AJP - Renal AJP: Gastrointestinal and Liver Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 293: F325-F332, 2007. First published May 9, 2007; doi:10.1152/ajprenal.00158.2007
0363-6127/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/F325    most recent
00158.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramesh, G.
Right arrow Articles by Reeves, W. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramesh, G.
Right arrow Articles by Reeves, W. B.

Endotoxin and cisplatin synergistically induce renal dysfunction and cytokine production in mice

Ganesan Ramesh,1 Binzhi Zhang,1 Satoshi Uematsu,2 Shizuo Akira,2 and W. Brian Reeves1,3

1Division of Nephrology, Pennsylvania State University College of Medicine, Hershey; 3Lebanon Veterans Affairs Medical Center, Lebanon, Pennsylvania; and 2Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan

Submitted 4 April 2007 ; accepted in final form 3 May 2007


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
A major toxicity of the cancer chemotherapeutic agent cisplatin is acute renal failure. Sepsis is a common cause of acute renal failure in humans and patients who receive cisplatin are at increased risk for sepsis. Accordingly, this study examined the interactions between cisplatin and endotoxin in vivo with respect to renal function and cytokine production. Mice were treated with either a single dose of cisplatin or two doses of LPS administered 24 h apart, or both agents in combination. Administration of 10 mg/kg cisplatin had no effect on blood urea nitrogen or creatinine levels throughout the course of the study. LPS resulted in a modest rise in blood urea nitrogen at 24 and 48 h, which returned to normal by 72 h. In contrast, mice treated with both cisplatin and LPS developed severe renal failure and an increase in mortality. Urine, but not serum, TNF-{alpha} levels showed a synergistic increase by cisplatin and LPS. Urinary IL-6, MCP-1, KC, and GM-CSF also showed a synergistic increase with cisplatin+LPS treatment. The renal dysfunction induced by cisplatin+LPS was completely dependent on TLR4 signaling and partially dependent on TNF-{alpha} production. Increased cytokine production was associated with a moderate increase in infiltrating leukocytes which was not different between cisplatin+LPS and LPS alone. These results indicate that cisplatin and LPS act synergistically to produce nephrotoxicity which may involve proinflammatory cytokine production.

tumor necrosis factor-{alpha}; Toll-like receptor 4; sepsis; acute renal failure; cytokines


ACUTE RENAL FAILURE can develop in a variety of clinical situations such as ischemia, sepsis, and administration of nephrotoxic agents. Studies using experimental models of acute renal failure have identified a large number of putative pathophysiological mediators (33, 35). The majority of these studies have employed models of acute renal injury subsequent to a single renal insult (20). However, acute renal failure in humans often occurs in complex clinical settings in which patients may be exposed to a number of different renal insults (35). It has been suggested that the failure in humans of therapeutic interventions based on single-insult animal studies may be due, in part, to the multiplicity of renal insults in human acute renal failure (12, 20).

Sepsis is a common cause of acute renal failure, accounting for up to 60% of cases in some series (2, 32). TNF-{alpha} is an important mediator of the systemic and renal effects of sepsis (3, 15). The production of TNF-{alpha} in sepsis results from the activation of TLR receptors by bacterial products such as endotoxin (1, 4, 5). In previous animal studies, we and others (27, 29, 30, 36, 37) also demonstrated an important role for TNF-{alpha} in the pathogenesis of cisplatin-induced renal injury. Inhibition of TNF-{alpha} production or action markedly reduced the nephrotoxicity of cisplatin (29, 30). Against this background, Zager et al. (44) reported that treatment of mice with both cisplatin and endotoxin resulted in augmented production of proinflammatory cytokines, including TNF-{alpha}, by the kidney and speculated that this inflammatory response might be responsible for some of the extrarenal complications seen in patients with acute renal failure. We subsequently determined that the synergy between cisplatin and endotoxin in stimulating TNF-{alpha} production by proximal tubule cells derives from both an endotoxin-induced increase in TNF-{alpha} gene transcription (26) and a cisplatin-induced increase in TNF-{alpha} mRNA translation (26). The latter was critically dependent on activation of p38 MAPK (26).

While these studies (26, 44) clearly showed that cisplatin priming before endotoxin treatment enhances cytokine production by proximal tubule epithelial cells in vitro and kidney in vivo, the impact of this increased cytokine production on renal function is unknown. The present studies examined the effects of treatment with both cisplatin and endotoxin on renal function, renal cytokine production, and cytokine excretion. In addition, the signaling pathways which mediate these effects were explored. The results demonstrate a marked synergy between cisplatin and endotoxin in producing acute renal failure. This synergy was only partially dependent on TNF-{alpha} production but completely dependent on TLR4 signaling. These interactions between cisplatin and endotoxin might predispose patients to cisplatin nephrotoxicity in the presence of infection.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Drug administration. Experiments were performed using 8- to 10-wk-old male C57BL/6, TNF knockout (KO), and TLR4 KO mice weighing ~25–30 g. The TNF-{alpha}-deficient mice on a C57BL6 background were obtained from B and K Universal (East Yorkshire, UK). The TLR 4 knockout mice, also on a C57BL6 background, have been described previously (11). Cisplatin (Sigma, St. Louis, MO) was dissolved in saline at a concentration of 1 mg/ml and filtered through a 0.2-µm syringe filter. Escherichia coli LPS (Sigma) was dissolved in saline at a concentration of 0.25 mg/ml. The protocol for drug administration is provided in Fig. 1. Mice were given a single intraperitoneal injection of either vehicle (saline) or cisplatin (10 mg/kg body wt) at t = 0. Mice were then administered either saline or LPS (2.5 mg/kg body wt) by intraperitoneal injection at 6 and 24 h after the cisplatin injection. Blood and urine samples were collected at the indicated times for measurement of urea nitrogen, creatinine, and cytokines. Urine was harvested by bladder massage. All animal protocols were approved by the Institutional Animal Care and Use Committee of the Penn State University College of Medicine.


Figure 1
View larger version (8K):
[in this window]
[in a new window]

 
Fig. 1. Experimental protocol. Mice were administered either vehicle (saline), cisplatin, or LPS by intraperitoneal injection at the indicated times. Urine and blood samples were collected at the indicated times.

 
Renal function. Renal function was assessed by measurements of blood urea nitrogen (BUN; VITROS DT60II Chemistry slides, Ortho-clinical Diagnostics) and serum creatinine (DZ072B, Diazyme Labs).

Histology and histochemistry. Kidney tissue was fixed in buffered formalin for 24 h and then embedded in paraffin wax. Five-micrometer sections were stained with periodic acid-Schiff (PAS) or naphthol AS-D chloroacetate esterase (kit no. 91A; Sigma). The esterase stain identifies infiltrating neutrophils and monocytes. Twenty x40 fields of esterase-stained sections were examined for quantitation of leukocytes. Tubular injury was assessed in PAS-stained sections using a semiquantitative scale (13) in which the percentage of cortical tubules showing epithelial necrosis was assigned a score: 0 = normal, 1 = <10%, 2 = 10–25%, 3 = 26–75%, 4 = >75%. The individuals scoring the slides were blinded to the treatment and strain of the animal.

Quantitation of mRNA by real-time RT-PCR. Real-time RT-PCR was performed in an Applied Biosystems 7700 Sequence Detection System (Foster City, CA). Total RNA (1.5 µg) was reverse transcribed in a reaction volume of 20 µl using Omniscript RT kit and random primers. The product was diluted to a volume of 150 µl and either 2-µl (actin) or 10-µl (all others) aliquots were used as templates for amplification using the SYBR Green PCR amplification reagent (Qiagen) and gene-specific primers. The primer sets used were mouse IL-1beta (forward: CTCCATGAGCTTTGTACAAGG; reverse: TGCTGATGTACCAGTTGGGG), TNF-{alpha} (forward: GCATGATCCGCGACGTGGAA; reverse: AGATCCATGCCGTTG GCCAG), Heme Oxygenase-1 (forward: AGCATGCCCCAGGATTTG; reverse: AGCTCAATGTTGAGCAGGA), IL-18 (forward: ACTGTACAACCGCAGTAATACGG; reverse: AGTGAACATTACAGATTTATCCC). MCP-1 (forward: ATGCAGGTCCCTGTCATG; reverse: GCTTGAGGTGGTTGTGGA), ICAM-1 (forward: AGATCACATTCACGGTGCTG; reverse: CTTCAGAGGCAGGAAACAGG), TLR4 (forward: CCTCTGCCTTCACTACAGAGACTTT; reverse: TGTGGAAGCCTTCCTGGAG), and HMG1 (forward: TCGGCCTTCTTCTTGTTCTG; reverse: CTTCAGCTTGGCAGCTTTCT). The amount of DNA was normalized to the beta-actin signal amplified in a separate reaction (forward primer: AGAGGGAAATCGTGCGTGAC; reverse: CAATAGTGATGACCTGGCCGT).

Cytokine/chemokine quantitation. The levels of TNF-{alpha} in blood and urine were quantitated using an ELISA assay (Quantikine Mouse TNF-{alpha} kit; R&D Systems, Minneapolis, MN). Fifty microliters of serum were used for the TNF-{alpha} assay. Urine cytokines and chemokines [IL-1beta, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12 (p70), IL-17, IFN-{gamma}, IP-10, G-CSF, MIP-1{alpha}, MCP-1, RANTES] were measured using a bead-based multiplexed cytokine analysis kit (Linco Research, St. Charles, MO) using a Luminex-100 system (Luminex, Austin, TX). Assays were run in duplicate according to the manufacturer's protocol and data were collected and analyzed using MasterPlex QT 2.5 software (MiraiBio, Alameda, CA). Amounts of cytokines were normalized to the creatinine concentration in the urine.

Statistical methods. All assays were performed in duplicate. The data are reported as means ± SE. Statistical significance was assessed by unpaired, two-tailed Student's t-tests for single comparisons or ANOVA for multiple comparisons.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mice were treated with either 10 mg/kg cisplatin, 2.5 mg/kg LPS, or both. The doses of cisplatin (preliminary data) and LPS (15) were selected to produce limited nephrotoxicity alone. As shown in Fig. 2, mice receiving 10 mg/kg cisplatin alone had only a slight increase in BUN at 72 h and no change in the serum creatinine concentration. Mice receiving two consecutive doses of LPS displayed modest increases in BUN and serum creatinine at 24 and 48 h which returned to baseline by 72 h. In contrast, mice which received both the cisplatin and LPS had an early rise in both BUN and creatinine which continued to increase throughout the course of observation. The mortality rate at 72 h for the cisplatin- or LPS-treated mice was 0% but was 44% for mice treated with both cisplatin and LPS.


Figure 2
View larger version (8K):
[in this window]
[in a new window]

 
Fig. 2. Effect of cisplatin (Cis), LPS, and both cisplatin and LPS on renal function. Values for blood urea nitrogen (BUN; A) and creatinine (B) are means ± SE, n = 8–12 mice per group. *P < 0.01 vs. all others. +P < 0.05 vs. saline and cisplatin.

 
The deleterious effects of the combination of cisplatin and LPS were also reflected by histologic changes. As shown in Fig. 3, mice treated with either cisplatin or LPS alone, and killed at 72 h, displayed almost normal renal histology. In contrast, mice which received both the cisplatin and LPS had evidence of tubular injury such as dilation of tubules, vacuole formation, and necrosis. Semiquantitative scoring of tubular injury yielded scores of 0.3 ± 0.1 for saline-treated animals, 0.4 ± 0.07 for LPS-treated animals, 1.5 ± 0.5 for cisplatin-treated mice, and 2.6 ± 0.26 for mice receiving both cisplatin and LPS (n = 4–6). The tubular injury score of the cisplatin+LPS-treated mice was significantly higher than saline- or LPS-treated mice (P < 0.01).


Figure 3
View larger version (151K):
[in this window]
[in a new window]

 
Fig. 3. Histology of kidneys from mice treated with saline (A), cisplatin (B), LPS (C), or both cisplatin and LPS (D). Tissues were harvested 72 h after the initial treatment. Magnification x200.

 
Since TNF-{alpha} is known to contribute to the pathogenesis of both endotoxin and cisplatin-induced nephrotoxicity (3, 29, 30), we measured TNF-{alpha} levels in blood and urine (Fig. 4). The low dose of cisplatin had no effect on blood TNF-{alpha} levels. As expected, LPS produced a robust rise in serum TNF-{alpha} which returned to baseline by 48 h. Mice treated with both cisplatin and LPS had a similar magnitude increase in serum TNF-{alpha}. Although the duration of the TNF-{alpha} peak appeared to persist somewhat longer than in mice which received only LPS, this was not a consistent finding (see GoGoGoGoFig. 9). Urinary excretion of TNF-{alpha} was not increased by cisplatin alone. LPS alone resulted in a transient increase in urine TNF-{alpha}. However, the combination of cisplatin and LPS resulted in significantly higher urinary TNF-{alpha} than did LPS alone.


Figure 4
View larger version (8K):
[in this window]
[in a new window]

 
Fig. 4. Effect of cisplatin and LPS on serum (A) and urine levels (B) of TNF-{alpha}, n = 9–12 mice per group. *P < 0.01 vs. saline or cisplatin. +P < 0.05 vs. LPS.

 

Figure 5
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 5. Effect of cisplatin (CIS) and LPS on renal gene expression and cytokine levels. A: expression levels of the indicated genes were determined by real-time RT-PCR. Gene expression levels are expressed relative to levels in control (saline-treated) mice. B: levels of the indicated cytokines were determined in kidney tissue homogenates using ELISA. Tissue samples were collected 72 h after the initial treatment, n = 4–8. *P < 0.05 vs. control or cisplatin.

 

Figure 6
View larger version (7K):
[in this window]
[in a new window]

 
Fig. 6. Effect of cisplatin and LPS on renal leukocyte infiltration. Sections of kidney harvested 72 h after the indicated treatments were stained for leukocytes as described in METHODS. Twenty x40 fields of kidney cortex were examined from each animal. The total number of leukocytes in those 20 fields is presented. *P < 0.05 vs. saline, n = 4–5.

 

Figure 7
View larger version (22K):
[in this window]
[in a new window]

 
Fig. 7. Urinary cytokine excretion in mice treated with cisplatin and/or LPS. Urine samples were collected at 9 (A) and 27 (B) h after the initial injection, i.e., 3 h following each LPS injection. All values are indexed to the creatinine concentration in the urine sample, n = 2–4. *P < 0.05 vs. saline or LPS. +P < 0.05 vs. saline.

 

Figure 8
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 8. Role of TLR4 in the response to cisplatin and/or LPS treatment. Wild-type (WT) or TLR4-deficient mice were treated with saline, cisplatin, and/or LPS according to the protocol in Fig. 1. Blood urea nitrogen (BUN; A) and serum creatinine (B) were measured as indexes of renal function, n = 3–5. *P < 0.01 vs. all other groups. +P < 0.01 vs. LPS/TLR4 knockout.

 

Figure 9
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 9. Role of TLR4 in the effects of cisplatin and LPS on serum (A) and urine (B) levels of TNF-{alpha}, n = 4–5 mice per group. *P < 0.01 vs. TLR4 knockout (KO).

 
TNF-{alpha} drives the expression of a variety of other cytokines during cisplatin toxicity (29). We measured the expression of various cytokine genes and protein levels within the kidney after treatment with cisplatin, LPS, or both. As noted in Fig. 5, several inflammatory genes, e.g., IL-1beta, IL-6, MCP-1, and ICAM, were increased by LPS and the combination of cisplatin and LPS. However, there were no significant differences between the levels of expression between LPS and cisplatin plus LPS mice. Low-dose cisplatin had no significant effect on the expression of any of these genes. Levels of MCP-1 and MIP-2 protein were significantly elevated in kidney cortex from LPS-treated mice and cisplatin plus LPS mice. TNF-{alpha} levels in the medulla were increased by LPS and by LPS plus cisplatin. There was no synergy noted between cisplatin and LPS in the kidney content of TNF-{alpha}, MCP-1, or MIP-2 proteins. Consistent with the upregulation of chemokines and adhesion molecules, leukocyte infiltration into the kidney was increased after LPS administration but there was no further increase seen in kidneys from cisplatin plus LPS-treated mice (Fig. 6).

Urinary cytokine excretion is elevated in humans with acute renal failure and may have prognostic significance (16, 22). We measured urinary cytokines using a multiplex immunoassay (Fig. 7). Urine was collected 3 h after each injection of LPS, i.e., at either 9 or 27 h after the initial cisplatin injection. At both times, a number of cytokines were markedly elevated in urine from LPS- and cisplatin plus LPS-treated mice. In particular, KC and G-CSF showed synergy between cisplatin and LPS at the 27-h time point.

The TLR4 receptor and TNF-{alpha} are believed to mediate many of the actions of endotoxin (1), including acute renal injury (3, 4). We examined the interactions between cisplatin and LPS in mice deficient of either TLR4 or TNF-{alpha}. TLR4-deficient mice (Fig. 8) developed only modest renal dysfunction in response to cisplatin plus LPS at day 3 and did not respond to LPS alone. The degree of renal dysfunction in the TLR4-deficient mice treated with cisplatin and LPS (BUN = 63 ± 13 mg/dl) was similar to that seen in wild-type mice treated with cisplatin alone (50 ± 18 mg/dl; Fig. 2), suggesting that LPS has no added effect with cisplatin in the absence of TLR4. Likewise, serum and urine TNF-{alpha} responses to LPS were absent in the TLR4-deficient mice (Fig. 9), also indicating that the TLR4 receptor is essential in mediating LPS actions on renal function and TNF-{alpha} production. TNF-{alpha}-deficient mice treated with LPS plus cisplatin sustained less renal dysfunction than wild-type mice (Fig. 10), but more than TNF-{alpha}-deficient mice treated with either cisplatin or LPS alone. Thus synergy between cisplatin and LPS in producing renal dysfunction is entirely dependent on TLR4 signaling, and partially dependent on TNF-{alpha} production.


Figure 10
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 10. Role of TNF-{alpha} production in the response to cisplatin and/or LPS treatment. Wild-type or TNF-{alpha}-deficient (TNFKO) mice were treated with saline, cisplatin, and/or LPS. BUN (A) and serum creatinine (B) were measured as indexes of renal function, n = 4–6. *P < 0.05 vs. all other groups. +P < 0.001 vs. cisplatin or LPS.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The present study examined the interactions between two diverse renal insults, cisplatin and endotoxin, on renal function. Our results indicate that cisplatin and endotoxin exhibit remarkable synergy in producing renal dysfunction. Sepsis is a common cause of acute renal injury in humans (32). The pathophysiology of sepsis-induced acute renal failure is complex and involves hemodynamic factors (40, 42), inflammation (9, 19, 38), and cytotoxic injury (39). It is possible, based on the current results and the results of others (4345, 48), that a portion of the high incidence of acute renal failure in sepsis may be referable to sensitization of the kidney to other insults, such as nephrotoxins or ischemia, rather than to a direct effect of endotoxin. Another interpretation of these results is that cisplatin sensitizes the kidney to injury by endotoxin. Since both agents were required to produce severe renal injury, we cannot draw any conclusions regarding the primacy of the individual insults. Nonetheless, the observations support the view that interactions between disparate, mild renal insults may lead to profound renal failure. These types of interactions may account for what clinicians have long recognized as "multifactorial" acute renal failure.

The current study was predicated on previous in vitro and in vivo evidence that cisplatin and endotoxin exhibit synergy with respect to the production of TNF-{alpha}, an important mediator of renal injury (25, 26, 44). It was interesting, then, to find that the combination of cisplatin and endotoxin resulted in only a slight increase in serum TNF-{alpha} levels compared with those produced in response to endotoxin alone. Urinary TNF-{alpha}, however, was elevated to a much greater extent in mice treated with cisplatin and endotoxin vs. endotoxin alone. The observation that urinary TNF-{alpha} levels at 24 h differed between the LPS and cisplatin plus LPS mice even though serum TNF-{alpha} levels were similar and that urine TNF-{alpha} levels at 48 h had dropped to near baseline in the face of persistent elevations in serum TNF-{alpha} suggests that urinary TNF-{alpha} does not derive primarily from glomerular filtration. Rather, the increase in urinary TNF-{alpha} may reflect increased intrarenal production of TNF-{alpha}. In this regard, we (49) recently demonstrated that production of TNF-{alpha} by parenchymal cells, rather than by infiltrating inflammatory cells, mediates cisplatin nephrotoxicity. The contribution of TNF-{alpha} production to the renal failure observed upon treatment with cisplatin and endotoxin was evaluated using TNF-deficient mice (Fig. 10). These experiments indicated that TNF-{alpha} production accounted for a large portion, although not all, of the synergistic renal toxicity in this setting. The failure of TNF-{alpha} deletion to completely abrogate synergy between cisplatin and endotoxin suggests that endotoxin elicits the production of additional mediators of injury. Indeed, as discussed below, urinary IL-6 and KC are increased by endotoxin and both have been implicated in causing acute kidney injury (14, 18, 23). It is also worth mentioning that in previous studies (2830), we demonstrated that cisplatin alone increased serum, urine, and kidney levels of TNF-{alpha} while in this report cisplatin had a minimal effect on serum and urine TNF-{alpha} levels. This discrepancy likely relates to the lower dose of cisplatin used in this study and the lack of significant nephrotoxicity.

The TLR4 receptor in conjunction with CD14 and MD-2 is the primary receptor for gram negative endotoxins (11, 41). Although endotoxin by itself can produce acute renal failure in animal models (3, 4, 15), the role of endotoxin in the pathogenesis of clinical septic acute renal failure is not clear. In both an animal model of sepsis, the cecal ligation and puncture model (5), and in human postsurgical sepsis (8), no clear dependence on TLR4 could be demonstrated. However, through the use of TLR4 knockout mice, we were able to show an absolute dependence on TLR4 signaling for the synergistic production of TNF-{alpha} and also functional renal injury resulting from the combination of cisplatin and endotoxin.

Enhanced TLR-mediated inflammatory responses in the setting of tissue injury have been reported previously. For example, acute thermal injury, lung injury, and hemorrhagic shock result in increased production of various proinflammatory cytokines by monocytes in response to TLR2 and TLR4 ligands (7, 24). In the kidney, Zager and colleagues (44, 45, 47) demonstrated enhanced TLR2- and TLR4-induced cytokine production in the setting of cisplatin, ischemia, obstruction, or glycerol-induced renal injury. The present study confirms the hyperresponsiveness to TLR4 agonists and demonstrates that the hyperresponsiveness contributes to the development of renal failure. The mechanism of the hyperresponsiveness is not understood. In the thermal injury model, no changes in monocyte TLR2 or TLR4 expression were demonstrated (24). Although El-Achkar et al. (6) reported an increase in renal TLR4 expression in sepsis, Zager et al. (46, 47) were unable to demonstrate any increase in kidney TLR4 protein levels after either cisplatin or endotoxin treatment. Likewise, we did not detect any impact of cisplatin, endotoxin, or combined treatment on kidney TLR4 mRNA expression (Fig. 5). Rather, changes in the downstream signaling pathways mediating TLR4 responses, such as p38 MAPK, may be responsible.

Evidence for an enhanced inflammatory response within the kidney also emerged from an examination of urinary cytokine excretion. In recent work, we reported that several urinary cytokines/chemokines, including IL-2, IL-6, and RANTES, were increased at 72 h after injection of high-dose cisplatin (49), i.e., during established renal injury. The current results indicate that, in addition to TNF-{alpha}, several urinary cytokines were markedly elevated by endotoxin treatment at early time points, 9 and 27 h after cisplatin injection. Of these, KC, IL-6, G-CSF, and GM-CSF were increased to a greater extent by the combination of endotoxin and cisplatin vs. either agent alone. Increased renal expression of KC, a neutrophil chemotactic factor, was first reported following renal ischemia by Safirstein et al. (31). Likewise, increased urine and serum KC has been found after renal ischemia (10, 21). Based on the current results, urinary KC may be a more general marker of renal injury. An increase in G-CSF expression in the kidney has been demonstrated after ischemia (50), but elevations in urine G-CSF levels in acute renal failure have not been previously reported. IL-6 has been incriminated in the pathogenesis of ischemic acute renal failure (14, 23). Increases in urine and serum IL-6 in human acute renal failure correlate with duration of renal failure and mortality (16, 34). We also observed large increases in urine IL-6 following endotoxin injection, but not after the low dose of cisplatin alone. Taken together, these observations support the notion that renal inflammation is present during endotoxin- and cisplatin-induced acute renal injury and that measurements of urinary cytokines may be useful as early markers of injury.

We speculate that activation of p38 MAPK may account for the synergistic toxicity noted between endotoxin and cisplatin. We previously demonstrated that cisplatin increases renal p38 MAPK activity and that this is critical to cisplatin-induced production of TNF-{alpha} by renal epithelial cells and the resulting renal injury (27). We also found that the activation of p38 MAPK is crucial, via an increase in mRNA translation, to the synergy between cisplatin and endotoxin in stimulating TNF-{alpha} production by cultured renal proximal tubule cells (25). Since TNF-{alpha} is an important mediator of the renal injury observed here (Fig. 10), the activation of p38 MAPK and subsequent TNF-{alpha} production may account for the synergistic renal injury from cisplatin and endotoxin in vivo.

Finally, based on the present results, one can speculate that coexisting infections might influence an individual's susceptibility to developing cisplatin nephrotoxicity. Likewise, acquired or genetic differences in TLR4 signaling or downstream effector pathways, such as NF-{kappa}B activation or TNF-{alpha} production and action, might also influence the risk of cisplatin nephrotoxicity. If so, knowledge of these determinants could be used to guide the clinical use of cisplatin.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant RO1-DK-063120 to W. B. Reeves, the Veterans Affairs Medical Research Service, and an Alyce Spector Research Grant from the Kidney Foundation of Central Pennsylvania. G. Ramesh was a fellow of the National Kidney Foundation when portions of this work were performed.


    ACKNOWLEDGMENTS
 
We acknowledge the excellent technical support provided by W. W. Wang.


    FOOTNOTES
 

Address for reprint requests and other correspondence: W. B. Reeves, Division of Nephrology, Rm C5830, Pennsylvania State College of Medicine, 500 Univ. Dr., Hershey, PA 17033 (e-mail: wreeves{at}psu.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Akira S. Toll-like receptors: lessons from knockout mice. Biochem Soc Trans 28: 551–556, 2000.[Web of Science][Medline]
  2. Brivet FG, Kleinknecht DJ, Loirat P, Landais PJ. Acute renal failure in intensive care units–causes, outcome, and prognostic factors of hospital mortality; a prospective, multicenter study. Crit Care Med 24: 192–198, 1996.[CrossRef][Web of Science][Medline]
  3. Cunningham PN, Dyanov HM, Park P, Wang J, Newell KA, Quigg RJ. Acute renal failure in endotoxemia is caused by TNF acting directly on TNF receptor-1 in kidney. J Immunol 168: 5817–5823, 2002.[Abstract/Free Full Text]
  4. Cunningham PN, Wang Y, Guo R, He G, Quigg RJ. Role of toll-like receptor 4 in endotoxin-induced acute renal failure. J Immunol 172: 2629–2635, 2004.[Abstract/Free Full Text]
  5. Dear JW, Yasuda H, Hu X, Hieny S, Yuen PST, Hewitt SM, Sher A, Star RA. Sepsis-induced organ failure is mediated by different pathways in the kidney and liver: acute renal failure is dependent on MyD88 but not renal cell apoptosis. Kidney Int 69: 832–836, 2006.[CrossRef][Web of Science][Medline]
  6. El-Achkar TM, Huang X, Plotkin Z, Sandoval RM, Rhodes GJ, Dagher PC. Sepsis induces changes in the expression and distribution of Toll-like receptor 4 in the rat kidney. Am J Physiol Renal Physiol 290: F1034–F1043, 2006.[Abstract/Free Full Text]
  7. Fan J, Kapus A, Marsden PA, Li YH, Oreopoulos G, Marshall JC, Frantz S, Kelly RA, Medzhitov R, Rotstein OD. Regulation of Toll-like receptor 4 expression in the lung following hemorrhagic shock and lipopolysaccharide. J Immunol 168: 5252–5259, 2002.[Abstract/Free Full Text]
  8. Feterowski C, Emmanuilidis K, Miethke T, Gerauer K, Rump M, Ulm K, Holzmann B, Weighardt H. Effects of functional Toll-like receptor-4 mutations on the immune response to human and experimental sepsis. Immunology 109: 426–431, 2003.[CrossRef][Web of Science][Medline]
  9. Gupta A, Berg DT, Gerlitz B, Sharma GR, Syed S, Richardson MA, Sandusky G, Heuer JG, Galbreath EJ, Grinnell BW. Role of protein C in renal dysfunction after polymicrobial sepsis. J Am Soc Nephrol 18: 860–867, 2007.[Abstract/Free Full Text]
  10. Hoke TS, Douglas IS, Klein CL, He Z, Fang W, Thurman JM, Tao Y, Dursun B, Voelkel NF, Edelstein CL, Faubel S. Acute renal failure after bilateral nephrectomy is associated with cytokine-mediated pulmonary injury. J Am Soc Nephrol 18: 155–164, 2007.[Abstract/Free Full Text]
  11. Hoshino K, Takeuchi O, Kawai T, Sanjo H, Ogawa T, Takeda Y, Takeda K, Akira S. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the LPS gene product. J Immunol 162: 3749–3752, 1999.[Abstract/Free Full Text]
  12. Kelly KJ, Molitoris BA. Acute renal failure in the new millennium: time to consider combination therapy. Semin Nephrol 20: 4–19, 2000.[Web of Science][Medline]
  13. Kelly KJ, Williams WW, Colvin RB, Bonventre JV. Antibody to intercellular adhesion molecule-1 protects the kidney against ischemic injury. Proc Natl Acad Sci USA 91: 812–816, 1994.[Abstract/Free Full Text]
  14. Kielar ML, John R, Bennett M, Richardson JA, Shelton JM, Chen L, Jeyarajah DR, Zhou XJ, Zhou H, Chiquett B, Nagami GT, Lu CY. Maladaptive role of IL-6 in ischemic acute renal failure. J Am Soc Nephrol 16: 3315–3325, 2005.[Abstract/Free Full Text]
  15. Knotek M, Rogachev B, Wang W, Ecder T, Melnikov V, Gengaro PE, Esson M, Edelstein CL, Dinarello CA, Schrier RW. Endotoxemic renal failure in mice: role of tumor necrosis factor independent of inducible nitric oxide synthase. Kidney Int 59: 2243–2249, 2001.[Web of Science][Medline]
  16. Kwon O, Molitoris BA, Pescovitz M, Kelly KJ. Urinary actin, interleukin-6 and interkeukin-8 may predict sustained ARF after ischemic injury in renal allografts. Am J Kidney Dis 41: 1074–1087, 2003.[CrossRef][Web of Science]
  17. Miura M, Fu X, Zhang QW, Remick DG, Fairchild RL. Neutralization of Gro{alpha} and macrophage inflammatory protein-2 attenuates renal ischemia/reperfusion injury. Am J Pathol 159: 2137–2145, 2001.[Abstract/Free Full Text]
  18. Miyaji T, Hu X, Yuen PST, Muramatsu Y, Iyer S, Hewitt SM, Star RA. Ethyl pyruvate decreases sepsis-induced acute renal failure and multiple organ damage in aged mice. Kidney Int 64: 1620–1631, 2003.[CrossRef][Web of Science][Medline]
  19. Molitoris BA, Weinberg JM, Venkatachalam MA, Zager RA, Nath KA, Goligorsky MS. Acute renal failure. II. Experimental models of acute renal failure: imperfect but indispensable. Am J Physiol Renal Physiol 278: F1–F12, 2000.[Abstract/Free Full Text]
  20. Molls RR, Savransky V, Liu M, Bevans S, Mehta T, Tuder RM, King LS, Rabb H. Keratinocyte-derived chemokine is an early biomarker of ischemic acute kidney injury. Am J Physiol Renal Physiol 290: F1187–F1193, 2006.[Abstract/Free Full Text]
  21. Parikh C, Abraham E, Ancukiewicz M, Edelstein C. Urine IL-18 is an early diagnostic marker for acute kidney injury and predicts mortality in the intensive care unit. J Am Soc Nephrol 16: 3046–3052, 2005.[Abstract/Free Full Text]
  22. Patel NSA, Chatterjee PK, Di Paola R, Mazzon E, Britti D, De Sarro A, Cuzzocrea S, Thiemermann C. Endogenous interleukin-6 enhances the renal injury, dysfunction, and inflammation caused by ischemia/reperfusion. J Pharmacol Exp Ther 312: 1170–1178, 2005.[Abstract/Free Full Text]
  23. Paterson HM, Murphy TJ, Purcell EJ, Shelley O, Kriynovich SJ, Lien E, Mannick JA, Lederer JA. Injury primes the innate immune system for enhanced Toll-like receptor reactivity. J Immunol 171: 1473–1483, 2003.[Abstract/Free Full Text]
  24. Ramesh G, Kimball SR, Jefferson LS, Reeves WB. Endotoxin and cisplatin synergistically stimulate TNF-{alpha} production by renal epithelial cells. Am J Physiol Renal Physiol 292: F812–F819, 2007.[Abstract/Free Full Text]
  25. Ramesh G, Reeves WB. Cisplatin increases TNF-{alpha} mRNA stability in kidney proximal tubule cells. Ren Fail 28: 583–592, 2006.[CrossRef][Web of Science][Medline]
  26. Ramesh G, Reeves WB. p38 MAP kinase inhibition ameliorates cisplatin nephrotoxicity in mice. Am J Physiol Renal Physiol 289: F166–F174, 2005.[Abstract/Free Full Text]
  27. Ramesh G, Reeves WB. Salicylate reduces cisplatin nephrotoxicity by inhibition of tumor necrosis factor-{alpha}. Kidney Int 65: 490–498, 2004.[CrossRef][Web of Science][Medline]
  28. Ramesh G, Reeves WB. TNF-{alpha} mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J Clin Invest 110: 835–842, 2002.[CrossRef][Web of Science][Medline]
  29. Ramesh G, Reeves WB. TNFR2-mediated apoptosis and necrosis in cisplatin-induced acute renal failure. Am J Physiol Renal Physiol 285: F610–F618, 2003.[Abstract/Free Full Text]
  30. Safirstein R, Megyesi J, Saggi SJ, Price PM, Poon M, Rollins BJ, Taubman MB. Expression of cytokine-like genes JE and KC is increased during renal ischemia. Am J Physiol Renal Fluid Electrolyte Physiol 261: F1095–F1101, 1991.[Abstract/Free Full Text]
  31. Schrier RW, Wang W. Acute renal failure and sepsis. N Engl J Med 351: 159–169, 2004.[Free Full Text]
  32. Schrier RW, Wang W, Poole B, Mitra A. Acute renal failure: definitions, diagnosis, pathogenesis, and therapy. J Clin Invest 114: 5–14, 2004.[CrossRef][Web of Science][Medline]
  33. Simmons E, Himmelfarb J, Sezer M, Chertow G, Mehta R, Paganini E, Soroko S, Freedman S, Becker K, Spratt D, Shyr Y, Ikizler T. Plasma cytokine levels predict mortality in patients with acute renal failure. Kidney Int 65: 1357–1365, 2004.[CrossRef][Web of Science][Medline]
  34. Thadhani R, Pascual M, Bonventre JV. Medical progress–acute renal failure. N Engl J Med 334: 1448–1460, 1996.[Free Full Text]
  35. Tsuruya K, Ninomiya T, Tokumoto M, Hirakawa M, Matsutani K, Taniguchi M, Fukuda K, Kanai H, Kishihara K, Hirakata H, Iida M. Direct involvement of the receptor-mediated apoptotic pathways in cisplatin-induced renal tubular cell death. Kidney Int 63: 72–82, 2003.[Web of Science][Medline]
  36. Tsuruya K, Tokumoto M, Ninomiya T, Hirakawa M, Matsutani K, Taniguchi M, Fukuda K, Kanai H, Hirakata H, Iida M. Antioxidant ameliorates cisplatin-induced renal tubular cell death through inhibition of death receptor-mediated pathways. Am J Physiol Renal Physiol 285: F208–F218, 2003.[Abstract/Free Full Text]
  37. Wang W, Faubel S, Ljubanovic D, Mitra A, Falk SA, Kim J, Tao Y, Soloviev A, Reznikov LL, Dinarello CA, Schrier RW, Edelstein CL. Endotoxemic acute renal failure is attenuated in caspase-1-deficient mice. Am J Physiol Renal Physiol 288: F997–F1004, 2005.[Abstract/Free Full Text]
  38. Wang W, Jittikanont S, Falk SA, Li P, Feng L, Gengaro PE, Poole BD, Bowler RP, Day BJ, Crapo JD, Schrier RW. Interaction among nitric oxide, reactive oxygen species, and antioxidants during endotoxemia-related acute renal failure. Am J Physiol Renal Physiol 284: F532–F537, 2003.[Abstract/Free Full Text]
  39. Wang W, Zolty E, Falk S, Basava V, Reznikov L, Schrier R. Pentoxifylline protects against endotoxin-induced acute renal failure in mice. Am J Physiol Renal Physiol 291: F1090–F1095, 2006.[Abstract/Free Full Text]
  40. West PA, Koblansky AA, Ghosh S. Recognition and signaling by Toll-like receptors. Annu Rev Cell Dev Biol 22: 409–437, 2006.[CrossRef][Web of Science][Medline]
  41. Wu L, Tiwari MM, Messer KJ, Holthoff JH, Gokden N, Brock RW, Mayeux PR. Peritubular capillary dysfunction and renal tubular epithelial cell stress following lipopolysaccharide administration in mice. Am J Physiol Renal Physiol 292: F261–F268, 2007.[Abstract/Free Full Text]
  42. Zager RA. Escherichia coli endotoxin injections potentiate experimental ischemic renal injury. Am J Physiol Renal Fluid Electrolyte Physiol 251: F988–F994, 1986.[Abstract/Free Full Text]
  43. Zager RA, Johnson ACM, Hanson SY, Lund S. Acute nephrotoxic and obstructive injury primes the kidney to endotoxin-driven cytokine/chemokine production. Kidney Int 69: 1181–1188, 2006.[CrossRef][Web of Science][Medline]
  44. Zager RA, Johnson ACM, Hanson SY, Lund S. Ischemic proximal tubular injury primes mice to endotoxin-induced TNF-{alpha} generation and systemic release. Am J Physiol Renal Physiol 289: F289–F297, 2005.[Abstract/Free Full Text]
  45. Zager RA, Johnson ACM, Lund S. "Endotoxin tolerance": TNF-{alpha} hyperreactivity and tubular cytoresistance in a renal cholesterol loading state. Kidney Int 71: 496–503, 2007.[CrossRef][Web of Science][Medline]
  46. Zager RA, Johnson ACM, Lund S, Hanson S. Acute renal failure: determinants and characteristics of the injury-induced hyperinflammatory response. Am J Physiol Renal Physiol 291: F546–F556, 2006.[Abstract/Free Full Text]
  47. Zager RA, Sharma HM. Gentamicin increases renal susceptibility to an acute ischemic insult. J Lab Clin Med 101: 670–678, 1983.[Web of Science][Medline]
  48. Zhang B, Ramesh G, Norbury C, Reeves WB. TNF-{alpha} produced by renal parenchymal cells mediates cisplatin nephrotoxicity. Kidney Int In press.
  49. Zhang Y, Woodward VK, Shelton JM, Richardson JA, Zhou XJ, Link D, Kielar ML, Jeyarajah DR, Lu CY. Ischemia-reperfusion induces G-CSF gene expression by renal medullary thick ascending limb cells in vivo and in vitro. Am J Physiol Renal Physiol 286: F1193–F1201, 2004.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
W. Wang, W. B. Reeves, L. Pays, P. Mehlen, and G. Ramesh
Netrin-1 Overexpression Protects Kidney from Ischemia Reperfusion Injury by Suppressing Apoptosis
Am. J. Pathol., September 1, 2009; 175(3): 1010 - 1018.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Naito, R. A. Zager, and K. Bomsztyk
BRG1 Increases Transcription of Proinflammatory Genes in Renal Ischemia
J. Am. Soc. Nephrol., August 1, 2009; 20(8): 1787 - 1796.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. Rosen and I. E. Stillman
Acute Tubular Necrosis Is a Syndrome of Physiologic and Pathologic Dissociation
J. Am. Soc. Nephrol., May 1, 2008; 19(5): 871 - 875.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
B. Zhang, G. Ramesh, S. Uematsu, S. Akira, and W. B. Reeves
TLR4 Signaling Mediates Inflammation and Tissue Injury in Nephrotoxicity
J. Am. Soc. Nephrol., May 1, 2008; 19(5): 923 - 932.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/F325    most recent
00158.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramesh, G.
Right arrow Articles by Reeves, W. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramesh, G.
Right arrow Articles by Reeves, W. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.