AJP - Renal AJP: Heart and Circulatory Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 293: F186-F192, 2007. First published March 27, 2007; doi:10.1152/ajprenal.00484.2006
0363-6127/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/F186    most recent
00484.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Usa, K.
Right arrow Articles by Liang, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Usa, K.
Right arrow Articles by Liang, M.

Renal interstitial corticosterone and 11-dehydrocorticosterone in conscious rats

Kristie Usa,1 Ravinder J. Singh,2 Brian C. Netzel,2 Yong Liu,1 Hershel Raff,3,4 and Mingyu Liang1

1Department of Physiology, Medical College of Wisconsin, Milwaukee; 2Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, Minnesota; 3Department of Medicine, Medical College of Wisconsin, Milwaukee; and 4Endocrine Research Laboratory, Aurora St. Luke's Medical Center, Milwaukee, Wisconsin

Submitted 7 December 2006 ; accepted in final form 23 March 2007


    ABSTRACT
 TOP
 ABSTRACT
 METHODS AND MATERIALS
 RESULTS
 DISCUSSION
 REFERENCES
 
Deficiencies in the conversion between active and inactive glucocorticoids in the kidney can lead to hypertension. However, the significance of glucocorticoid metabolism in specific kidney regions in vivo is not clear, possibly in part due to the difficulty in measuring glucocorticoid levels in kidney regions in vivo. We used microdialysis techniques to sample renal interstitial fluid from conscious rats. The levels of corticosterone (active) and 11-dehydrocorticosterone (inactive) were analyzed by liquid chromatography-tandem mass spectrometry. Direct infusion of the 11beta-hydroxysteroid dehydrogenase (11beta-HSD) inhibitor carbenoxolone into the renal medulla induced hypertension, and significantly increased corticosterone levels and the corticosterone/11-dehydrocorticosterone ratio, an index of 11beta-HSD activity, in the renal medullary microdialysate, but not in urine or the plasma. Further characterization of conscious, untreated rats (n = 13–16) indicated that corticosterone concentrations (ng/ml) were 0.8 ± 0.1, 1.0 ± 0.1, 66.7 ± 8.1, and 7.9 ± 1.1 in cortical microdialysate, medullary microdialysate, the plasma, and urine, respectively. The corticosterone/11-dehydrocorticosterone ratios were 0.8 ± 0.1, 0.6 ± 0.1, 10.6 ± 1.4, and 1.7 ± 0.1, respectively, in these 4 types of sample. The expression level of 11beta-HSD1 was higher in the medulla than in the cortex, whereas 11beta-HSD2 was most enriched in the outer medulla. Microdialysate levels of corticosterone were ~1.6-fold higher in afternoons than in mornings, whereas plasma levels differed by 2.8-fold. These results demonstrated that corticosterone excess in the renal medulla might be sufficient to cause hypertension and provided the first characterization of renal interstitial glucocorticoids.

hypertension; 11beta-hydroxysteroid dehydrogenase; microdialysis; mass spectrometry


THE BIOLOGICAL ACTIVITY OF glucocorticoids in target organ systems is controlled not only by circulating levels of glucocorticoids but also by intracellular metabolism in target tissue. The metabolism of glucocorticoids in target tissue involves several enzymatic reactions including the interconversion between active and inactive glucocorticoids catalyzed by 11beta-hydroxysteroid dehydrogenases (11beta-HSD) (7, 41). The type 2 isoform of the enzyme, 11beta-HSD2, converts active glucocorticoids, mainly cortisol in human and corticosterone in rodents, to inactive forms, cortisone in human and 11-dehydrocorticosterone in rodents. The type 1 isoform of the enzyme, 11beta-HSD1, has both dehydrogenase and reductase activities but may act predominantly as a reductase in vivo, regenerating biologically active glucocorticoids from their inactive forms (40).

Local metabolism of glucocorticoids has particular relevance to renal function. Aldosterone is a powerful and important regulator of electrolyte transport in the distal nephron. Mineralocorticoid receptors in the distal nephron, however, can bind aldosterone and glucocorticoids with nearly equal affinity. 11beta-HSD2 in the distal nephron inactivates glucocorticoids and allows aldosterone to be functionally significant (12, 35). Deficiencies in 11beta-HSD2 can lead to the development of apparent mineralocorticoid excess syndrome (28, 36, 42) characterized by hypertension and hypokalemia due to overstimulation of mineralocorticoid receptors by excess glucocorticoids. Renal excess of glucocorticoids could also contribute to sodium retention and potassium loss in other diseases such as cirrhosis (11). The kidney also appears to express 11beta-HSD1 (5, 31), but its significance is not known.

The kidney consists of anatomically and physiologically distinct regions including the cortex, the outer medulla, and the inner medulla. Differential expression of 11beta-HSDs has been reported in the renal medulla of rat models of hypertension (23). 11beta-HSD expression or activity in glomeruli, renal tubules, and vasculatures has also been reported (2, 3, 9). However, the significance of regional glucocorticoid metabolism in the kidney in vivo is not clear. This is possibly in part due to the difficulty in directly measuring glucocorticoid levels in kidney regions in vivo. Measurement of active and inactive glucocorticoids or their tetrahydro metabolites in urine is often used as an indirect index of renal metabolism of glucocorticoids. Renal interstitial microdialysis is an established technique used to obtain samples that can be used to estimate renal interstitial fluid concentration of a wide variety of substances such as cyclic GMP (33), ATP (30), nitric oxide metabolites (22), and catecholamines (1). Microdialysis has been used in the analysis of corticosterone in the brain (26), but not in the kidney. Microdialysis of 11-dehydrocorticosterone has not been reported.

In the present study, we examined the functional significance of regional metabolism of glucocorticoids in the kidney and tested the hypothesis that inhibition of 11beta-HSD by carbenoxolone locally in the renal medulla would be sufficient to cause hypertension. Furthermore, we characterized the levels of corticosterone and 11-dehydrocorticosterone in renal cortical and medullary interstitial fluid in conscious, freely moving rats using chronic microdialysis and a liquid chromatography-tandem mass spectrometry (LC-MS/MS) method.


    METHODS AND MATERIALS
 TOP
 ABSTRACT
 METHODS AND MATERIALS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and tissue harvest. Male Sprague-Dawley rats weighing 250–300 g at the beginning of the experiment were used in the present study. Rats were on a 12:12-h light-dark cycle with lights on from 6 AM to 6 PM. Rats had unlimited access to water. The animal protocols were approved by the Institutional Animal Care and Use Committee of the Medical College of Wisconsin. Tissue harvest and dissection of kidney regions were performed as described previously (23).

Rats were used in four protocols. In protocol 1, 20 rats were uninephrectomized and implanted with femoral arterial catheters, renal medullary interstitial infusion lines, and renal medullary microdialysis probes for studying the effect of carbenoxolone. In protocol 2, 16 rats were implanted with femoral arterial catheters and renal cortical and medullary microdialysis probes (in the left kidney) for the characterization of renal cortical and medullary interstitial glucocorticoids. In protocol 3, 8 rats were instrumented similar to protocol 2 and used to study the effect of dietary high-salt intake. In protocol 4, 10 uninstrumented rats were used for tissue harvest for the analysis of gene expression.

Chronic renal interstitial microdialysis in conscious rats. The renal interstitial microdialysis method we previously used in anesthetized rats (1, 22) was modified for chronic experiments in conscious rats. The inflow and outflow tubes of a linear microdialysis probe (5-mm membrane, 5-kDa molecular mass cutoff, Bioanalytical Systems, West Lafayette, IN) were replaced with PE-10 polyethylene tubes to increase resistance to breakage. Rats were anesthetized briefly with ketamine (40 mg/kg), xylazine (8 mg/kg), and acepromazine (4 mg/kg), and the left kidney was exposed through a flank incision. Probes were placed into the renal cortex and the renal medulla, or the renal medulla only, using a 30-gauge needle. The inflow and outflow tubes were tunneled under the skin and exteriorized at the back of the neck where a spring was attached to protect the tubes. Rats were housed in individual metabolic cages. The inflow tubes were connected to an infusion pump through a double-channel swivel and continuously perfused with Ringer solution at 1 µl/min. The cortical and medullary microdialysate was collected from the outflow tubes. Rats were allowed 1 wk to recover before experimental collections or treatments were started. Microdialysate was collected twice a day from 9 AM to noon and from 2 to 5 PM, or once a day in the PM only as described in RESULTS. After the animal was killed at the end of the experiment, the kidney was dissected to confirm the correct positioning of the microdialysis membrane.

Collection of plasma and urine samples. Blood samples (0.2 ml) were collected in the presence of heparin (2 µl) from chronically implanted femoral arterial catheters at midpoint of a microdialysate collection. Blood samples were centrifuged at 1,000 g, 4°C, for 5 min to obtain the plasma, which was stored at –80°C. Urine samples were collected in metabolic cages over the same period as microdialysate collection.

In vitro microdialysis. In vitro microdialysis was performed as described previously (1, 22) to estimate the relative recovery rate using a bath solution containing 100 ng/ml corticosterone (Sigma, St. Louis, MO) and 11-dehydrocorticosterone (Steraloids, Newport, RI).

Renal medullary interstitial infusion. Chronic renal medullary interstitial infusion in conscious rats was performed as described previously (27, 38). Carbenoxolone (Sigma) was infused into the renal medulla at 6 mg/day. The rats were uninephrectomized to ensure the remaining, infused kidney was responsible for all renal function. These rats were also implanted with medullary microdialysis probes, requiring the use of double-channel swivels. Cortical microdialysis was not performed in these rats since the channels of the swivel were fully occupied by interstitial infusion and medullary microdialysis.

Measurement of arterial blood pressure in conscious rats. Chronic monitoring of arterial blood pressure in conscious rats using indwelling femoral arterial catheters was performed as described previously (15, 27, 38).

LC-MS/MS analysis of corticosterone and 11-dehydrocorticosterone. An LC-MS/MS method was developed to quantify corticosterone and 11-dehydrocorticosterone, modified from methods for analyzing other steroids that we previously reported (29, 39). Corticosterone, 11-dehydrocorticosterone, and cortisol were obtained from Steraloids. A 1 µg/ml working standard was prepared by diluting the standards with 70:30 methanol-water. A four-point calibration curve of 25, 5, 1, and 0.2 ng/ml was made by serial dilutions of the working standard. Corticosterone 2,2,4,6,6,17a,21,21-d8 (isotopic enrichment 97%) was purchased from CDN Isotopes (Quebec, Canada) and was used as an internal standard. A 1-µg/ml working internal standard was made in 70:30 methanol-water. A 10-µl internal standard was added to 50 µl of each sample or standard, and an acetonitrile crash was performed to remove particulate matter and to precipitate proteins. Four milliliters of CH2Cl2 were added for organic liquid/liquid extraction. The methylene chloride layer was washed with base, acid, and water before dry-down and resuspsension in 50 µl of 70:30 methanol-water containing estriol (to prevent nonspecific binding of the analytes to glassware).

Perkin-Elmer Series 200 pumps and a CTC-Pal Autosampler were used for sample introduction to the mass spectrometer. A reversed-phase analytical column (SUPELCOSIL LC-18; 33 x 4.6-mm ID, 3 µm; SUPELCO) combined with a 4 x 2-mm ID precolumn filter was used to resolve the analytes and internal standard chromatographically. Samples were introduced to the mass spectrometer in 20-µl volumes. The mobile phase, delivered at 1,000 µl/min, consisted of 45% methanol in 0.1% (vol/vol) ammonium acetate, followed by a 4-min ramp to 85% methanol in 0.1% ammonium acetate.

LC-MS/MS measurements were performed with an API 4000 Q-trap tandem mass spectrometer (Applied Biosystems, Foster City, CA), operating with an electospray ionization source in the positive mode. The mass spectrometer operating parameters consisted of the source heater probe at 500°C, with an ionspray voltage of 5,000 V, a curtain gas setting of 20, entrance potential of 10 V, and ion spray 1 and 2 voltages at 50 and 40, respectively. Data acquisition and processing were performed using Analyst software (Applied Biosystems). Corticosterone, 11-dehydrocorticosterone, corticosterone-d8, and cortisol were monitored by ion pairs of 347.3/121.2, 345.2/121.2, 355.2/125.1, and 363.1/121.1, respectively. A multiple reaction monitoring chromatogram is shown in Fig. 1. Signal-to-noise ratios for the 0.2 ng/ml standards of corticosterone, 11-dehydrocorticosterone, and cortisol were 24.2, 18.8, and 17.8, respectively.


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 1. MRM chromatogram of corticosterone, 11-dehydrocorticosterone, and cortisol at a concentration of 5 ng/ml in a calibrator. The order of elution for these compounds is as follows: peak 1, 11-dehydrocorticosterone; peak 2, cortisol; peak 3, d8 corticosterone; peak 4, corticosterone.

 
Measurement of urinary concentration of Na+ and K+. Urinary concentrations of Na+ and K+ were measured using a flame photometer (22).

Real-time PCR. Real-time PCR analysis using the Taqman chemistry (Applied Biosystems) was performed as described previously (17, 24). 18S rRNA was used as an internal normalizer. Oligonucleotide sequences were: rat 11beta-HSD1, forward CTCCTCCATGGCTGGGAAA, reverse AAGAACCCATCCAGAGCAAACTT, probe FAM-ACCCAACCTCTGATTGCTTCCTACTCTGCA-TAMRA; rat 11beta-HSD2, forward CTCTCCTCTGCTTCATGAGACCAT, reverse CACGCTAAACTCTCCATCCATCT, probe FAM-CCTACCAGGCACGACCCTTCAGC-TAMRA.

Western blot. Western blot analysis was performed as described previously (20, 21, 24). A goat antibody for human 11beta-HSD1 was obtained from R&D Systems (Minneapolis, MN), catalog number AF3397, and used at a final concentration of 0.5 µg/ml. The antibody detected a distinct band at the expected molecular weight of 11beta-HSD1 in samples from both the kidney and the liver, the latter known to express a high level of 11beta-HSD1. Two additional bands at higher molecular weights of ~100 kDa were seen, especially in kidney samples. A sheep antibody for rat 11beta-HSD2 was obtained from Chemicon International (Millipore, Billerica, MA), catalog number AB1296, and used at 1:2,000 dilution. The antibody detected a single band at the expected molecular weight of 11beta-HSD2. Membranes were stained with Coomassie blue, and the total Coomassie blue intensity in each lane was used for normalization.

Immunohistochemistry. Kidneys were cut into two halves along the corticopapillary axis and immediately immersed in 10% neutral formalin. Fixed kidney tissue was processed on SAKURA VIP 30 and embedded with Tisher Tissue Tek 2. Paraffin sections, 3-µm thick, were cut and mounted on Fisher Plus slides. Deparaffinization and hydration were performed using SAKURA DRS2000 Automated Stainer. Endogenous peroxidase and biotin and nonspecific binding sites were sequentially blocked. Tissue sections were then incubated with the sheep antibody for 11beta-HSD2 (Chemicon International, 1:2,000 dilution) for 90 min, followed by biotinylated secondary antibody and then streptavidin-peroxidase conjugates. Color was developed using DAB reagents.

Statistical analysis. Data were analyzed using ANOVA, Student's t-test, or paired t-test when appropriate and are presented as means ± SE. P < 0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS AND MATERIALS
 RESULTS
 DISCUSSION
 REFERENCES
 
Effect of renal medullary interstitial infusion of carbenoxolone. We examined the physiological significance of regional metabolism of glucocorticoids in the kidney. We tested the hypothesis that inhibition of 11beta-HSD by carbenoxolone locally in the renal medulla would be sufficient to cause hypertension. Direct infusion of carbenoxolone (6 mg/day) into the renal medullary interstitial space increased mean arterial blood pressure from 110 ± 2 mmHg at the baseline to 130 ± 3 mmHg at 5 days after the initiation of the infusion (n = 10, P < 0.05; Fig. 2). Intravenous infusion of carbenoxolone at the same dose did not induce hypertension. Blood pressure was 109 ± 1 mmHg at the baseline and 108 ± 2 mmHg after 5 days of intravenous infusion (n = 12). Intravenous infusion of carbenoxolone at a higher dose, 12 mg/day, increased blood pressure to 127 ± 3 mmHg (n = 9, P < 0.05 vs. baseline) after 2 days. Blood pressure returned to the baseline level of 108 ± 5 mmHg after 5 days.


Figure 2
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 2. Effect of renal medullary interstitial infusion of carbenoxolone on arterial blood pressure. Carbenoxolone (6 mg/day) or vehicle was infused directly into the renal medullary interstitium of conscious, uninephrectomized Sprague-Dawley rats, starting after blood pressure recording on day 0. Mean arterial blood pressure (MAP) was monitored daily (2 to 5 PM) using indwelling femoral arterial catheter, n = 9 to 10. *P < 0.05 vs. day 0.

 
Glucocorticoid levels were analyzed before interstitial carbenoxolone infusion (day 0) and at day 3 and day 7 after the initiation of carbenoxolone treatment. The samples were collected from 2 to 5 PM. The renal medullary infusion of carbenoxolone significantly increased corticosterone concentrations in the renal medullary microdialysate from 1.12 ± 0.17 at the baseline to 3.23 ± 0.59 ng/ml at 7 days (n = 8 to 9, P < 0.05 vs. control). The concentrations tended to increase at 3 days but did not reach statistical significance (Fig. 3A). Corticosterone levels did not change significantly in either the plasma or urine. The corticosterone/11-dehydrocorticosterone ratio, an index of 11beta-HSD activities, was also significantly increased in the medullary microdialysate by about twofold from the baseline to 7 days (Fig. 3B). The ratio did not change significantly in the plasma or urine.


Figure 3
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 3. Effect of renal medullary interstitial infusion of carbenoxolone on glucocorticoid levels. Corticosterone levels (A) and corticoterone/11-dehydrocorticosterone ratios (B) were measured in conscious, freely moving rats before (baseline) and 3 and 7 days after the initiation of renal medullary interstitial infusion of carbenoxolone. Microdialysate samples were collected from 2 to 5 PM, n = 6 to 10. *P < 0.05 vs. saline control.

 
Urinary Na+ concentrations in the carbenoxolone-treated group significantly decreased from 102.0 ± 10.7 on day 0 to 69.5 ± 7.6 mmol/l on day 3 (n = 10, P < 0.05) and 61.8 ± 10.3 mmol/l on day 7 (n = 6, P < 0.05). Na+ concentrations did not change significantly in the control group. Urinary K+ concentrations did not change significantly, although there was a tendency of increase in the carbenoxolone-treated group from day 0 to day 7 (32.8 ± 2.3 vs. 48.1 ± 10.5 mmol/l, n = 6, NS).

It should be cautioned that dietary intake was not controlled in the present study, and urine volume could not be accurately measured due to the short collection period of 3 h and the use of metabolic cages. Urine volume is not critical for interpreting the glucocorticoid data but is important for interpreting the electrolyte excretion data.

Interstitial corticosterone and 11-dehydrocorticosterone in the renal cortex and medulla. The carbenoxolone study suggested that measurement of glucocorticoids in renal interstitial microdialysate had significant value beyond measurements in the plasma and urine. We performed further studies to characterize glucocorticoid levels in both renal cortical and medullary interstitial microdialysate in additional groups of conscious, freely moving, untreated rats.

As shown in Fig. 4A, concentrations of corticosterone (average of morning and afternoon collections) in renal cortical and medullary microdialysate were 0.76 ± 0.14 and 1.02 ± 0.15 ng/ml, respectively (n = 15 to 16, NS). In vitro microdialysis indicated that the relative recovery rate for corticosterone was 15.4 ± 1.5% (n = 3). Assuming the in vivo recovery rate was similar, we estimated that the levels of corticosterone in renal interstitial fluid would be ~6 ng/ml. Urinary and plasma concentrations of corticosterone were 7.9 ± 1.1 and 66.7 ± 8.1 ng/ml, respectively (n = 15 to 16). Concentrations of 11-dehydrocorticosterone in renal interstitial microdialysate, the plasma, and urine are shown in Fig. 4B. The relative recovery rate for 11-dehydrocorticosterone in vitro was 14.4 ± 2.0% (n = 3). Cortisol was not detectable in the majority of the samples.


Figure 4
View larger version (7K):
[in this window]
[in a new window]

 
Fig. 4. Renal interstitial corticosterone and 11-dehydrocorticosterone levels in conscious, freely moving rats. Cortical microdialysate, medullary microdialysate, the plasma, and urine were collected from conscious, freely moving, untreated rats (n = 15 to 16). Corticosterone (A) and 11-dehydrocorticosterone (B) levels were analyzed with liquid chromatography-tandem mass spectrometry and their ratio (C) was calculated. Open bars represented predicted concentrations in the interstitial fluid based on in vitro recovery rates. *P < 0.05 vs. the plasma or urine.

 
The ratio of corticosterone/11-dehydrocorticosterone was 0.83 ± 0.13 and 0.60 ± 0.07 in renal cortical and medullary microdialysate, respectively (n = 13, NS). These ratios were significantly lower than that in urine or the plasma (Fig. 4C).

Regional expression of 11beta-HSD1 and 11beta-HSD2. We analyzed the regional distribution of 11beta-HSD1 and 11beta-HSD2 using quantitative Taqman real-time PCR and Western blot with currently available antibodies. Rats used in the expression study were not instrumented or treated. As shown in Fig. 5, both 11beta-HSD1 and 11beta-HSD2 were readily detectable in the rat renal cortex, renal outer medulla, and renal inner medulla. 11beta-HSD1 appeared to be more abundant in the medulla than in the cortex. 11beta-HSD2 was most enriched in the outer medulla, followed by the cortex and the inner medulla. Immunohistochemistry analysis showed that 11beta-HSD2 was detectable in the collecting duct in the cortex, the outer medulla, and the inner medulla, largely consistent with previous findings (18, 34). The 11beta-HSD1 antibody we used did not appear suitable for immunohistochemistry analysis (see METHODS AND MATERIALS).


Figure 5
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 5. Expression of 11beta-HSD1 and 11beta-HSD2 in kidney regions. mRNA levels of 11beta-HSD1 (A) and 11beta-HSD2 (B) were quantified with Taqman real-time PCR and normalized to 18S rRNA. Protein levels of 11beta-HSD1 (C) and 11beta-HSD2 (D) were measured with Western blot in tissue homogenate and normalized to Coomassie blue staining. Liver was used as a positive control for 11beta-HSD1. Data are shown as percentage of average levels in cortex. Representative Western blots of 11beta-HSD1 (E, top) and 11beta-HSD2 (F, top) and corresponding Coomassie blue staining (bottom) are shown, n = 5 to 10. *P < 0.05 vs. cortex. C, renal cortex; OM, outer medulla; IM, inner medulla.

 
Circadian changes. Circulating levels of glucocorticoid are known to exhibit circadian fluctuations. This was confirmed in our study where plasma levels of corticosterone were ~2.8-fold higher in the afternoon (3:30 PM) than in the morning (10:30 AM; Fig. 6A). The same trend was observed in renal microdialysate but the magnitude of the difference was smaller. Corticosterone levels in renal microdialysate were ~1.6-fold higher in the afternoon than in the morning (Fig. 6A). Urinary corticosterone levels tended to be higher in the afternoon but did not reach statistical significance. The corticosterone/11-dehydrocorticosterone ratio was higher in the afternoon in renal cortical microdialysate, similar to the plasma (Fig. 6B). The ratio did not fluctuate significantly in the medullary microdialysate.


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 6. Circadian changes of systemic and renal interstitial glucocorticoid levels. Corticosterone levels (A) and corticoterone/11-dehydrocorticosterone ratios (B) were measured in conscious, freely moving rats in mornings (9 AM to noon) and afternoons (2 to 5 PM), n = 13 to 16. *P < 0.05 vs. AM.

 
Effect of increased dietary salt intake. We examined the effect of high-salt intake on renal interstitial glucocorticoid levels. Rats were switched from a baseline 0.4% NaCl diet to a 4% NaCl diet for 3 days. The samples were collected from 2 to 5 PM. The treatment did not significantly alter renal interstitial levels of corticosterone or corticosterone/11-dehydrocorticosterone ratio. In cortical microdialysate, corticosterone levels were 0.75 ± 0.14 and 0.83 ± 0.18 ng/ml on 0.4 and 4% NaCl, respectively, and the ratio was 1.33 ± 0.42 and 1.31 ± 0.25, respectively (n = 7 to 8, NS). In medullary microdialysate, the corticosterone levels were 1.23 ± 0.39 and 1.15 ± 0.14 ng/ml, respectively, and the ratio was 0.53 ± 0.1 and 0.98 ± 0.28, respectively (n = 7 to 8, NS).


    DISCUSSION
 TOP
 ABSTRACT
 METHODS AND MATERIALS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study utilized a new approach combining chronic renal microdialysis, LC-MS/MS analysis, and renal medullary interstitial infusion of an 11beta-HSD inhibitor to study local metabolism of glucocorticoids. It demonstrated that corticosterone excess in the renal medulla might be sufficient to cause hypertension and provided the first characterization of renal interstitial glucocorticoids.

Carbenoxolone can inhibit both 11beta-HSD1 and 11beta-HSD2 (4) and has diverse effects (16, 32). The specific renal medullary administration used in the present study obviates certain confounding effects associated with systemic administration. The findings of the present study indicate that the net effect of renal medullary administration of carbenoxolone is suppression of 11-dehydrogenation of corticosterone. The resulting increase in renal medullary corticosterone could mediate or contribute to the concomitant hypertension. The finding that alterations of corticosterone metabolism in the renal medulla can lead to hypertension is significant since differential expression of 11beta-HSDs has been reported in the renal medulla of rat models of hypertension (23). Given the known role of 11beta-HSD2 in maintaining mineralocorticoid receptor selectivity (12, 35), hypertension observed in the present study might be due to overstimulation of mineralocorticoid receptors as a result of carbenoxolone infusion. Other mechanisms could also be involved. For example, glucocorticoids have been shown to suppress the expression of endothelial nitric oxide synthase, an effect exacerbated by knockdown of 11beta-HSD2 (25).

The large diurnal variation of plasma corticosterone appeared to be partially buffered in the kidney since the variation was smaller in the renal microdialysate. It might reflect the capacity of renal 11beta-HSD to maintain a relatively stable level of corticosterone, which might be important given the potential impact of corticosterone on sodium and fluid transport.

There was a tendency for higher corticosterone levels and lower corticosterone/11-dehydrocorticosterone ratios in the medulla compared with the cortex. The differences were not statistically significant. Both 11beta-HSD1 and 11beta-HSD2 tend to be enriched in the medulla, which could contribute to the complexity of intrarenal regional glucocorticoid metabolism. Medullary glucocorticoid levels did not appear to differ significantly in uninephrectomized rats (the interstitial carbenoxolone groups) compared with rats with two kidneys. It has been reported that renal levels of active glucocorticoids increased at 24 h but not 2 wk after uninephrectomy (9). The design of the present study was more in line with the long-term time point.

The plasma concentrations of corticosterone obtained in the present study are consistent with values previously reported in conscious rats (6, 37). Corticosterone/11-dehydrocorticosterone ratios in rat urine were reported to be about three to four according to ELISA (13) or 0.7 according to a radioimmunoassay (36a), compared with about one to two in the present study.

Urinary steroid measurements have been, and will continue to be, valuable as indexes of renal glucocorticoid metabolism, especially in studies involving humans or large changes in the whole kidney. Tissue levels of glucocorticoid metabolites can also be analyzed using tissue extracts (8). Renal interstitial measurement will be a particularly valuable alternative in experimental animals when the changes are subtle or confined to a kidney region and when temporal changes in conscious animals are of interest. Microdialysis could also be useful in the study of other tissues, such as liver, fat, and brain, where local metabolism of glucocorticoids is important.

Additional factors need to be considered when interpreting the microdialysate data. Interstitial levels of glucocorticoids are likely influenced by both circulating and intracellular levels since glucocorticoids are steroids and can move across the plasma membrane. Circulating corticosterone is largely protein-bound. The reported percentages of rat plasma corticosterone that is unbound vary from ~1% to more than 10% (10, 14). Renal interstitial levels of corticosterone would, therefore, appear to be generally in the same range as plasma levels of the unbound corticosterone. The renal interstitial levels we measured probably reflect the influence of various cell types within a kidney region since the microdialysis membrane is 5 mm long. In collecting duct cells, where 11beta-HSD2 is enriched (18, 19), corticosterone levels could be lower.

Quantification of intracellular levels of glucocorticoids with sufficient temporal and spatial resolution will ultimately be needed to truly understand local metabolism of glucocorticoids. Renal microdialysis and LC-MS/MS analysis represent a significant step toward that goal. The approach allowed us to detect changes of corticosterone metabolism in the renal medulla, not reflected in urine, that were associated with hypertension.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. Liang, Dept. of Physiology, Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee, WI 53226 (e-mail: mliang{at}mcw.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS AND MATERIALS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Berndt TJ, Liang M, Tyce GM, Knox FG. Intrarenal serotonin, dopamine, and phosphate handling in remnant kidneys. Kidney Int 59: 625–630, 2001.[CrossRef][Web of Science][Medline]
  2. Brem AS, Bina RB, King TC, Morris DJ. Localization of 2 11beta-OH steroid dehydrogenase isoforms in aortic endothelial cells. Hypertension 31: 459–462, 1998.[Abstract/Free Full Text]
  3. Brereton PS, van Driel RR, Suhaimi Fb Koyama K, Dilley R, Krozowski Z. Light and electron microscopy localization of the 11beta-hydroxysteroid dehydrogenase type I enzyme in the rat. Endocrinology 142: 1644–1651, 2001.[Abstract/Free Full Text]
  4. Bujalska I, Shimojo M, Howie A, Stewart PM. Human 11 beta-hydroxysteroid dehydrogenase: studies on the stably transfected isoforms and localization of the type 2 isozyme within renal tissue. Steroids 62: 77–82, 1997.[CrossRef][Web of Science][Medline]
  5. Castello R, Schwarting R, Muller C, Hierholzer K. Immunohistochemical localization of 11-hydroxysteroid dehydrogenase in rat kidney with monoclonal antibody. Renal Physiol Biochem 12: 320–327, 1989.[Web of Science][Medline]
  6. Choi S, Wong LS, Yamat C, Dallman MF. Hypothalamic ventromedial nuclei amplify circadian rhythms: do they contain a food-entrained endogenous oscillator? J Neurosci 18: 3843–3852, 1998.[Abstract/Free Full Text]
  7. Draper N, Stewart PM. 11beta-Hydroxysteroid dehydrogenase and the prereceptor regulation of corticosteroid hormone action. J Endocrinol 186: 251–271, 2005.[Abstract/Free Full Text]
  8. Escher G, Frey FJ, Frey BM. 11 beta-Hydroxysteroid dehydrogenase accounts for low prednisolone/prednisone ratios in the kidney. Endocrinology 135: 101–106, 1994.[Abstract]
  9. Escher G, Vogt B, Beck T, Guntern D, Frey BM, Frey FJ. Reduced 11beta-hydroxysteroid dehydrogenase activity in the remaining kidney following nephrectomy. Endocrinology 139: 1533–1539, 1998.[Abstract/Free Full Text]
  10. Fleshner M, Deak T, Spencer RL, Laudenslager ML, Watkins LR, Maier SF. A long-term increase in basal levels of corticosterone and a decrease in corticosteroid-binding globulin after acute stressor exposure. Endocrinology 136: 5336–5342, 1995.[Abstract]
  11. Frey FJ. Impaired 11 beta-hydroxysteroid dehydrogenase contributes to renal sodium avidity in cirrhosis: hypothesis or fact? Hepatology 44: 795–801, 2006.[CrossRef][Web of Science][Medline]
  12. Funder JW, Pearce PT, Smith R, Smith AI. Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242: 583–585, 1988.[Abstract/Free Full Text]
  13. Gomez-Sanchez EP, Ganjam V, Chen YJ, Liu Y, Zhou MY, Toroslu C, Romero DG, Hughson MD, de Rodriguez A, Gomez-Sanchez CE. Regulation of 11 beta-hydroxysteroid dehydrogenase enzymes in the rat kidney by estradiol. Am J Physiol Endocrinol Metab 285: E272–E279, 2003.[Abstract/Free Full Text]
  14. Han ES, Evans TR, Shu JH, Lee S, Nelson JF. Food restriction enhances endogenous and corticotropin-induced plasma elevations of free but not total corticosterone throughout life in rats. J Gerontol A Biol Sci Med Sci 56: B391–B397, 2001.[Abstract/Free Full Text]
  15. Hinojosa-Laborde C, Greene AS, Cowley AW Jr. Autoregulation of the systemic circulation in conscious rats. Hypertension 11: 685–691, 1988.[Abstract/Free Full Text]
  16. Kamermans M, Fahrenfort I, Schultz K, Janssen-Bienhold U, Sjoerdsma T, Weiler R. Hemichannel-mediated inhibition in the outer retina. Science 292: 1178–1180, 2001.[Abstract/Free Full Text]
  17. Knoll KE, Pietrusz JL, Liang M. Tissue-specific transcriptome responses in rats with early streptozotocin-induced diabetes. Physiol Genomics 21: 222–229, 2005.[Abstract/Free Full Text]
  18. Krozowski Z, MaGuire JA, Stein-Oakley AN, Dowling J, Smith RE, Andrews RK. Immunohistochemical localization of the 11 beta-hydroxysteroid dehydrogenase type II enzyme in human kidney and placenta. J Clin Endocrinol Metab 80: 2203–2209, 1995.[Abstract]
  19. Kyossev Z, Walker PD, Reeves WB. Immunolocalization of NAD-dependent 11 beta-hydroxysteroid dehydrogenase in human kidney and colon. Kidney Int 49: 271–281, 1996.[Web of Science][Medline]
  20. Liang M, Knox FG. Nitric oxide activates PKCalpha and inhibits Na+-K+-ATPase in opossum kidney cells. Am J Physiol Renal Physiol 277: F859–F865, 1999.[Abstract/Free Full Text]
  21. Liang M, Croatt AJ, Nath KA. Mechanisms underlying induction of heme oxygenase-1 by nitric oxide in renal tubular epithelial cells. Am J Physiol Renal Physiol 279: F728–F735, 2000.[Abstract/Free Full Text]
  22. Liang M, Berndt TJ, Knox FG. Mechanism underlying diuretic effect of L-NAME at a subpressor dose. Am J Physiol Renal Physiol 281: F414–F419, 2001.[Abstract/Free Full Text]
  23. Liang M, Yuan B, Rute E, Greene AS, Olivier M, Cowley AW Jr. Insights into Dahl salt-sensitive hypertension revealed by temporal patterns of renal medullary gene expression. Physiol Genomics 12: 229–237, 2003.[Abstract/Free Full Text]
  24. Liang M, Pietrusz JL. Thiol-related genes in diabetic complications. A novel protective role for endogenous thioredoxin 2. Arterioscler Thromb Vasc Biol 27: 77–83, 2007.[Abstract/Free Full Text]
  25. Liang M, Pietrusz JL. Distinct roles of 11beta-hydroxysteroid dehydrogenase type 1 and type 2 in the regulation of endothelial nitric oxide synthase expression (Abstract). Hypertension 46: 3, 2005.[CrossRef]
  26. Linthorst AC, Flachskamm C, Barden N, Holsboer F, Reul JM. Glucocorticoid receptor impairment alters CNS responses to a psychological stressor: an in vivo microdialysis study in transgenic mice. Eur J Neurosci 12: 283–291, 2000.[CrossRef][Web of Science][Medline]
  27. Mattson DL, Lu S, Nakanishi K, Papanek PE, Cowley AW Jr. Effect of chronic renal medullary nitric oxide inhibition on blood pressure. Am J Physiol Heart Circ Physiol 266: H1918–H1926, 1994.[Abstract/Free Full Text]
  28. Mune T, Rogerson FM, Nikkila H, Agarwal AK, White PC. Human hypertension caused by mutations in the kidney isozyme of 11 beta-hydroxysteroid dehydrogenase. Nat Genet 10: 394–399, 1995.[CrossRef][Web of Science][Medline]
  29. Nelson RE, Grebe SK, O'Kane DJ, Singh RJ. Liquid chromatography-tandem mass spectrometry assay for simultaneous measurement of estradiol and estrone in human plasma. Clin Chem 50: 373–384, 2004.[Abstract/Free Full Text]
  30. Nishiyama A, Majid DS, Taher KA, Miyatake A, Navar LG. Relation between renal interstitial ATP concentrations and autoregulation-mediated changes in renal vascular resistance. Circ Res 86: 656–662, 2000.[Abstract/Free Full Text]
  31. Rundle SE, Funder JW, Lakshmi V, Monder C. The intrarenal localization of mineralocorticoid receptors and 11 beta-dehydrogenase: immunocytochemical studies. Endocrinology 125: 1700–1704, 1989.[Abstract/Free Full Text]
  32. Sandeep TC, Yau JL, MacLullich AM, Noble J, Deary IJ, Walker BR, Seckl JR. 11Beta-hydroxysteroid dehydrogenase inhibition improves cognitive function in healthy elderly men and type 2 diabetics. Proc Natl Acad Sci USA 101: 6734–6739, 2004.[Abstract/Free Full Text]
  33. Siragy HM, Carey RM. The subtype-2 (AT2) angiotensin receptor regulates renal cyclic guanosine 3', 5'-monophosphate and AT1 receptor-mediated prostaglandin E2 production in conscious rats. J Clin Invest 97: 1978–1982, 1996.[Web of Science][Medline]
  34. Smith RE, Li KX, Andrews RK, Krozowski Z. Immunohistochemical and molecular characterization of the rat 11 beta-hydroxysteroid dehydrogenase type II enzyme. Endocrinology 138: 540–547, 1997.[Abstract/Free Full Text]
  35. Stewart PM, Wallace AM, Valentino R, Burt D, Shackleton CH, Edwards CR. Mineralocorticoid activity of liquorice: 11-beta-hydroxysteroid dehydrogenase deficiency comes of age. Lancet 2: 821–824, 1987.[Web of Science][Medline]
  36. Stewart PM, Krozowski ZS, Gupta A, Milford DV, Howie AJ, Sheppard MC, Whorwood CB. Hypertension in the syndrome of apparent mineralocorticoid excess due to mutation of the 11 beta-hydroxysteroid dehydrogenase type 2 gene. Lancet 347: 88–91, 1996.[CrossRef][Web of Science][Medline]
  37. Takeda Y, Inaba S, Furukawa K, Miyamori I. Renal 11beta-hydroxysteroid dehydrogenase in genetically salt-sensitive hypertensive rats. Hypertension 32: 1077–1082, 1998.[Abstract/Free Full Text]
  38. Tannenbaum BM, Brindley DN, Tannenbaum GS, Dallman MF, McArthur MD, Meaney MJ. High-fat feeding alters both basal and stress-induced hypothalamic-pituitary-adrenal activity in the rat. Am J Physiol Endocrinol Metab 273: E1168–E1177, 1997.[Abstract/Free Full Text]
  39. Taylor NE, Glocka P, Liang M, Cowley AW Jr. NADPH oxidase in the renal medulla causes oxidative stress and contributes to salt-sensitive hypertension in Dahl S rats. Hypertension 47: 692–698, 2006.[Abstract/Free Full Text]
  40. Taylor RL, Machacek D, Singh RJ. Validation of a high-throughput liquid chromatography-tandem mass spectrometry method for urinary cortisol, and cortisone. Clin Chem 48: 1511–1519, 2002.[Abstract/Free Full Text]
  41. Tomlinson JW, Walker EA, Bujalska IJ, Draper N, Lavery GG, Cooper MS, Hewison M, Stewart PM. 11beta-Hydroxysteroid dehydrogenase type 1: a tissue-specific regulator of glucocorticoid response. Endocr Rev 25: 831–866, 2004.[Abstract/Free Full Text]
  42. White PC, Mune T, Agarwal AK. 11 beta-Hydroxysteroid dehydrogenase and the syndrome of apparent mineralocorticoid excess. Endocr Rev 18: 135–156, 1997.[Abstract/Free Full Text]
  43. Wilson RC, Harbison MD, Krozowski ZS, Funder JW, Shackleton CH, Hanauske-Abel HM, Wei JQ, Hertecant J, Moran A, Neiberger RE, Balfe JW, Fattah A, Daneman D, Licholai T, New MI. Several homozygous mutations in the gene for 11 beta-hydroxysteroid dehydrogenase type 2 in patients with apparent mineralocorticoid excess. J Clin Endocrinol Metab 80: 3145–3150, 1995.[Abstract]



This article has been cited by other articles:


Home page
HypertensionHome page
Z. Tian, Y. Liu, K. Usa, D. Mladinov, Y. Fang, X. Ding, A. S. Greene, A. W. Cowley Jr, and M. Liang
Novel Role of Fumarate Metabolism in Dahl-Salt Sensitive Hypertension
Hypertension, August 1, 2009; 54(2): 255 - 260.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. Liu, D. Mladinov, J. L. Pietrusz, K. Usa, and M. Liang
Glucocorticoid response elements and 11{beta}-hydroxysteroid dehydrogenases in the regulation of endothelial nitric oxide synthase expression
Cardiovasc Res, January 1, 2009; 81(1): 140 - 147.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
Y. Liu, R. J. Singh, K. Usa, B. C. Netzel, and M. Liang
Renal medullary 11{beta}-hydroxysteroid dehydrogenase type 1 in Dahl salt-sensitive hypertension
Physiol Genomics, December 12, 2008; 36(1): 52 - 58.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
M. Liang, N. H. Lee, H. Wang, A. S. Greene, A. E. Kwitek, M. L. Kaldunski, T. V. Luu, B. C. Frank, S. Bugenhagen, H. J. Jacob, et al.
Molecular networks in Dahl salt-sensitive hypertension based on transcriptome analysis of a panel of consomic rats
Physiol Genomics, June 1, 2008; 34(1): 54 - 64.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
Z. Tian, A. S. Greene, K. Usa, I. R. Matus, J. Bauwens, J. L. Pietrusz, A. W. Cowley Jr, and M. Liang
Renal Regional Proteomes in Young Dahl Salt-Sensitive Rats
Hypertension, April 1, 2008; 51(4): 899 - 904.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
Y. Liu, F. Park, J. L. Pietrusz, G. Jia, R. J. Singh, B. C. Netzel, and M. Liang
Suppression of 11{beta}-hydroxysteroid dehydrogenase type 1 with RNA interference substantially attenuates 3T3-L1 adipogenesis
Physiol Genomics, February 19, 2008; 32(3): 343 - 351.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/F186    most recent
00484.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Usa, K.
Right arrow Articles by Liang, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Usa, K.
Right arrow Articles by Liang, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.