihydrofolate reductase gene promoter. Nucleic Acids Res 17: 9291–9304, 1989.[Abstract/Free Full Text]
  36. Tiao G, Fagan J, Roegner V, Lieberman M, Wang JJ, Fischer JE, Hasselgren PO. Energy-ubiquitin-dependent muscle proteolysis during sepsis in rats is regulated by glucocorticoids. J Clin Invest 97: 339–348, 1996.[Web of Science][Medline]
  37. Tovbin D, Franch HA, Alpern RJ, Preisig PA. Media acidification inhibits TGFbeta-mediated growth suppression in cultured rabbit proximal tubule cells. Proc Assoc Am Physicians 109: 572–579, 1997.[Web of Science][Medline]
  38. Trisciuoglio D, Iervolino A, Candiloro A, Fibbi G, Fanciulli M, Zangemeister-Wittke U, Zupi G, Del BD. bcl-2 induction of urokinase plasminogen activator receptor expression in human cancer cells through Sp1 activation: involvement of ERK1/ERK2 activity. J Biol Chem 279: 6737–6745, 2004.[Abstract/Free Full Text]
  39. Wing S, Medina R, Goldberg AL, Haas A. Glucocorticoids activate ubiquitin dependent protein degradation in skeletal muscle during fasting. Diabetes 39: 150A, 1990.



This article has been cited by other articles:


Home page
Circ. Res.Home page
J. Herrmann, L. O. Lerman, and A. Lerman
Ubiquitin and Ubiquitin-Like Proteins in Protein Regulation
Circ. Res., May 11, 2007; 100(9): 1276 - 1291.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/2/F660    most recent
00178.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marinovic, A. C.
Right arrow Articles by Price, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marinovic, A. C.
Right arrow Articles by Price, S. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.