Am J Physiol Renal Physiol 292: F956-F965, 2007.
First published October 31, 2006; doi:10.1152/ajprenal.00314.2006

0363-6127/07 $8.00
AQP7 is localized in capillaries of adipose tissue, cardiac and striated muscle: implications in glycerol metabolism
Mariusz T. Skowronski,1,2,*
Janne Lebeck,1,*
Aleksandra Rojek,1,*
Jeppe Praetorius,1
Ernst-Martin Füchtbauer,3
Jørgen Frøkiær,1 and
Søren Nielsen1
1The Water and Salt Research Center, University of Aarhus, Aarhus; 2Department of Animal Physiology, University of Warmia and Mazury, Olsztyn, Poland; and 3Department of Molecular Biology, University of Aarhus, Aarhus, Denmark
Submitted 10 August 2006
; accepted in final form 25 October 2006
 |
ABSTRACT
|
|---|
Aquaporin (AQP7) is expressed in proximal tubules and is involved in glycerol uptake. The cellular expression and physiological function in other organs remain largely undefined. AQP7 knockout (KO) mice were generated and used for immunohistochemical analyses to define the organ and cellular expression of AQP7. AQP7 labeling was found in kidney proximal tubule, heart, skeletal muscle, testis, epididymis, as well as in white and brown adipose tissue (WAT and BAT) of wild-type mice. Importantly, immunoreactivity was completely absent from these tissues in AQP7 KO mice. At the cellular level, the capillary endothelium WAT and BAT displayed prominent staining, whereas AQP7 labeling in adipocyte membranes was undetectable. Double-labeling confocal microscopy revealed coexpression of AQP7 with capillary AQP1 but not with adipocyte GLUT4. Moreover, immunoelectron microscopy and RT-PCR of isolated microvessels confirmed the vascular AQP7 expression. Distinct immunolabeling of the capillary endothelium was also observed in both skeletal and heart muscle with no apparent staining of skeletal or cardiac myocytes. As previously reported, specific immunolabeling was confined to brush border in segment 3 renal proximal tubules and to spermatids and spermatozoa in male reproductive tract. The expression of AQP7 was induced up to 2.2-fold in WAT of mice with streptozotocin-induced diabetes mellitus (S-DM) compared with controls and fasting for 72 h (but not 24 h) induced significant increase in AQP7 expression. In conclusion, AQP7 is expressed in capillary endothelia of adipose tissue (and cardiac and striated muscle) and is upregulated in WAT in response to S-DM supporting its role in glycerol metabolism.
aquaporin; aquaglyceroporin; immunolocalization; immunoelectronmicroscopy
AQUAPORIN 7 (AQP7) (13) belongs to the aquaglyceroporin subgroup of the aquaporin family based on its biophysical characteristics as a channel allowing passage of water and small neutrally charged solutes like urea, glycerol, and purines (13, 14), as well as arsenite (24). It has closest sequence homology with AQP3, AQP9 (14), and AQP10 (9).
In adipose tissue, which is a major site of AQP7 expression (18), the function of AQP7 appears to be related to its ability to allow the passage of glycerol across plasma membranes. AQP7 has also been found in testes (13, 34), epididymis (3), kidney (12, 30), gastrointestinal tract (22), skeletal muscles (37), and inner ear (11), but its function in these organs remains largely unknown. Other aquaporins are often coexpressed with AQP7 in these tissues, and thus, their functions may be redundant.
Recent studies with AQP7 knockout (KO) mice phenotypes demonstrated that AQP7 serves as a glycerol channel in adipose tissue in vivo and that fat-derived glycerol determines the fasting plasma glucose level (26). Others have found that AQP7-deficient mice develop adult-onset obesity. This has been speculated to be due to adipocyte hypertrophy as a result of a defective glycerol exit and consequent accumulation of glycerol and triglycerides (10), or a consequence of increased glycerol kinase activity and thereby an acceleration of triglyceride synthesis in adipocytes (8).
The expression of adipocyte AQP7 mRNA has been shown to be regulated in response to insulin (18). Adipocyte AQP7 expression was upregulated in response to starvation and type I diabetes (19), and similar dysregulation also occurs in type II diabetes (21), which suggests that AQP7 might be a potential causative element in increased gluconeogenesis in obese diabetic humans. Indeed, a study with human lean and obese high-fat consumers showed that the AQP7 gene expression is decreased in adipose tissue of obese with a high-fat intake compared with lean control subjects (27), indicating that AQP7 might be involved in the human susceptibility to obesity. Despite that several studies have been undertaken, the exact cellular and subcellular localization has not been studied in detail. To accomplish this, we generated gene KO mice for AQP7 and used these together with normal mice to disclose the cellular expression of this gene product.
The purposes of this study were 1) to identify the exact tissue localization of AQP7 in mouse different organs by generating gene KO mice lacking AQP7 as negative controls and 2) to investigate the regulation of AQP7 protein in white adipose tissue (WAT) and kidney from fasted mice and mice with streptozotocin-induced diabetes mellitus (S-DM).
 |
MATERIALS AND METHODS
|
|---|
Generation of AQP7 KO mice.
A 5.0-kb DNA fragment was amplified from a 129/Sv strain of mice genomic DNA using primer pair cggtttggtctcgagctagaggtaccCAGGAACTGACCCAGCACATATAC and cgcggttgtctcgagAATCCCAGAACTCCAGAAgctaag, and a 2.8-kb fragment was amplified using primer pair tttccgcggTCCTGTCCCTTACCCTGTTTGAA and attccgcggTGGTGAGCAGTCTTCCTGGATTG (Fig. 1A). The PCR products were individually subcloned into a pCR4-TOPO vector. The 5.0-kb vector arm was purified from pCR4 using XhoI, and the 2.8-kb fragment using SacII and inserted into XhoI site and SacII in a pKO Scrambler1903 vector. The 5.0-kb arm of the targeting vector spans over a part of exon 4, intron 4, and a part of exon 5; the 2.8-kb arm spans over a part of exon 5 and exon 6, 7, and 8 and the joining introns. In the targeted cells, 41 nucleotides in the middle of exon 5 are deleted and substituted by the neomycin phosphotransferase expression cassette. The targeting construct was linearized using NotI and electroporated into CJ7 embryonic stem cells derived from 129/Sv mice (35), maintained on embryonic fibroblasts. G418/ FIAU double-resistant colonies were selected and expanded. Clones with homologous recombination were detected by Southern blot analysis using an external probe flanking the 2.8-kb arm. Clones with the correct recombination event were used for injection into B6D2F2 mouse blastocysts.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1. Outline for generating AQP7 knockout mice. A: schematic representation of the gene targeting strategy shows the wild-type locus, the targeting construct, and homologues recombination in embryonic stem (EC) cells. B: genotyping PCR using a primer set shown by black arrows. C: immunoblot of white adipose tissue protein samples with antibody against AQP7. /, Homozygous; +/, heterozygous; +/+, wild-type mice.
|
|
The chimeric males were bred with C57BL/6 females in a Specific Pathogen Free animal facility. Agouti offspring (indicating germ-line transmission of the manipulated 129/Sv ES cells) was tested for the presence of the disrupted AQP7 allele by PCR with three primers (NEO) gtgctacttccatttgtcacgtcct, (Primer F) CTGCAAAGTGGTTAATGGCACCT and (Primer R) TATCTCGGTGTCAACTTGGGTTTTG using genomic tail DNA. The expected product for the wild-type allele is 810 bp, and for the disrupted allele is 557 bp. The heterozygous mice were further bred to obtain homozygous AQP7 KO mice. The animals used in the study were C57BL/6 x 129/Sv hybrids. The controls for the AQP7 KO mice were AQP7+/+ littermates.
Animal models.
The animal protocols were approved and the license for use of experimental animals issued by the Danish Ministry of Justice. The mice were kept with a 12:12-h artificial light-dark cycle, a temperature of 21 ± 2°C, and humidity of 55 ± 2%, with free access to tap water and were maintained on a standard rodent diet (1,324 pellets, Altromin, Lage, Germany).
For experiment, with S-DM and 24-h fasting, male C57BL/B6 mice were purchased from Harlan Scandinavia (Allerød, Denmark). The mice with an average weight of 25 g were divided into three groups matched for body weight: control (n = 5), 24-h fasting (n = 5), and S-DM (n = 5), or in another experiment into two groups: control (n = 5) and 72-h fasting (n = 5). S-DM was induced by injection of streptozotocin, which displays selective cytotoxicity to the pancreatic
-cells. Food was removed 68 h before the injection, and the mice were anaesthetized with isoflurane and injected intraperitoneally either with streptozotocin (250 mg/kg) dissolved in 0.5 ml vehicle (0.9 mg/ml saline, pH 5.4) for the S-DM group or with vehicle alone for the controls and fasted mice. The inclusion criteria for the mice in the S-DM group was a blood glucose level >15 mmol/l 2 days after the injection, whereas the control group blood glucose levels were <9 mmol/l. The mice were killed 6 days after the injection of streptozotocin. For the fasting group, food was removed 24 or 72 h before death. Tissue samples were taken for immunoblotting and immunohistochemistry. Adipose tissue was taken from the surroundings of epididymis.
Primary antibodies.
Antibodies to mouse AQP7 (RA2900/1246) and AQP1 (RA3391/2353) were previously characterized (30, 36) including demonstration that anti-AQP7 antibody preincubated with the immunizing peptide prevented labeling. In addition, it should be indicated that the antibody specificity is tested in the present study by use of AQP7 KO mice. All polyclonal antibodies were affinity-purified (SulfoLink Kit, Pierce). Goat anti-GLUT4 antibody was purchased from Chemicon International (Temecula, CA). In addition, use of nonimmune IgG (RA2900/1246) revealed absence of brush-border labeling of segment 3 proximal tubules in kidney sections.
SDS-PAGE and immunoblotting.
The tissues were immediately placed in ice-cold dissection buffer (0.3 M sucrose, 25 mM imidazol, 1 mM EDTA in ddH2O, pH 7.2, containing 8.4 µM leupeptin, 0.4 mM pefabloc). After dissection, the tissue samples were homogenized using an ultra Turrax T8 homogenizer (IKA Labortechnik, Staufen, Germany) and centrifuged at 4,000 g for 15 min at 4°C. The supernatant added was SDS-containing sample buffer giving a final concentration of 62 mM Tris (hydroxymethyl)-aminomethane, 0.1 M SDS, 8.7% glycerol, 0.09 mM bromophenol blue, and 0.04 M dithiothreitol (DTT), pH 6.8. The protein samples were heated for 5 min at 90°C and stored at 20°C until use.
The samples were heated to 37°C and loaded into 12% polyacrylamide gels and proteins were separated by electrophoresis. For semiquantification, the total protein amount in each sample was adjusted by staining with Gelcode Coomassie Blue Stain Reagent (Bie and Berntsen A/S, Åbyhøj, Denmark) to ensure equal loading. The proteins of subsequent gels were electro-transferred onto nitrocellulose membranes (Hybond ECL RPN3032D, Amersham Pharmacia Biotech, Little Chalfont, UK) for 1 h at 100V. The membranes were blocked with 5% milk in PBS-T (80 mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl, pH 7.5 and 0.1% vol/vol Tween 20) for 1 h. After being washed, the membranes were incubated overnight at 5°C with anti-AQP7 antibody.
The membranes were washed and incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibody (Dako A/S, Glostrup, Denmark) in PBS-T for 1 h. After being washed with PBS-T, bound antibody was detected by ECL chemiluminescence kit (Amersham Bioscience). The luminescence was detected on a light sensitive Hyperfilm (Amersham Bioscience). Semiquantification of the immunoreactive proteins was performed using a scanner (Duoscan f40, Agfa, Glostrup, Denmark) and Scion Image software (www.scioncorp.com) after background subtraction. The band intensities were measured within the linear range.
Immunohistochemistry.
Tissues were fixed by retrograde perfusion via the aorta with 3% paraformaldehyde, in 0.1 M cacodylate buffer, pH 7.4 (7). For preparation of paraffin-embedded tissue sections (2-µm thickness), tissues were dehydrated in ethanol followed by xylene and finally embedded in paraffin. The staining was carried out using either indirect immunofluorescence or indirect immunoperoxidase. The sections were dewaxed and rehydrated. For immunoperoxidase labeling, endogenous peroxidase was blocked by 0.5% H2O2 in absolute methanol for 10 min at room temperature. To reveal antigens, sections were submerged in 1 mM Tris solution (pH 9.0) supplemented with 0.5 mM EGTA and heated in a microwave oven at 650 W for 6 min and then at 350 W for 10 min as described previously (7, 30). After the treatment, sections were left for 30 min in the buffer for cooling. Nonspecific binding of IgG was prevented by incubating the sections in 50 mM NH4Cl for 30 min, followed by blocking in PBS supplemented with 1% BSA, 0.05% saponin, and 0.2% gelatin. Sections were incubated overnight at 4°C with primary antibodies diluted in PBS supplemented with 0.1% BSA and 0.3% Triton X-100. The sections were rinsed with PBS supplemented with 0.1% BSA, 0.05% saponin, and 0.2% gelatin and then incubated with horseradish peroxidase-conjugated secondary antibody (P448, 1:200, DAKO). Labeling was visualized by 0.05% 3,3 diaminobenzidine tetrahydrochloride (DAB).
Fluorescence techniques were employed for double-labeling tissues. After overnight incubation with anti-AQP7 antibody as described above, the sections were incubated with fluorescent secondary antibody (goat anti-rabbit antibodies AlexaFluor 546, Molecular Probes). After being washed (PBS for 3 x 10 min), sections were incubated overnight with a biotinylated anti-AQP1 antibody, and the immunoreactivity was visualized using streptavidine FITC (Dako). For AQP7/GLUT4 double labeling, the primary antibodies (rabbit anti-AQP7 and goat anti-GLUT4) were both present during the overnight incubation. After being washed, the sections were stained simultaneously with two secondary antibodies (donkey anti-rabbit AlexaFluor 488 and donkey anti-goat AlexaFluor 546). After being rinsed with PBS for 3 x 10 min, the sections were mounted in glycerol supplemented with antifade reagent (N-propyl-galat). The microscopy was carried out using a Leica DMRE light microscope and a Leica TCS-SP2 laser confocal microscope (Heidelberg, Germany).
Immunoelectron microscopy.
Tissue was prepared by freeze substitution and subjected to immunoelectron microscopical analysis as described previously (6, 15). Briefly, ultrathin Lowicryl HM20 sections were incubated overnight at 4°C with anti-AQP7 antibodies and visualized with goat anti-rabbit IgG conjugated to 10-nm colloidal gold particles at 1:50 (GAR.EM10; BioCell Research Laboratories, Cardiff, UK). Sections stained with uranyl acetate and lead citrate were examined with a Philips CM100 or Philips Morgagni electron microscope (Philips, Eindhoven, The Netherlands).
Microisolation of vessels from fat tissue.
Mice were anesthetized with isoflurane and the fat tissue was removed and placed in ice-cold isolation buffer (140 mM K+-gluconate, 10 mM NaCl, 1 mM MgCl2, 2 mM CaCl2, 10 mM KOH-HEPES, 41 mM sucrose, and 0.1 mg/ml DNase, 1 mg/ml collagenase, and 1 mg/ml dispase, pH 7.5). The tissue was then cut into
1-mm3 pieces and added 2 ml isolation buffer preheated to 37°C. The fat tissue suspension was left at 37°C in a shaking chamber while being top-gassed with 100% oxygen. To help dissolve the tissue, the suspension was gently mixed by pipetting every 10 min. After 30 min, the adipocytes were largely lysed and the suspension was centrifuged to remove fat. The suspension was then placed in a small Petri dish and the arterioles and capillaries were isolated under a Leica MZ 125 dissection stereomicroscope. The isolated vessels were washed twice in isolation buffer before collecting for either immunoblotting or RT-PCR. The vessels collected for immunoblotting were sonicated for 30 s and then mixed with SDS-containing sample buffer.
RT-PCR.
Total RNA from fresh tissues was extracted using RNeasy Mini Kits (Qiagen, Germantown, MD). After DNase-treatment (RQ1 RNase-Free DNase, Promega, Madison, WI), the RNA was reverse transcribed using 2 U/µl Reverse Transcriptase (Superscript II, Invitrogen, Taastrup, Denmark) in the presence of poly-T primers. RT products were stored at 20°C until required. Primers were designed to amplify specifically AQP7 transcript: a sense primer (5'-ATGGTGTTTGGCCTTGGTTCCG-3') and an antisense primer (5'-AGGTCACGGGATGGGTTGATTG-3'). PCR (30 cycles) was performed (HotStarTaq Master Mix, Qiagen) with 1020% cDNA and 1 pmol of each primers: hot-start at 95°C for 15 min, denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and elongation at 72°C for 1 min. Negative controls were performed including omission of reverse transcriptase or omission of cDNA. PCR for
-actin was performed to validate each batch of template before use. PCR products were separated by 2% agarose gel electrophoresis and the products were photographed under ultraviolet illumination.
Plasma/urine measurements.
The blood glucose measurement was performed using Accu-Chek Sensor (Roche) by snipping the tail. For other tests the mice were anesthesized and blood samples were collected from the right ventricle of the heart and plasma was analyzed for glycerol and free fatty acids (FFA). The FFA was measured by NEFA C KIT from Wako Chemicals GmbH, detected by Elisa reader at 540 nm. Twenty-four-hour urine samples were obtained by placing the mice in metabolic cages. The urine osmolality was measured by The Advanced Osmometer (model 3900, Advanced Instruments).
Statistics.
Data are expressed as means ± SE. Statistical analysis between groups was made by one-way ANOVA with Tukey-Kramer multiple comparisons test or by unpaired t-test. P values <0.05 were considered statistical significant.
 |
RESULTS
|
|---|
Generation of AQP7 total-KO mice.
AQP7 gene KO mice were generated as described in MATERIALS AND METHODS. The agouti offspring (indicating germ-line transmission of the manipulated 129/Sv ES cells) was tested for the presence of the disrupted AQP7 allele by PCR with three primers (see MATERIALS AND METHODS) using genomic tail DNA. The expected product for the wild-type allele is 810 bp, and for the disrupted allele is 557 bp. The heterozygous mice were further bred to obtain homozygous AQP7 KO mice (Fig. 1A). Mice that are heterozygous or homozygous for AQP7 allele are fertile and do not display any physical or behavioral abnormalities. Immunoblotting of WAT protein extracts from AQP7+/+, AQP7+/, and AQP7/ mice with anti-AQP7 antibody (RA2900/1246) confirmed the presence of AQP7 in AQP7+/+ and AQP7+/, but absence of AQP7 expression in AQP7/ mice (Fig. 1C).
Functionally, AQP7/mice exhibit severe loss of glycerol in urine (see
Table 2) with negligible renal loss from heterozygous, consistent with previous studies in AQP7 gene KO mice generated in other laboratories (33). Under basal conditions, there were no significant changes in the blood glucose, FFA, and glycerol level between the genotypes (Table 1). After 24-h fasting, there were no significant differences in the plasma parameters between the genotypes (Table 2).
Localization of AQP7 in mouse tissues.
Immunohistochemical analysis was performed on multiple mouse organs by use of an antibody against a peptide corresponding to the COOH-terminal part of mouse AQP7, to investigate the distribution of AQP7. The following tissues were investigated: WAT, BAT, kidney, skeletal muscle, heart, liver, testis, epididymis, omenta, mesentery, diaphragm, small intestine, and colon. The analysis revealed specific labeling only in WAT, BAT, kidney, muscle, heart, testis, and epididymis. AQP7 KO mouse tissues were used as negative controls and failed to stain with the antibody.
Localization of AQP7 in adipose tissue.
Figure 2 shows the localization of AQP7 at light microscopical level in the WAT and BAT. Interestingly, the anti-AQP7 antibody only revealed prominent labeling in small vessels of WAT, whereas labeling was undetectable in the plasma membrane domains of adipocytes (Fig. 2, A and B), suggesting either low or absence of expression. An identical labeling pattern was observed in interscapular BAT (Fig. 2, A and C) and in BAT from the hilus of the kidney (not shown). WAT (Fig. 2, D and E) and BAT (Fig. 2, D and F) from AQP7/ mice did not exhibit any immunoreactivity. Distinct histological abnormalities of the tissue structures were not observed, consistent with previous findings (26). Immunoblotting with the anti-mouse AQP7 antibody recognized a 25-kDa band in both WAT (Fig. 2G) and BAT (Fig. 2H) from AQP7+/+ mice.

View larger version (93K):
[in this window]
[in a new window]
|
Fig. 2. AQP7 expression in white adipose tissues (WAT) and brown adipose tissues (BAT). Immunohistochemical staining of AQP7 in paraffin-embedded sections of the WAT and BAT from AQP7+/+ (A-C) and AQP7/ (D-F) mice. Anti-AQP7 antibody labels small capillaries of WAT and BAT in normal mice (A-C). The staining is absent in AQP7 knockout mice (D-F). Bar indicates 50 µm. Western blot analysis of AQP7 protein expression (G and H). Anti-mouse AQP7 antibody recognizes a 25-kDa band in membrane fractions from mouse WAT (G) and BAT (H). Arrows indicate localization of WAT and arrowheads indicate localization of BAT.
|
|
Further microscopical analyses were performed to verify the unexpected capillary expression of AQP7 and the apparent absence from adipocytes. AQP1 is a suitable marker of the plasma membranes of capillaries (28). Thus fluorescence double labeling for AQP1 and AQP7 was employed to determine the localization of AQP7 relatively to these vessels. As shown in Fig. 3A, the AQP1 antibody strongly labeled the small vessels of WAT (green). The anti-AQP7 antibody showed a similar localization pattern within WAT (red; Fig. 3B). As shown in Fig. 3, C and D, the double immunolabeling of AQP1 and AQP7 revealed a high degree of colocalization of the two proteins in the capillaries of mouse WAT.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 3. Representative immunofluorescence confocal microscopical images of AQP7 and AQP1 localization in mouse adipose tissue (A-D). Adipose tissues were stained for AQP1 (green) to mark the capillaries (A). Note that the weak staining found within the connective tissues of WAT with the AQP1 antibody may constitute binding of streptavidine to endogenous biotin. The localization pattern of AQP7 (red) in the same region of adipose tissue (B). The 2 fluorescence images were merged to reveal the colocalization (yellow) of AQP1 and AQP7 (C). The fluorescence images were overlaid onto the corresponding differential interference contrast image to localize these signals to the structural components of the tissue (D). Bar represents 15 µm. Representative images from immunofluorescence confocal microscopical analysis of AQP7 and GLUT4 localization in mouse white adipose tissue (E-G). Adipose tissue was stained for AQP7 (green; E) and GLUT4 (red; F). The 2 fluorescence images (G) were merged to investigate the localization of AQP7 (green) and GLUT4 (red). Arrows indicate localization of the capillaries. AQP7 expression in vessels isolated from adipose tissue (H and I). Immunoblotting for AQP7 protein (H) in vessels isolated from adipose tissue (Ves), adipose tissues (Adi), and kidney (Kid). RT-PCR was performed on total RNA (I) from isolated vessels of adipose tissue (Ves), adipose tissue (Adi), and kidney (Kid).
|
|
GLUT4 is expressed by adipocytes, and double immunofluorescence labeling for AQP7 (green) and GLUT4 (red) was performed to confirm the predominant nonadipocyte localization of AQP7 (Fig. 3, E, F, and G). As Fig. 3E shows, anti-AQP7 antibody labeling seems confined to small vessels of WAT, whereas GLUT4 labeling is found to the plasma membrane domain and thin rim of cytoplasma of adipocytes (Fig. 3F) consistent with previous findings (16). The overlay of AQP7 and GLUT4 labeling patterns confirmed the dissimilar localization of these proteins in the mouse WAT (Fig. 3G). These findings support that our antibody labels an AQP7 protein localized in the microvessels of WAT.
To further this finding, abdominal WAT was subjected to immunoblotting and RT-PCR analysis for the presence of AQP7 in blood vessels. As shown in Fig. 3H, AQP7 was expressed in the isolated vessels as well as in adipose tissue. A 25-kDa band of AQP7 protein was present in both above-mentioned tissue samples, as well as in kidney (positive control). RT-PCR analysis, performed with AQP7-specific primers, yielded
500-bp DNA product in the isolated vessels, WAT, and kidney (Fig. 3I). A positive product for actin primers was observed in all samples studied (not shown). The signal from samples of isolated vessels appears relatively weak compared with control tissues.
Finally, the subcellular distribution of AQP7 in capillaries was determined by immunogold electron microscopy. The analysis confirmed AQP7 localization in capillary endothelia of mouse WATs (Fig. 4, A, B, and C). Both apical and basolateral plasma membranes including caveolae exhibit AQP7 labeling (Fig. 4, B and C). Thus the capillary localization was demonstrated in wild-type mice by three immunological and one mRNA-based method and was absent in AQP7 gene KO mice. The expression of AQP7 was undetectable in adipocyte by the same methods.

View larger version (110K):
[in this window]
[in a new window]
|
Fig. 4. Immunoelectron microscopic localization of AQP7 in an ultrathin Lowicryl section of a periepididymal WAT capillary. Both apical and basal plasma membranes including caveolae exhibit labeling (arrows). Magnification: x14,000 (A), x28,000 (B, C). L, lumen; TJ, tight junction.
|
|
Localization of AQP7 in kidney.
Figure 5 shows localization of AQP7 at a light microscopic level in the kidney. Consistent with previous observations (12, 30), the anti-AQP7 antibody strongly labels segment 3 of proximal tubules in AQP7+/+ mice (Fig. 5, A and B), whereas no other structures of the kidney were stained. Kidney sections from the AQP7/ mice did not stain with the antibody (Fig. 5, C and D). Histological abnormalities were absent from the AQP7/ kidneys by comparison of the two genotypes.

View larger version (117K):
[in this window]
[in a new window]
|
Fig. 5. Immunohistochemical staining of AQP7 in paraffin-embedded sections of the kidney from AQP7+/+ (A and B) and AQP7/ (C and D) mice. Anti-mouse antibody labels the brush border in segment 3 in the proximal tubule in mouse kidney (A and B). The AQP7 knockout mice did not stain with the antibody (C and D). Bar indicates 50 µm.
|
|
Localization of AQP7 in striated and cardiac muscle capillaries.
Immunohistochemical analysis of striated muscle was also performed. In skeletal muscle, AQP7 was localized to the capillary network between the skeletal muscle fibers as seen in both longitudinal sections (Fig. 6A) and cross sections (Fig. 6C). There was no staining in skeletal myofibers or in larger vessels. In cardiac muscle, immmunohistochemistry showed a specific staining for AQP7, but like in skeletal muscle, it was localized to small vessels of the muscle (Fig. 6E). No staining was observed in cardiac myocytes. Skeletal muscle sections (Fig. 6, B and D) and cardiac muscle sections (Fig. 6F) from the AQP7/ mice did not label with the antibody. There were no histological abnormalities of the skeletal muscle and cardiac muscle structures of the AQP7/ mice. Immunoblotting analysis showed a weak 25-kDa band in skeletal muscle from AQP7+/+ mice compared with kidneys from the same mice (Fig. 6G). Skeletal muscle tissues from AQP7/ mice did not present immunoreactive proteins by immunoblotting.

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 6. Immunohistochemical staining of AQP7 in paraffin-embedded longitudinal and cross sections of the skeletal muscle fibers from AQP7+/+ (A and C) and AQP7/ (B and D) mice. The immunoperoxidase staining is only localized to the small vessels of muscle of wild-type mice (A and C). Immunohistochemical staining of cardiac muscle fibers in longitudinal sections from AQP7+/+ (E) and AQP7/ (F) mice. Anti-AQP7 antibody labels small vessels (arrows) of the muscle in control mice (E). AQP7 staining was not detected in AQP7 knockout mice (F). Bar indicates 50 µm. Western blot analysis of AQP7 expression (G). Anti-mouse AQP7 antibody recognizes a 25-kDa band in membrane fractions from mouse muscle and kidney in wild-type mice (+/+) but not in AQP7 knockout mice (/).
|
|
Localization of AQP7 in male reproductive tract.
In testis, AQP7 immunoreactivity was confined to the inner surface area that surrounds spermatids and spermatozoa, as well as in spermatids and spermatozoa tails (Fig. 7, A and B). In epididymis, AQP7 was also localized to the tail of spermatozoa (Fig. 7, E and F). Immunoreactivity was absent from testis sections (Figs. 3C and 7D) and epidydymis sections (Figs. 3H and 7G) from the AQP7/ mice. The AQP7/ mice did not display histological abnormalities of the testis and epididymis compared with controls.

View larger version (83K):
[in this window]
[in a new window]
|
Fig. 7. Immunohistochemical staining of AQP7 in paraffin-embedded sections of the testis from AQP7+/+ (A and B) and AQP7/ (C and D) mice and epididymis from AQP7+/+ (E and F) and AQP7/ mice (G and H). Tail of spermatids and spermatozoa display immunoreactivity (A, B, E, and F). The staining is absent in AQP7 knockout mice (C, D, G, and H). Bar indicates 50 µm.
|
|
Experimental S-DM and fasting in male mice.
The influence of S-DM and 24-h fasting on AQP7 expression in adipose tissue and kidney was evaluated by semiquantitative immunoblotting (Fig. 8, A and B, respectively). In the adipose tissue, S-DM induced a more than twofold increase in AQP7 expression compared with control mice (P < 0.05, n = 4 control, n = 3 S-DM). However, in the fasted group, 24-h fasting induced only a slight increase in AQP7 expression in adipose tissue compared with control group (not significant; Fig. 8A). In contrast, there were no changes in the renal AQP7 expression between the studied groups (not significant, n = 4). On the day of death, the average plasma glucose levels for control, S-DM, and fasted group were 8.7 ± 0.2, 30.6 ± 1.1, and 4.4 ± 0.4 mmol/l, respectively. This confirmed that the animals were adequately affected by the protocol. Immunoperoxidase microscopy for AQP7 staining supported these results (Fig. 8, C, D, and E). The AQP7 expression apparently increased of in the adipose tissue of S-DM mice (Fig. 8D) compared with controls, whereas the adipose tissue from the fasted mice (Fig. 8E) displayed no or only a slight increase in AQP7 expression (Fig. 8A). The images also revealed a marked decrease in the size of most of the adipocytes in the adipose tissue from S-DM mice, whereas there were no differences in the apparent size of the adipocyte structures from fasted animals compared with controls.

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 8. Regulation of AQP7 protein abundance in streptozotocin-induced diabetes mellitus (S-DM) and after 24-h starvation. Semiquantitative immunoblotting was performed for AQP7 in adipose tissue (A) and kidney (B). *P < 0.05. Immunoperoxidase microscopy was performed on adipose tissue taken from the periepididymal fat. Representative images of AQP7 labeling in fat tissue in various metabolic states. The AQP7 labeling in adipose tissue from control mouse (C), S-DM mice (D), and fasted mice (E). Bars indicate 50 µm. Arrows indicate localization of the capillaries.
|
|
In another experiment, mice were fasted for 72 h to determine whether prolonged starvation influence AQP7 expression in WAT and kidney (Fig. 9, A and B). Semiquantitative immunoblotting showed a twofold increase in WAT AQP7 protein level in the 72-h fasted mice compared with control mice (P < 0.01, n = 4). There were no statistically significant changes in AQP7 protein abundance in kidney between the studied groups (not significant, n = 4). Furthermore, immunohistochemical findings supported the apparent increased immunoreactivity (Fig. 9, C and D). Interestingly, even prolonged fasting had no evident effect on adipocyte size in normal or AQP7 KO mice.

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 9. Regulation of AQP7 protein abundance after 72-h starvation. Semiquantitative immunoblotting was performed for AQP7 in periepididymal white adipose tissue (A) and kidney (B). **P < 0.01. Representative images of AQP7 labeling in fat tissue. Immunoperoxidase labeling for AQP7 was performed on adipose tissue taken from the periepididymal white fat from control mouse (C) and fasted mice (D). Bars indicate 50 µm. Arrows indicate localization of the capillaries.
|
|
 |
DISCUSSION
|
|---|
In the present study, AQP7 KO mice were generated and employed as a negative control in immunohistological studies to clarify the tissue expression profile of AQP7. We found AQP7 to be expressed in several mouse tissues including adipose tissue, renal proximal tubules, skeletal and cardiac muscle as well as in testis and spermatozoa cells. Furthermore, the abundance of AQP7 in adipose tissue was regulated in response to experimentally induced diabetes mellitus and fasting.
AQP7 in adipose tissues.
Adipocytes are highly metabolically active and receive a rich supply of blood vessels. Triglycerides in the adipocytes are hydrolyzed to glycerol and FFA by hormone-sensitive lipase and adipose triglyceride lipase. Once liberated inside the adipocyte, FFA and glycerol have to cross the adipocyte plasma membrane, traverse the interstitial adipose tissue and cross the endothelial barrier to enter the blood stream. Several membrane proteins have been identified that are involved in FFA transport (32), whereas only one protein candidates as the major transporter for glycerol. Expression of AQP7 in adipocytes was initially demonstrated by Kishida et al. (18). Recent in vitro and in vivo studies with use of two independent mouse lines lacking of AQP7 ascertained that AQP7 is a principal channel required for the release of glycerol from adipose tissue (8, 10, 26) (reviewed in Refs. 5, 25). However, the studies did not show exact tissue localization of the AQP7 protein.
The current study demonstrates that AQP7 is primarily expressed in the capillary endothelium of WAT and, unexpectedly, that no detectable AQP7 is expressed in the adipocytes using immunohistochemistry and immunoelectron microscopy. Furthermore, we confirmed the vascular localization of AQP7 by immunoblotting and RT-PCR analysis on vessels isolated from the adipose tissues. It should be noted that the loaded amount of protein or mRNA was not equal in the lanes, because very little material was obtained from the microisolated vessels. Furthermore, immunoreactivity of endothelia was restricted to capillary endothelium and was absent in larger vessels (by immunohistochemistry, not shown). It is not surprising that the signal is relatively weak in isolated vessels, bearing in mind that more protein and RNA in the samples arose from small arteries and veins relatively to the capillaries.
The possibility has been raised that certain aquaporins exist in more than one isoform. Li et al. showed differences in localization of various aquaglyceroporin AQP10 transcripts in human small intestine in the capillary endothelium in villi and in the gastro-entero-pancrestic endocrine cells, respectively, by immunohistochemistry and immunoelectron microscopy (23). Moreover, RT-PCR, revealed the amplification of two fragments of 224 and 697 bp from duodenum and jejunum indicating the transcription of both AQP10 isoforms. However, at present there is no evidence pointing to more than one AQP7 transcript.
Since our antibody has been raised against a peptide corresponding to the COOH-terminal part of mouse AQP7, it is reasonable to speculate that one of AQP7 isoform, found here, is present in the capillaries of adipose tissues and that another isoform with a different COOH terminus may serve as glycerol channel in the adipocyte plasma membrane.
AQP7 in the kidney.
In a previous communication from this laboratory, immunohistochemical analysis revealed strong AQP7 labeling of segment 3 of murine renal proximal tubules (30) which was later confirmed (12). We currently confirm this renal labeling pattern which is confined to the brush border of proximal tubules. Recent studies have proven AQP7 to be a major glycerol reabsorbing pathway in the proximal straight tubules, since AQP7 KO mice develop marked glyceroluria with no apparent change in urea metabolism (33). However, plasma glycerol level was affected only to a minor extend in AQP7 gene KO. The possible significance of renal AQP7 in glycerol homeostasis is addressed below in the context of the models of metabolically challenged mice.
AQP7 in muscles.
In the present study, we demonstrated the AQP7 expression in the capillary network of skeletal muscle as well as in the capillaries of cardiac muscle. AQP7 has not been studied as extensively in skeletal muscle and heart as in adipose tissue. However, Kishida et al. (18) showed AQP7 mRNA expression in mouse skeletal muscle and recently, an immunohistochemical study using anti-AQP7 antibody showed immunoreactivity at the myofiber surface of type 1 and type 2 fibers in human muscles and of type 2 fibers in mouse muscles (37). In the present study, no staining of myofibers was observed. Again, we cannot exclude the existence of multiple variants in muscle as e.g.. truncated AQP7 forms, but the application of AQP7/ mice as negative controls strongly supports the vascular expression of the protein.
The AQP7 mRNA expression in the heart has been demonstrated previously (20, 30, 38) and later confirmed (1). However, this is the first report of the cellular and subcellular localization of AQP7 within the heart and the results reveal that the cellular and subcellular expression is quite similar to that of adipose tissue and skeletal muscle. AQP7 has been shown to be a major glycerol channel in adipose tissue so, at least theoretically, it should play a similar role in here. However, in addition to AQP7, another aquaglyceroporin, AQP3, is expressed in skeletal muscle and heart. Wakayama et al. (38) showed localization of AQP3 in normal human skeletal muscle. The immunoreaction for the anti-AQP3 antibody was noted at the inside surface of muscle plasma membrane. Low AQP3 levels were also detected in human skeletal and cardiac muscle (29). It may be that the two proteins serve similar purposes in these tissues.
Glycerol released into the systemic circulation is utilized mainly by the liver, although kidney and muscle also take up glycerol. Although lipolysis primarily occurs in adipose tissue, other tissues, notably muscle are known to contribute. It is still unclear why AQP7 is expressed in the capillaries of striated muscles, although it may be speculated that it could serve as an entry and/or exit pathway for glycerol or other solutes/metabolites. Thus further studies using AQP7 KO mice might be helpful.
AQP7 in spermatocytes.
Sperm are produced in testes and transported out via an extensive and complex array of tubules collectively referred to as the excurrent duct systems where in its epididymal region mature and are concentrated by fluid resorption. There are several reports describing the expression of AQP7 in mouse (30), rat (2, 13, 17, 30, 34), and human (31) male reproductive tract.
In the present study, we showed the presence of AQP7 in the surroundings of mouse spermatids and in their tails as well as in testicular and epipidymal spermatozoa tails. Saito et al. (31) demonstrated by immunohistochemistry similar labeling pattern in human testes and ejaculated sperm. They suggested that a lack of AQP7 expression in sperm may be an underlying mechanism of male infertility. Several others proteins have been shown to be associated with spermatozoa suggesting a role in sperm maturation and/or sperm-egg interactions (4). However, our male mice lacking AQP7 are fertile and their sperm cells show normal motility. We suggest that the presence of AQP7 in spermatozoa cells have no or an insignificant role in sperm-egg interactions, since the AQP7 KO genotype female and male mice have been fertile.
The lack of phenotype in the absence of AQP7 in spermatids and spermatozoa of mouse does not exclude a potential role for the protein in concentrating the sperm and in promoting sperm maturation, since the defect may have been fully compensated by other mechanisms.
Experimental S-DM and fasting in male mice.
In the present study, we demonstrate that AQP7 protein abundance in capillaries of WAT increases in response to both diabetes mellitus and prolonged fasting, whereas AQP7 labeling in adipocyte membranes was still undetectable. Several studies have reported changes in AQP7 at mRNA level during insulin-resistant state and starvation. Kishida et al. (18) demonstrated an increase in AQP7 mRNA expression after fasting and decrease with refeeding and suppressed role of insulin in the amount of AQP7 mRNA in adipose tissue. The authors concluded that sustained upregulation of AQP7 mRNA in adipose tissue in the insulin-resistant condition may disturb glucose homeostasis by increasing plasma glycerol. The study performed by Kuriyama et al. (21) indicated that the gene expressions of AQP7 and AQP9 were regulated coordinately by the plasma concentrations of insulin in accordance with the nutritional condition, such as fasting and refeeding. Like other insulin-responsive genes, AQP7 is downregulated by insulin via an insulin-responsive element in the promoter, whereas pioglitazone, a PPAR
ligand, increases the adipocyte AQP7 expression via a peroxisome proliferator response element (20). This regulation is believed to induce an increase in the plasma glycerol level, by release from the adipocytes, during starvation or exercise for gluconeogenesis in the liver (19, 21). A homozygous human subject, with a G264V mutation in the AQP7 gene that abolishes the ability to transport glycerol, showed no exercise-induced increase of plasma glycerol level (20).
Our AQP7 KO mice did not show a significant difference in serum glycerol level in basal and in starved conditions, consistent with previous observations (8, 33). On the contrary, Maeda et al. (26) recently reported that AQP7 KO mice had lower plasma glycerol levels compared with wild-type mice. We also demonstrated severe loss of glycerol in urine in AQP7 KO mice, consistent with previous observation performed by Sohara et al. (33). The authors suggested that glyceroluria in AQP7 KO mice was not due to a change in plasma glycerol levels but was due to the reduction or the elimination of the glycerol reabsorption pathway in the kidney.
Our findings for the first time demonstrate a regulation of AQP7 protein in capillaries of WAT after starvation and insulin deficiency. However, further studies are necessary to investigate how the possible adipose AQP7 isoformes cooperate during different metabolic stages in mice.
 |
GRANTS
|
|---|
The Water and Salt Research Center at the University of Aarhus is established and supported by the Danish National Research Foundation (Danmarks Grundforskningsfond). Support for this study was provided by the Nordic Centre of Excellence Program in Molecular Medicine: WIRED, Karen Elise Jensen Foundation, Human Frontier Science Program Organization, Novo Nordic Foundation, Danish Medical Research Council, University of Aarhus Research Foundation, and European Commission (QRLT 2000 00778 and QRLT 2000 00987).
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank I. M. Paulsen, H. Høyer, L. V. Holbech, I. M. Jalk, P. M. Kragh, Z. Nikrozi, M. Vistisen, and L. V. Nielsen for expert technical assistance and A. C. Füchtbauer for advice and technical assistance.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: S. Nielsen, The Water and Salt Research Center, Institute of Anatomy, Univ. of Aarhus, DK-8000 Aarhus C, Denmark (e-mail: sn{at}ana.au.dk)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* M. T. Skowronski, J. Lebeck, and A. Rojek contributed equally to this work. 
 |
REFERENCES
|
|---|
- Butler TL, Au CG, Yang B, Egan JR, Tan YM, Hardeman EC, North KN, Verkman AS, Winlaw DS. Cardiac aquaporin expression in humans, rats, and mice. Am J Physiol Heart Circ Physiol 291: H705H713, 2006.[Abstract/Free Full Text]
- Calamita G, Mazzone A, Bizzoca A, Svelto M. Possible involvement of aquaporin-7 and -8 in rat testis development and spermatogenesis. Biochem Biophys Res Commun 288: 619625, 2001.[CrossRef][ISI][Medline]
- Da SN, Silberstein C, Beaulieu V, Pietrement C, Van Hoek AN, Brown D, Breton S. Postnatal expression of aquaporins in epithelial cells of the rat epididymis. Biol Reprod In press.
- Evans JP. Getting sperm and egg together: things conserved and things diverged. Biol Reprod 63: 355360, 2000.[Free Full Text]
- Fruhbeck G. Obesity: aquaporin enters the picture. Nature 438: 436437, 2005.[Medline]
- Gresz V, Kwon TH, Gong H, Agre P, Steward MC, King LS, Nielsen S. Immunolocalization of AQP-5 in rat parotid and submandibular salivary glands after stimulation or inhibition of secretion in vivo. Am J Physiol Gastrointest Liver Physiol 287: G151G161, 2004.[Abstract/Free Full Text]
- Hager H, Kwon TH, Vinnikova AK, Masilamani S, Brooks HL, Frokiaer J, Knepper MA, Nielsen S. Immunocytochemical and immunoelectron microscopic localization of
-,
-, and
-ENaC in rat kidney. Am J Physiol Renal Physiol 280: F1093F1106, 2001.[Abstract/Free Full Text] - Hara-Chikuma M, Sohara E, Rai T, Ikawa M, Okabe M, Sasaki S, Uchida S, Verkman AS. Progressive adipocyte hypertrophy in aquaporin-7-deficient mice: adipocyte glycerol permeability as a novel regulator of fat accumulation. J Biol Chem 280: 1549315496, 2005.[Abstract/Free Full Text]
- Hatakeyama S, Yoshida Y, Tani T, Koyama Y, Nihei K, Ohshiro K, Kamiie JI, Yaoita E, Suda T, Hatakeyama K, Yamamoto T. Cloning of a new aquaporin (AQP10) abundantly expressed in duodenum and jejunum. Biochem Biophys Res Commun 287: 814819, 2001.[CrossRef][ISI][Medline]
- Hibuse T, Maeda N, Funahashi T, Yamamoto K, Nagasawa A, Mizunoya W, Kishida K, Inoue K, Kuriyama H, Nakamura T, Fushiki T, Kihara S, Shimomura I. Aquaporin 7 deficiency is associated with development of obesity through activation of adipose glycerol kinase. Proc Natl Acad Sci USA 102: 1099310998, 2005.[Abstract/Free Full Text]
- Huang D, Chen P, Chen S, Nagura M, Lim DJ, Lin X. Expression patterns of aquaporins in the inner ear: evidence for concerted actions of multiple types of aquaporins to facilitate water transport in the cochlea. Hear Res 165: 8595, 2002.[CrossRef][ISI][Medline]
- Ishibashi K, Imai M, Sasaki S. Cellular localization of aquaporin 7 in the rat kidney. Exp Nephrol 8: 252257, 2000.[CrossRef][ISI][Medline]
- Ishibashi K, Kuwahara M, Gu Y, Kageyama Y, Tohsaka A, Suzuki F, Marumo F, Sasaki S. Cloning and functional expression of a new water channel abundantly expressed in the testis permeable to water, glycerol, and urea. J Biol Chem 272: 2078220786, 1997.[Abstract/Free Full Text]
- Ishibashi K, Kuwahara M, Gu Y, Tanaka Y, Marumo F, Sasaki S. Cloning and functional expression of a new aquaporin (AQP9) abundantly expressed in the peripheral leukocytes permeable to water and urea, but not to glycerol. Biochem Biophys Res Commun 244: 268274, 1998.[CrossRef][ISI][Medline]
- Ishikawa Y, Yuan Z, Inoue N, Skowronski MT, Nakae Y, Shono M, Cho G, Yasui M, Agre P, Nielsen S. Identification of AQP5 in lipid rafts and its translocation to apical membranes by activation of M3 mAChRs in interlobular ducts of rat parotid gland. Am J Physiol Cell Physiol 289: C1303C1311, 2005.[Abstract/Free Full Text]
- James DE, Brown R, Navarro J, Pilch PF. Insulin-regulatable tissues express a unique insulin-sensitive glucose transport protein. Nature 333: 183185, 1988.[CrossRef][Medline]
- Kageyama Y, Ishibashi K, Hayashi T, Xia G, Sasaki S, Kihara K. Expression of aquaporins 7 and 8 in the developing rat testis. Andrologia 33: 165169, 2001.[CrossRef][ISI][Medline]
- Kishida K, Kuriyama H, Funahashi T, Shimomura I, Kihara S, Ouchi N, Nishida M, Nishizawa H, Matsuda M, Takahashi M, Hotta K, Nakamura T, Yamashita S, Tochino Y, Matsuzawa Y. Aquaporin adipose, a putative glycerol channel in adipocytes. J Biol Chem 275: 2089620902, 2000.[Abstract/Free Full Text]
- Kishida K, Shimomura I, Kondo H, Kuriyama H, Makino Y, Nishizawa H, Maeda N, Matsuda M, Ouchi N, Kihara S, Kurachi Y, Funahashi T, Matsuzawa Y. Genomic structure and insulin-mediated repression of the aquaporin adipose (AQPap), adipose-specific glycerol channel. J Biol Chem 276: 3625136260, 2001.[Abstract/Free Full Text]
- Kondo H, Shimomura I, Kishida K, Kuriyama H, Makino Y, Nishizawa H, Matsuda M, Maeda N, Nagaretani H, Kihara S, Kurachi Y, Nakamura T, Funahashi T, Matsuzawa Y. Human aquaporin adipose (AQPap) gene. Genomic structure, promoter analysis and functional mutation. Eur J Biochem 269: 18141826, 2002.[ISI][Medline]
- Kuriyama H, Shimomura I, Kishida K, Kondo H, Furuyama N, Nishizawa H, Maeda N, Matsuda M, Nagaretani H, Kihara S, Nakamura T, Tochino Y, Funahashi T, Matsuzawa Y. Coordinated regulation of fat-specific and liver-specific glycerol channels, aquaporin adipose and aquaporin 9. Diabetes 51: 29152921, 2002.[Abstract/Free Full Text]
- Laforenza U, Gastaldi G, Grazioli M, Cova E, Tritto S, Faelli A, Calamita G, Ventura U. Expression and immunolocalization of aquaporin-7 in rat gastrointestinal tract. Biol Cell 97: 605613, 2005.[CrossRef][ISI][Medline]
- Li H, Kamiie J, Morishita Y, Yoshida Y, Yaoita E, Ishibashi K, Yamamoto T. Expression and localization of two isoforms of AQP10 in human small intestine. Biol Cell 97: 823829, 2005.[CrossRef][ISI][Medline]
- Liu Z, Shen J, Carbrey JM, Mukhopadhyay R, Agre P, Rosen BP. Arsenite transport by mammalian aquaglyceroporins AQP7 and AQP9. Proc Natl Acad Sci USA 99: 60536058, 2002.[Abstract/Free Full Text]
- MacDougald OA, Burant CF. Obesity and metabolic perturbations after loss of aquaporin 7, the adipose glycerol transporter. Proc Natl Acad Sci USA 102: 1075910760, 2005.[Free Full Text]
- Maeda N, Funahashi T, Hibuse T, Nagasawa A, Kishida K, Kuriyama H, Nakamura T, Kihara S, Shimomura I, Matsuzawa Y. Adaptation to fasting by glycerol transport through aquaporin 7 in adipose tissue. Proc Natl Acad Sci USA 101: 1780117806, 2004.[Abstract/Free Full Text]
- Marrades MP, Milagro FI, Martinez JA, Moreno-Aliaga MJ. Differential expression of aquaporin 7 in adipose tissue of lean and obese high fat consumers. Biochem Biophys Res Commun 339: 785789, 2006.[CrossRef][ISI][Medline]
- Mobasheri A, Marples D. Expression of the AQP-1 water channel in normal human tissues: a semiquantitative study using tissue microarray technology. Am J Physiol Cell Physiol 286: C529C537, 2004.[Abstract/Free Full Text]
- Mobasheri A, Wray S, Marples D. Distribution of AQP2 and AQP3 water channels in human tissue microarrays. J Mol Histol 36: 114, 2005.[CrossRef][ISI][Medline]
- Nejsum LN, Elkjaer M, Hager H, Frokiaer J, Kwon TH, Nielsen S. Localization of aquaporin-7 in rat and mouse kidney using RT-PCR, immunoblotting, and immunocytochemistry. Biochem Biophys Res Commun 277: 164170, 2000.[CrossRef][ISI][Medline]
- Saito K, Kageyama Y, Okada Y, Kawakami S, Kihara K, Ishibashi K, Sasaki S. Localization of aquaporin-7 in human testis and ejaculated sperm: possible involvement in maintenance of sperm quality. J Urol 172: 20732076, 2004.[CrossRef][ISI][Medline]
- Schaffer JE. Fatty acid transport: the roads taken. Am J Physiol Endocrinol Metab 282: E239E246, 2002.[Abstract/Free Full Text]
- Sohara E, Rai T, Miyazaki J, Verkman AS, Sasaki S, Uchida S. Defective water and glycerol transport in the proximal tubules of AQP7 knockout mice. Am J Physiol Renal Physiol 289: F1195F1200, 2005.[Abstract/Free Full Text]
- Suzuki-Toyota F, Ishibashi K, Yuasa S. Immunohistochemical localization of a water channel, aquaporin 7 (AQP7), in the rat testis. Cell Tissue Res 295: 279285, 1999.[CrossRef][ISI][Medline]
- Swiatek PJ, Lindsell CE, del Amo FF, Weinmaster G, Gridley T. Notch1 is essential for postimplantation development in mice. Genes Dev 8: 707719, 1994.[Abstract/Free Full Text]
- Terris J, Ecelbarger CA, Nielsen S, Knepper MA. Long-term regulation of four renal aquaporins in rats. Am J Physiol Renal Fluid Electrolyte Physiol 271: F414F422, 1996.[Abstract/Free Full Text]
- Wakayama Y, Inoue M, Kojima H, Jimi T, Shibuya S, Hara H, Oniki H. Expression and localization of aquaporin 7 in normal skeletal myofiber. Cell Tissue Res 316: 123129, 2004.[CrossRef][ISI][Medline]
- Wakayama Y, Jimi T, Inoue M, Kojima H, Shibuya S, Murahashi M, Hara H, Oniki H. Expression of aquaporin 3 and its localization in normal skeletal myofibres. Histochem J 34: 331337, 2002.[CrossRef][ISI][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
K. Matsumura, B. H.-J. Chang, M. Fujimiya, W. Chen, R. N. Kulkarni, Y. Eguchi, H. Kimura, H. Kojima, and L. Chan
Aquaporin 7 Is a {beta}-Cell Protein and Regulator of Intraislet Glycerol Content and Glycerol Kinase Activity, {beta}-Cell Mass, and Insulin Production and Secretion
Mol. Cell. Biol.,
September 1, 2007;
27(17):
6026 - 6037.
[Abstract]
[Full Text]
[PDF]
|
 |
|