Am J Physiol Renal Physiol 293: F831-F838, 2007.
First published June 27, 2007; doi:10.1152/ajprenal.00005.2007
0363-6127/07 $8.00
Cyclosporine A induces senescence in renal tubular epithelial cells
Paul Jennings,1,*
Christian Koppelstaetter,2,*
Sonia Aydin,1
Thomas Abberger,1
Anna Maria Wolf,3
Gert Mayer,2 and
Walter Pfaller1
1Division of Physiology, Department of Physiology and Medical Physics, 2Division of Nephrology, and 3Division of Hematology and Oncology, Department of Internal Medicine, Innsbruck Medical University, Innsbruck, Austria
Submitted 3 January 2007
; accepted in final form 16 June 2007
 |
ABSTRACT
|
|---|
The nephrotoxic potential of the widely used immunosuppressive agent cyclosporine A (CsA) is well recognized. However, the mechanism of renal tubular toxicity is not yet fully elucidated. Chronic CsA nephropathy and renal organ aging share some clinical features, such as renal fibrosis and tubular atrophy, raising the possibility that CsA may exert some of its deleterious effects via induction of a stress-induced senescent phenotype. We investigated this hypothesis in HK-2 cells and primary proximal tubular cells in vitro. CsA induced the production of H2O2, caused cell cycle arrest in the G0/G1 phase, and inhibited DNA synthesis. Furthermore, CsA exposure lead to a reduction of telomere length, increased p53 serine 15 phosphorylation, and caused an upregulation of the cell cycle inhibitor p21Kip1 (CDKN1A) mRNA levels. CsA caused an increase in p16INK4a (CDKN2A) expression after a 13-day exposure in primary proximal tubular cells but not in HK-2 cells. Coincubation of cells with CsA and catalase was able to prevent telomere shortening and partially restored DNA synthesis. In summary, CsA induces cellular senescence in human renal tubular epithelial cells, which can be attenuated by scavenging reactive oxygen species.
p53; p16; p21; telomere; proliferation; cell culture; proximal tubular; reactive oxygen species
THE INTRODUCTION OF THE IMMUNOSUPPRESSIVE calcineurin inhibitor cyclosporine A (CsA) in the 1980s dramatically improved the outcome after organ transplantation. However, CsA was found to be nephrotoxic, causing glomerulosclerosis, stripped tubulointerstitial fibrosis, tubular atrophy, and afferent arteriolopathy (27, 28). While acute CsA nephrotoxicity is somewhat problematic in the postoperative period, it is usually reversible. On the contrary chronic CsA nephrotoxicity, ultimately leading to renal failure, still represents a major challenge in transplant medicine. The pathogenesis of CsA nephrotoxicity has been investigated in animal and in vitro models and also in clinical studies. From these investigations it is clear that CsA nephropathy is a complex multifactorial process involving the vasculature, the glomerulus, the tubular epithelium, and the renal interstitium (3, 4). There are certain histopathological similarities between CsA nephropathy and renal organ aging (26, 34), giving rise to the possibility that common biochemical intermediates and pathways may exist. In this paper, we will introduce the concept of CsA-mediated, stress-induced senescence of renal tubular epithelial cells.
Senescence was initially described by Hayflick and Moorhead in 1961, who demonstrated that cultured human diploid fibroblasts proliferate only for a finite number of population doublings (12). When this limit is reached, the cells arrest in the G1 phase of the cell division cycle but remain viable and metabolically active (6, 11). Telomeres, the tandemly repeated hexamers at the end of mammalian chromosomes, were found to act as the cellular replicative clock (30). Telomeres are shortened by each cell division, and once a critical telomere length has been reached the cell enters the state of replicative senescence. It is therefore not surprising that cellular senescence has been intimately linked with aging, and telomeres have been shown to shorten as a function of age in several cells and tissues including the renal cortex (1, 25).
More recently it has also been shown that the activation of the cell cycle inhibitors p16 (p16INK4A) and p21 (p21WAF) induces a senescent phenotype. While p21 induction is directly related to telomere shortening via the p53 pathway, p16 has been shown to induce cellular senescence independently of telomere attrition (24).
Aged kidneys are more susceptible to stress and disease, and renal aging has been associated with decreased glomerular filtration rate, glomerulosclerosis, tubular atrophy, and interstitial fibrosis (26, 34). Aging of cells, however, is not only a consequence of time but can be accelerated by a multitude of other factors, including genetic disposition, environmental factors, diet, life style, and possibly pharmaceuticals. In the present study, we hypothesized that CsA induces a cellular stress to renal tubular epithelial cells, contributing to senescence and accelerated organ aging.
 |
MATERIALS AND METHODS
|
|---|
Chemicals
All chemicals, unless otherwise mentioned, were purchased from Sigma (Vienna, Austria) and were of the highest grade available.
Cell Culture
HK-2 cells were purchased from American Type Culture Collection (ATCC no. CRL-2190). Cells were routinely cultured on 10-cm culture dishes from Sarstedt (Manassas, VA). The culture medium was a 1:1 mixture of DMEM and Ham's F12 (11966-025, 21765-029, GIBCO, Invitrogen, Lofer, Austria) containing 5 mM glucose supplemented with 10 ng/ml human recombinant EGF, 36 ng/ml hydrocortisone, 5 µg/ml bovine insulin, 5 µg/ml human transferrin, 5 ng/ml sodium selenite, 2 mM L-alanyl-L-glutamine (glutamax; GIBCO), 100 U/ml penicillin, and 100 µg/ml streptomycin (GIBCO). Cells were fed three times weekly and subcultivated by trypsinization when near confluence. For our experiments, HK-2 cells were used between passages 12 and 30.
Human primary proximal tubular (HPT) cells were isolated from the cortex of macroscopically normal regions of nephrectomized kidneys, as previously described (8). Ethical permission was given for the use of human renal samples. Briefly, cortexes were finely minced and subjected to a 35-min collagenase type II digestion. Digested material was forced through a tea strainer and washed in Hanks' balanced salt solution. This material was resuspended in 42% isosmotic Percoll solution and centrifuged at 25,000 g for 30 min at 4°C. The lowest fraction containing tubular fragments was plated on 10-cm dishes in DMEM without glucose, containing 10% FCS and 2 mM L-alanyl-L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Confluent monolayers were trypsinized and cultured again to confluence in the same medium as HK-2 cells. HPT cells from a 30-yr-old male donor were used at passage 1 for these experiments.
Experimental Design
Cells were trypsinized and seeded onto 6-well plates, glass coverslips on 12-well plates or 96-well plates depending on the experiment. (1,800-, 800-, and 100-µl medium volumes were used, respectively.) Cells were grown to full confluence before treatment for all experiments (unless otherwise stated) to best represent the in vivo situation of a differentiated epithelial monolayer. CsA was dissolved in absolute ethanol to 10 mM, aliquoted, and frozen at –20°C. This stock was further diluted in absolute ethanol directly before treatment and added to the growth medium. Ethanol concentrations were at a maximum of 0.2% in all treatment groups, including controls. CsA concentrations of 20, 10, 8.3, 5, 2.5, 1.25, and 0.83 µM were used depending on the experiment. Cisplatin was freshly prepared in DMSO at 150 mM and added to the cell culture medium at 1:1,000. Cells were treated for 24 h, unless otherwise stated.
Assays
Cytotoxicity.
Release of the cytosolic enzyme lactate dehydrogenase (LDH) into the supernatant medium was assayed using a commercially available assay (Roche, Mannheim, Germany).
Caspase 3.
Cells treated on 96-well plates were lysed in 50 µl 200 mM Tris, 20 mM EDTA containing 1% Triton X-100 for 30 min at 4°C. Lysates were incubated in a 1:1 ratio with 50 nM Z-DEVD-R110 [rhodamine 110; bis (N-CBZ)-L-aspartyl-L-glutamyl-Lvalyl-L-apartic acid amide, Molecular Probes, Invitrogen], 10 mM DTT, 20 mM PIPES, 4 mM EDTA, and 0.2% [(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate or CHAPS. After a 30-min incubation in the dark at room temperature, the plate was read on a TECAN GENios microtiter plate reader at 435-nm excitation and 535-nm emission. Fold over basal values were calculated.
Hoechst DNA staining.
Cells were cultured and treated on glass coverslips and fixed in 4% paraformaldehyde for 30 min, washed in PBS, and incubated with 0.5 µg/ml Hoechst 33258 for 10 min. Cells were washed and mounted in 3 mg/ml p-phenylene-diamine glycerol solution. Photographs were captured from a Zeiss Axiophot microscope with a cooled CCD camera (Spot, Diagnostic Instruments).
H2O2 production.
Thirty microliters of freshly collected supernatants were added to 30 µl of 0.16 mM Amplex Red Ultra (Molecular Probes) and 1 U/ml horseradish peroxidase (HRP) in PBS. The plates were incubated for 1 h at 37°C. Fluorescence was measured at 540-nm excitation and 595-nm emission. Fluorescence was linearly proportional to H2O2 added to cell culture medium (10, 5, 2.5, 1.25, 0.63, 0.31, 0.16, and 0 µM H2O2 gave an r2 = 0.997). Relative fluorescent units (RFU) were converted to fold over basal values.
Bromodeoxyuridine/resazurin.
Cells were treated on 96-well plates and incubated for 2 h with 44 µM resazurin and 10 µM bromodeoxyuridine (BrdU)-labeling reagent (Roche) in growth medium. Resazurin reduced to resorufin was measured at 540-nm excitation and 590-nm emission. Resazurin reduction is similar to the MTT assay and is directly proportional to the number of viable cells (21). Cells were washed and fixed in FixDenat (Roche) for 30 min. Cells were incubated for 1 h with anti-BrdU HRP-conjugated Fab fragments (Roche) with 300-rpm orbital shaking. Cells were washed and incubated for 30 min in 20 µM Amplex Red Ultra (Molecular Probes), 5 mM H2O2 in PBS. Amplex red is converted to resorufin in the presence of H2O2 and HRP (41). Since HRP is limited in this reaction, fluorescence is directly proportional to antibody bound and thus to BrdU incorporated. The resazurin assay does not interfere since the wells are washed out several times before this step. Fluorescence was measured at 540-nm excitation and 595-nm emission. RFU were converted to % control values.
Flow cytometry.
Cells were treated at confluence on six-well culture dishes, harvested by trypsinization, and subsequently fixed with 70% ethanol for 30 min at 4°C. Cells were then incubated in 50 µg/ml propidium iodide in the presence of 200 µg/ml RNAse (Roche) for 15 min at room temperature, protected from light. Analysis was carried out on a BD FACSCalibur flow cytometer (Becton Dickinson, Heidelberg, Germany) with laser excitation at 488 nm using a band-pass filter to collect red propidium iodide fluorescence. Cell clumps were excluded from analysis on the basis of fluorescence height vs. area. The percentages of cells in different phases of the cell cycle were analyzed using CellQuest software (Becton Dickinson).
Phosphorylated p53 enzyme immunoassay.
Cells were cultured on 96-well plates and treated for various time points with CsA. Cells were washed with PBS and fixed with 99% methanol at –20°C for 10 min. Nonspecific binding sites were blocked using 5% BSA (fraction V), 1% Triton X-100 in PBS for 30 min. Affinity-purified rabbit anti-Phospho-p53 (S15) antibody (0.5 ng/ml, AF1043, R&D Systems, Minneapolis, MN) in 1% BSA, 0.1% Triton X-100 was added and incubated for 1 h at room temperature (or overnight at 4°C) with 300-rpm orbital shaking. Plates were washed and incubated with an HRP-conjugated secondary antibody for 30 min with shaking. After another washing step, Amplex red was used to detect HRP (as described for BrdU assay). RFU were converted to fold over basal values.
Quantitative real-time PCR.
RNA was isolated from cell cultures using a column-based assay (High Pure RNA Isolation kit, Roche). Total RNA was quantified using a fluorescent-based assay (Ribogreen, Molecular Probes) and adjusted to 1 µg/10 µl for each sample. RNA was transcribed to cDNA using Moloney murine leukemia virus reverse transcriptase (Invitrogen), nucleotides (Amersham, Buckinghamshire, UK), and random hexamers (Roche). For determination of gene expression levels of p21 (p21 WAF1, CDKN1A), p16 (p16INK4a, CDKN2A), and p27 (p27KIP1, CDKN1B), a commercially available, predesigned primer set was used (Applied Biosystems, Brunn am Gebirge, Austria). Sequence-specific primers and probes for endothelial nitric oxide synthase (eNOS, NOS3), inducible nitric oxide synthase (iNOS, NOS2a), and p53 (TP53) were designed using Primer Express Software (Applied Biosystems).
18s RNA (Applied Biosystems) served as a standard reference gene. PCR reagent mixes for designed primers contained 900 nM sense and antisense primer, 200 nM probe, and a TaqMan Mix (Applied Biosystems). A thermal cycling profile started with 2 min at 50°C (RNAse inhibitor activation) and 10 min at 95°C to activate polymerase. Repeating cycles were performed 40 times at 95°C for 15 s, followed by 60°C for 1 min. Samples were run in duplicate, and the gene expression levels were calculated using the 
Ct method. Experiments were carried out using the ABI PRISM 7700 and evaluated by the SDS 1.9.1 software package and GraphPad Prism (GraphPad Software, San Diego, CA).
Telomere length assay.
Genomic DNA was isolated from cell cultures with a DNeasy Tissue Kit (Qiagen) and quantified using the fluorescent-based Picogreen assay (Molecular Probes). Relative telomere length was determined using an optimized assay (17) originally described by Cawthon (7). Separate PCR experiments were performed for telomere (T) and 36B4, a single-copy gene (S), in 96-well optical reaction plates (Applied Biosystems). Twenty microliters of 2.5 ng/µl sample DNA was transferred in duplicate to identical positions for telomere as well as for 36B4 experiments. The primer pair sequences for telomere PCR were (5' to 3') the following: for tel1b CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT and tel2b GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT. Sequences for 36B4 were forward CAGCAAGTGGGAAGGTGTAATCC and reverse CCCATTCTATCATCAACGGGTACAA. The reagent mixture composition shared by T and S PCR was 15 mM Tris·HCl (pH 8.0), 50 mM KCl, 200 µM dNTP (Amersham), 1% DMSO, 2.5 mM DTT, and 0.4x Sybr Green I (Molecular Probes, Invitrogen). The composition specific for PCR (T) was 1.5 mM MgCl2, 1.5 U AmpliTaq Gold DNA polymerase (Applied Biosystems), and 450 nM for each telomere-specific primer. The composition specific for PCR (S) was 3.5 mM MgCl2, 0.75 U AmpliTaq Gold DNA polymerase, 300 nM for the 36B4 forward primer, and 500 nM for the 36B4 reverse primer.
Experiments were carried out on an ABI Prism 7700 Sequence Detector (Applied Biosystems). The thermal cycling profile started with 15 min at 93°C to activate polymerase for PCR (T) and 10 min at 95°C to activate polymerase for the PCR (S). Repeating cycles were performed 25 (T) and 40 (S) times at 95°C for 15 s followed by 56°C for 1 min. To reduce interassay variation, a HK-2 DNA sample was used as a standard for both 36B4 and telomere. The standard was serially diluted from 5, 2.5, 1.25, 0.625, 0.313, 0.156, 0.078, and 0 ng DNA/µl. Using a spline fit of the antilog data, cell cycle threshold was converted to nanograms DNA per microliter, and then the T/S ratio was calculated. The T/S ratio of the standard sample was set to 1, and changes in telomere length (amount of telomeric DNA) were normalized to the standard.
Statistics
All data are expressed as means ± SE, unless otherwise specified. Statistical analysis was performed using GraphPad Prism. Intergroup differences for continuous variables were assessed by one-way ANOVA, using Dunnett's posttest to determine the significance of differences between groups. An unpaired Student's t-test was used for assessing statistical significance for experiments with only two data sets (control vs. treated).
 |
RESULTS
|
|---|
We assessed the effect of CsA on induction of necrosis and apoptosis. A 24-h exposure of HK-2 cells to CsA resulted in a dose-dependent increase in the release of the cytosolic enzyme LDH into the supernatant medium (Fig. 1A). However, CsA neither induced caspase 3 activity nor caused nuclear condensation at any of the concentrations applied (Fig. 1, A and B). The DNA-intercalating agent cisplatin was used as a positive control, which increased caspase 3 activity (6.67 ± 0.043-fold over basal) and induced nuclear condensation (Fig. 1B).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1. Effect of cyclosporin A (CsA) on HK-2 cell apoptosis and necrosis. HK-2 cells were treated with CsA or 150 µM cisplatin for 24 h on 96-well plates for caspase 3 and LDH release determination (A) or glass coverslips for Hoechst staining (B). A: mean fold over basal (FOB) caspase 3 activity ± SE from 4 experiments. B: representative Hoechst DNA fluorescence micrographs at x400 original magnification.
|
|
Next, we investigated the impact of CsA exposure on DNA synthesis. Pretreated HK-2 cells were incubated with both resazurin and the pyrimidine analog BrdU. Resazurin is reduced to resorufin by the cellular redox potential of viable cells, and BrdU is built into the DNA of proliferating cells. Resazurin conversion gives an estimation of viable cell number and BrdU, which is detected by immunoassay, gives an index of DNA synthesis. By combining both of these assays, we can establish whether a change in proliferation is due to a change in cell number. CsA caused a dose-dependent decrease in proliferation without a significant loss of cell number (Fig. 2A). This result may appear to contradict the observed increase in LDH release (Fig. 1A); however, mild toxicity induces LDH release without a significant change in viable cell number. This experiment was conducted on confluent monolayers. Although at confluence, HK-2 cells exhibit some "contact inhibition," there is still a significant cellular proliferation due to normal monolayer turnover. CsA dose dependently inhibited this basal cellular turnover. In another experiment, nonconfluent HK-2 and HPT cells were treated daily with 5 µM CsA for 13 days and cell number was determined on a daily basis using the resazurin assay. Both HK-2 cells and HPT cells continued to proliferate in the presence of CsA but at a lower rate than controls. As CsA treatment time increased, proliferative capacity decreased (Fig. 2, B and C).
Flow cytometric-based cell cycle analysis was used to investigate whether the CsA-induced inhibition of cell proliferation is due to cell cycle arrest. In HK-2 cells, CsA treatment resulted in an increase in the percentage of cells in the G0/G1 phase and a concomitant decrease in the percentage of cells in the G2/M phase (Fig. 3, A and B).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3. CsA-induced cell cycle arrest in HK-2 cells. HK-2 cells were cultured to confluence on 6-well plates and treated with CsA for 24 h. Cells were trypsinized, incubated with propidium iodide, and analyzed on a flow cytometer. The percentage of cells in the G0/G1 (A) and G2/M (B) cell cycle phase was determined. Values are means %cells ± SE of 4 experiments. Statistically significant, *P < 0.05, **P < 0.01.
|
|
Using quantitative real-time PCR, we analyzed some likely candidates in cell cycle regulation. Also, the expression of iNOS and eNOS mRNA was analyzed as nitric oxide (NO) has been implicated in many CsA-dependent effects both in vivo and in vitro. In HK-2 cells treated with 10 µM CsA for 24 h, there was no alteration in p16 mRNA (Table 1). p21 was highly induced. p27 was slightly increased but not significantly. p53 slightly decreased but also not significantly. eNOS was elevated but not iNOS. In HPT cells treated with µM CsA for 24 h, p21 was increased and p16 was unchanged (Table 2). p16 mRNA was also measured in HK-2 and HPT cells treated daily for 7 and 13 days with 5 µM CsA. p16 mRNA was not significantly altered in HK-2 cells but was significantly elevated in primary HPT cells after a 13-day exposure (Table 3).
p21 is directly downstream of p53, and thus the lack of p53 expression could imply that mRNA had already returned to baseline values after induction or also that there is only an increase in activated (phosphorylated) p53 and not in the gene product. To investigate this, we utilized an antibody recognizing a phosphorylated site at serine 15 on the p53 protein. Cells were treated with CsA at different time points in 96 wells, permeabilized, and assayed for activated p53. In HK-2 cells, there was a dose-dependent increase in activated p53 expression, peaking at 8 h (Fig. 4, A and B).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 4. CsA-induced changes in cellular expression of activated p53 in HK-2 cells. HK-2 cells were cultured to confluence on 96-well plates and treated with CsA as described. After treatment, cells were methanol permeabilized and incubated with an antibody recognizing serine 15 phosphorylated p53. Amplex red was used to fluorescently detect the horseradish peroxidase (HRP)-labeled secondary antibody. A: time course of p53 serine 15 phosphorylation expression in HK-2 cells treated with 10 µM CsA. B: CsA dose-dependent activation of p53 serine 15 phosphorylation in HK-2 cells after an 8-h exposure. Values are means fold over basal ± SE of 3 experiments with at least 4 replicates per experiment. Statistically significant, *P < 0.05, **P < 0.01.
|
|
The reduction of telomere length has been shown to be one of the events leading to activation of p53. We thus investigated the effect of 10 µM CsA on HK-2 and HPT telomere length using quantitative real-time PCR. Relative T/S ratio measured by quantitative PCR has been shown to have a strong correlation with telomere length determined by the telomere restriction length assay (7). CsA resulted in a 17 and 14% reduction in telomere length in HK-2 and HPT cells, respectively (see
Fig. 6, A and B).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 5. CsA-induced H2O2 production and effect of catalase coincubation on LDH release and DNA synthesis. HK-2 cells were cultured to confluence on 96-well plates and treated for 24 h with CsA. A: supernatants were collected, and H2O2 was quantified using a peroxidase/Amplex red assay. Values are means ± SE of 3 independent experiments with at least 3 replicates per experiment expressed as fold over basal. Statistically significant, *P < 0.05, **P < 0.01. The effect of catalase on CsA-induced LDH release (B) and BrdU incorporation (C) was determined. Open bars, without catalase; filled bars, with 140 U/ml catalase. Statistically significant,*P < 0.05, **P < 0.01, and ***P < 0.001.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6. Effect of CsA on telomere length. HK-2 and HPT cells were cultured to confluence on 6-well plates and treated for 8 h with or without 10 µM CsA in the presence or absence of 140 U/ml catalase. Genomic DNA was isolated, and telomere length was determined by quantitative real-time PCR relative to the single-copy gene 36B4. Values are expressed as fold over basal telomere cycle threshold (T) divided by the single-copy gene cycle threshold (S). Statistically significant, **P < 0.01. In B, CsA resulted in a reduction in relative telomere length (without catalase), but this effect was over the significant threshold (P = 0.0517).
|
|
Since reactive oxygen species generation is known as one of the major toxic intermediates leading to DNA damage, we investigated whether CsA induces the production of H2O2. As can be seen in Fig. 5A, CsA caused a dose-dependent increase in H2O2 generation in HK-2 cells. To investigate the impact of CsA-induced H2O2 on cytotoxicity and proliferation, we coincubated cells with 140 U/ml catalase, an enzyme that specifically breaks down H2O2 into H2O and O2. Catalase caused an attenuation of both CsA-induced cytotoxicity (Fig. 5B) and CsA-induced decrease in proliferation (Fig. 5C). Coincubation of cells with 140 U/ml catalase also abolished the effect of CsA on telomere length (Fig. 6). Catalase most likely does not enter the cytoplasm of the cell and so acts as an H2O2 scavenger primarily extracellularly. However, since H2O2 is freely permeable to cell membranes, catalase mops up extracellular H2O2, thus reducing intracellular accumulation. These effects of catalase demonstrate that H2O2 production is responsible, at least in part, for cytotoxicity and reduced proliferation.
 |
DISCUSSION
|
|---|
Due to the complex and multifactorial nature of chronic CsA nephrotoxicity, it is advantageous, when specific cellular and biochemical effects are being investigated, to remove higher-order regulatory systems. One method of achieving this is the use of cell culture systems, which have had a major impact on the understanding of cell-specific nephrotoxic mechanisms in general (15, 36). Due to the clinical importance of CsA, many investigations have been conducted in different cell culture types in an attempt to understand the cell type-specific mechanisms of CsA toxicity (15). One of the unifying effects of CsA in cell cultures of most renal cell types is a reduction in proliferation capacity, demonstrated in mesangial cells (39), endothelial cells (38), and tubular epithelial cells (18). Here, we investigated whether this observed decrease in proliferation involves distinct senescence pathways, leading to an accelerated aging of renal cells.
Telomeres consist of a repetitive base sequence (TTAGGGn) and are necessary for positioning of the chromosomes in the nucleus, as well as for protection of the coding parts of the DNA from recombination, degradation, and replicative damage (10, 40). Once an individual chromosome is not "capped" by a telomere exceeding a critical length, or the associated multicomponent protein assembly is disturbed, the situation is sensed as a DNA strand break. Already at 8 h after CsA exposure, there was a decrease in mean telomere length in both HK-2 cells and HPT cells. DNA strand breaks can lead to the activation of ATM kinase, a member of the phosphatidylinositol 3-kinase family. ATM phosphorylates p53 directly (at serine 15), as well as phosphorylating the Chk2 checkpoint kinase, which promotes additional phosphorylation of p53 (at serine 20) (2). We demonstrated that CsA induces a dose-dependent p53 serine 15 phosphorylation, which peaked at 8 h, coinciding with telomere shortening. Activation of p53 induces transcription of the cell cycle inhibitor p21, leading to cell cycle arrest in the G0/G1 phase. In our experiments, CsA significantly induced p21 mRNA and cells were arrested in the G0/G1 phase of the cell cycle, which could be independently observed by a CsA dose-dependent decrease in DNA synthesis without alterations in viable cell number. In addition, we observed no CsA-mediated induction of apoptosis, suggesting that the severity of telomere-mediated cell cycle arrest was mild enough to induce senescence without programmed cell death. It has been previously demonstrated that telomere attrition can induce either senescence or apoptosis, depending on the level of telomere dysfunction (19).
p16 is considered a marker of renal aging in vivo (26) and has been shown to be a marker of senescence in vitro (16). An elegant study by Jacobs et. al. (13) dissected the effects of telomere-directed p16 and p53 senescence, demonstrating that p16-induced senescence is independent of p53 activation and is primarily a late event, appearing after 1 wk. In our study, p16 mRNA was unaffected by a 24-h treatment of 10 µM CsA in both HK-2 and HPT cells. However, HPT cells treated daily with 5 µM CsA for 13 days exhibited a significant increase in p16 mRNA. Thus CsA does cause an elevation in p16 mRNA in primary cells, but only after long-term exposure. The lack of p16 mRNA induction in HK-2 cells treated for 13 days with CsA may indicate a loss of a functional p16 pathway in these cells due to immortalization [HK-2 cells were immortalized by transduction with human papilloma virus (HPV 16) E6/E7 genes] (37).
CsA induced a dose-dependent increase in H2O2 production. CsA induction of H2O2 production has been previously documented in cultured mesangial cells and LLC-PK1 cells (33, 35). H2O2 is known to directly cause DNA strand breaks and also to contribute to telomere attrition (9). When cells were exposed to CsA in the presence of extracellular catalase, which specifically breaks down H2O2, there was a reduction in CsA-induced cytotoxicity and an attenuation of the CsA-induced effect on proliferation and telomere attrition. In animal studies, cotreatment with antioxidants has been shown to reduce some of the toxic effects of CsA (14, 20). The catalase protection of telomere attrition would be in line with previous findings, demonstrating that the telomere is a region hypersensitive to oxidative damage (24). However, the effect of catalase was not as efficient on the reversal of CsA-induced decreased DNA synthesis. The telomere assay measures the global mean telomere length of all chromosomes, which may not be sensitive enough to detect smaller alterations, as the shortening of telomeres on specific chromosomes may preferentially activate senescence pathways (23).
CsA also induced eNOS mRNA in HK-2 cells. CsA has been previously shown to increase transcription of eNOS in a H2O2-dependent fashion (22), and it is speculated that this induction involves the redox-sensitive transcription factor AP-1 (32). NO itself is involved both in p53 activation (31) and in DNA damage (5). Recently, it has been shown that interstitial telomeric DNA sequences are hypersensitive to NO (29). Thus H2O2 production may amplify telomere attrition by indirectly elevating NO production by inducing eNOS transcription.
CsA thus appears to activate both the p53 telomere-dependent pathway and the p16/pRB-senescent pathway in renal HPT epithelial cells in vitro. Activation of the p53 pathway was evidenced by telomere attrition, p53 serine 15 phosphorylation, and induction of p21 transcription, leading to decreased DNA synthesis. Primary cells were more sensitive to CsA-induced long-term attenuation of proliferative status most likely due to a convergence of both the p16/pRB and the p53 pathway in these cells, where the HK-2 cell line lacks a CsA-induced p16 response. The induction of reactive oxygen species may initiate the senescence cascade, as catalase incubation attenuated many of the responses to CsA. Accelerated aging of the kidney due to CsA-induced reactive oxygen species production may play an important role in the limited life of transplanted kidneys.
 |
GRANTS
|
|---|
The work was supported by the Austrian Federal Ministry of Education Science and Culture (GZ 70.078/2-Pr/4/2002), EU 6th Framework project "Predictomics" (LSHB-CT-2004-504761), Genzyme Renal Innovation Project (GRIP), and European Centre for the Validation of Alternative Methods (ECVAM), Joint Research Centre of the European Commission (Ispra, Italy).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. R. M. Cawthon from the University of Utah for sending us updates to the protocol for quantitative PCR-based determination of telomere length.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: C. Koppelstaetter, Div. of Nephrology, Dept. of Internal Medicine, Medical Univ. Innsbruck, Anichstrasse 35, 6020 Innsbruck, Austria (e-mail: christian.koppelstaetter{at}uki.at)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* Authors contributed equally to this work. 
 |
REFERENCES
|
|---|
- Allsopp RC, Chang E, Kashefi-Aazam M, Rogaev EI, Piatyszek MA, Shay JW, Harley CB. Telomere shortening is associated with cell division in vitro and in vivo. Exp Cell Res 220: 194–200, 1995.[CrossRef][Web of Science][Medline]
- Appella E, Anderson CW. Post-translational modifications and activation of p53 by genotoxic stresses. Eur J Biochem 268: 2764–2772, 2001.[Web of Science][Medline]
- Bennett WM, DeMattos A, Meyer MM, Andoh T, Barry JM. Chronic cyclosporine nephropathy: the Achilles' heel of immunosuppressive therapy. Kidney Int 50: 1089–1100, 1996.[Web of Science][Medline]
- Burdmann EA, Yu L, Andoh TF, Perico C, Bennett WM. Calcineurin inhibitors and sirolimus. In: Clinical Nephrotoxins: Renal Injury from Drugs and Chemicals (2nd ed.). Boston: Kluwer, 2003, p. 403–458.
- Burney S, Caulfield JL, Niles JC, Wishnok JS, Tannenbaum SR. The chemistry of DNA damage from nitric oxide and peroxynitrite. Mutat Res 424: 37–49, 1999.[Web of Science][Medline]
- Campisi J. The biology of replicative senescence. Eur J Cancer 33: 703–709, 1997.[CrossRef][Web of Science][Medline]
- Cawthon RM. Telomere measurement by quantitative PCR. Nucleic Acids Res 30: e47, 2002.[Abstract/Free Full Text]
- Chen TC, Curthoys NP, Lagenaur CF, Puschett JB. Characterization of primary cell cultures derived from rat renal proximal tubules. In Vitro Cell Dev Biol 25: 714–722, 1989.[CrossRef]
- Duan J, Duan J, Zhang Z, Tong T. Irreversible cellular senescence induced by prolonged exposure to H2O2 involves DNA-damage-and-repair genes and telomere shortening. Int J Biochem Cell Biol 37: 1407–1420, 2005.[CrossRef][Web of Science][Medline]
- Harley CB. Telomere loss: mitotic clock or genetic time bomb? Mutat Res 256: 271–282, 1991.[CrossRef][Web of Science][Medline]
- Hayflick L. The limited in vitro lifetime of human diploid cell strains. Exp Cell Res 37: 614–636, 1965.[CrossRef][Web of Science][Medline]
- Hayflick L, Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res 25: 585–621, 1961.[CrossRef][Web of Science][Medline]
- Jacobs JJ, de Lange T. Significant role for p16INK4a in p53-independent telomere-directed senescence. Curr Biol 14: 2302–2308, 2004.[CrossRef][Web of Science][Medline]
- Jenkins JK, Huang H, Ndebele K, Salahudeen AK. Vitamin E inhibits renal mRNA expression of COX II, HO I, TGFbeta, and osteopontin in the rat model of cyclosporine nephrotoxicity. Transplantation 71: 331–334, 2001.[CrossRef][Web of Science][Medline]
- Jennings P, Koppelstaetter C, Helbert MJ, Pfaller W. Renal culture models: contribution to the understanding of nephrotoxic mechanisms. In: Clinical Nephrotoxins: Renal Injury from Drugs and Chemicals (2nd ed.). Boston: Kluwer, 2003, p. 115–147.
- Kim H, You S, Farris J, Kong BW, Christman SA, Foster LK, Foster DN. Expression profiles of p53-, p16(INK4a)-, and telomere-regulating genes in replicative senescent primary human, mouse, and chicken fibroblast cells. Exp Cell Res 272: 199–208, 2002.[CrossRef][Web of Science][Medline]
- Koppelstaetter C, Jennings P, Hochegger K, Perco P, Ischia R, Karkoszka H, Mayer G. Effect of tissue fixatives on telomere length determination by quantitative PCR. Mech Ageing Dev, 2005.
- Lally C, Healy E, Ryan MP. Cyclosporine A-induced cell cycle arrest and cell death in renal epithelial cells. Kidney Int 56: 1254–1257, 1999.[CrossRef][Web of Science][Medline]
- Lechel A, Satyanarayana A, Ju Z, Plentz RR, Schaetzlein S, Rudolph C, Wilkens L, Wiemann SU, Saretzki G, Malek NP, Manns MP, Buer J, Rudolph KL. The cellular level of telomere dysfunction determines induction of senescence or apoptosis in vivo. EMBO Rep 6: 275–281, 2005.[CrossRef][Web of Science][Medline]
- Lexis LA, Fenning A, Brown L, Fassett RG, Coombes JS. Antioxidant supplementation enhances erythrocyte antioxidant status and attenuates cyclosporine-induced vascular dysfunction. Am J Transplant 6: 41–49, 2006.[CrossRef][Web of Science][Medline]
- Liu D. A rapid biochemical test for measuring chemical toxicity. Bull Environ Contam Toxicol 26: 145–149, 1981.[CrossRef][Web of Science][Medline]
- Lopez-Ongil S, Hernandez-Perera O, Navarro-Antolin J, Perez de Lema G, Rodriguez-Puyol M, Lamas S, Rodriguez-Puyol D. Role of reactive oxygen species in the signalling cascade of cyclosporine A-mediated up-regulation of eNOS in vascular endothelial cells. Br J Pharmacol 124: 447–454, 1998.[CrossRef][Web of Science][Medline]
- Martens UM, Zijlmans JM, Poon SS, Dragowska W, Yui J, Chavez EA, Ward RK, Lansdorp PM. Short telomeres on human chromosome 17p. Nat Genet 18: 76–80, 1998.[CrossRef][Web of Science][Medline]
- Melk A. Senescence of renal cells: molecular basis and clinical implications. Nephrol Dial Transplant 18: 2474–2478, 2003.[Free Full Text]
- Melk A, Ramassar V, Helms LM, Moore R, Rayner D, Solez K, Halloran PF. Telomere shortening in kidneys with age. J Am Soc Nephrol 11: 444–453, 2000.[Abstract/Free Full Text]
- Melk A, Schmidt BM, Vongwiwatana A, Rayner DC, Halloran PF. Increased expression of senescence-associated cell cycle inhibitor p16INK4a in deteriorating renal transplants and diseased native kidney. Am J Transplant 5: 1375–1382, 2005.[CrossRef][Web of Science][Medline]
- Mihatsch MJ, Ryffel B, Gudat F. The differential diagnosis between rejection and cyclosporine toxicity. Kidney Int Suppl 52: S63–S69, 1995.[Medline]
- Mihatsch MJ, Steiner K, Abeywickrama KH, Landmann J, Thiel G. Risk factors for the development of chronic cyclosporine-nephrotoxicity. Clin Nephrol 29: 165–175, 1988.[Web of Science][Medline]
- Mosquera A, Gosalvez J, Sabatier L, Fernandez JL. Interstitial telomeric DNA sequences of Chinese hamster cells are hypersensitive to nitric oxide damage, and DNA-PKcs has a specific local role in its repair. Genes Chromosomes Cancer 44: 76–84, 2005.[CrossRef][Web of Science][Medline]
- Moyzis RK, Buckingham JM, Cram LS, Dani M, Deaven LL, Jones MD, Meyne J, Ratliff RL, Wu JR. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci USA 85: 6622–6626, 1988.[Abstract/Free Full Text]
- Nakaya N, Lowe SW, Taya Y, Chenchik A, Enikolopov G. Specific pattern of p53 phosphorylation during nitric oxide-induced cell cycle arrest. Oncogene 19: 6369–6375, 2000.[CrossRef][Web of Science][Medline]
- Navarro-Antolin J, Rey-Campos J, Lamas S. Transcriptional induction of endothelial nitric oxide gene by cyclosporine A. A role for activator protein-1. J Biol Chem 275: 3075–3080, 2000.[Abstract/Free Full Text]
- Nishida M, Ogawa H, Tamai M, Ishiwari K, Hamaoka K. Role of hydrogen peroxide in cyclosporine-induced renal tubular cell (LLC-PK1) injury. J Pharmacol Sci 91: 255–258, 2003.[CrossRef][Web of Science][Medline]
- Pannu N, Halloran P. The kidney in aging. In: Primer on Kidney Diseases, edited by Greenberg A. San Diego, CA: Academic, 2001, p. 377–381.
- Perez de Lema G, Arribas I, Prieto A, Parra T, de Arriba G, Rodriguez-Puyol D, Rodriguez-Puyol M. Cyclosporin A-induced hydrogen peroxide synthesis by cultured human mesangial cells is blocked by exogenous antioxidants. Life Sci 62: 1745–1753, 1998.[CrossRef][Web of Science][Medline]
- Pfaller W, Gstraunthaler G. Nephrotoxicity testing in vitro—what we know and what we need to know. Environ Health Perspect 106, Suppl 2: 559–569, 1998.[Web of Science][Medline]
- Ryan MJ, Johnson G, Kirk J, Fuerstenberg SM, Zager RA, Torok-Storb B. HK-2: an immortalized proximal tubule epithelial cell line from normal adult human kidney. Kidney Int 45: 48–57, 1994.[Web of Science][Medline]
- Seki Y, Toba K, Fuse I, Sato N, Niwano H, Takahashi H, Tanabe N, Aizawa Y. In vitro effect of cyclosporin A, mitomycin C and prednisolone on cell kinetics in cultured human umbilical vein endothelial cells. Thromb Res 115: 219–228, 2005.[CrossRef][Web of Science][Medline]
- Sun J, Wang Y. Effects of cyclosporin A on proliferation of cultured rat mesangial cells. J Tongji Med Univ 17: 115–117, 1997.[Medline]
- von Zglinicki T. Oxidative stress shortens telomeres. Trends Biochem Sci 27: 339–344, 2002.[CrossRef][Web of Science][Medline]
- Zhou M, Diwu Z, Panchuk-Voloshina N, Haugland RP. A stable nonfluorescent derivative of resorufin for the fluorometric determination of trace hydrogen peroxide: applications in detecting the activity of phagocyte NADPH oxidase and other oxidases. Anal Biochem 253: 162–168, 1997.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. Naesens, E. Lerut, H. de Jonge, B. Van Damme, Y. Vanrenterghem, and D. R. J. Kuypers
Donor Age and Renal P-Glycoprotein Expression Associate with Chronic Histological Damage in Renal Allografts
J. Am. Soc. Nephrol.,
November 1, 2009;
20(11):
2468 - 2480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Puigmule, J. Lopez-Hellin, G. Sune, O. Tornavaca, S. Camano, A. Tejedor, and A. Meseguer
Differential proteomic analysis of cyclosporine A-induced toxicity in renal proximal tubule cells
Nephrol. Dial. Transplant.,
September 1, 2009;
24(9):
2672 - 2686.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Naesens, D. R. J. Kuypers, and M. Sarwal
Calcineurin Inhibitor Nephrotoxicity
Clin. J. Am. Soc. Nephrol.,
February 1, 2009;
4(2):
481 - 508.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wieser, G. Stadler, P. Jennings, B. Streubel, W. Pfaller, P. Ambros, C. Riedl, H. Katinger, J. Grillari, and R. Grillari-Voglauer
hTERT alone immortalizes epithelial cells of renal proximal tubules without changing their functional characteristics
Am J Physiol Renal Physiol,
November 1, 2008;
295(5):
F1365 - F1375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Garcia-Verdugo, A. Ravasio, E. G. de Paco, M. Synguelakis, N. Ivanova, J. Kanellopoulos, and T. Haller
Long-term exposure to LPS enhances the rate of stimulated exocytosis and surfactant secretion in alveolar type II cells and upregulates P2Y2 receptor expression
Am J Physiol Lung Cell Mol Physiol,
October 1, 2008;
295(4):
L708 - L717.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2007 by the American Physiological Society.