AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 293: F885-F894, 2007. First published June 13, 2007; doi:10.1152/ajprenal.00519.2006
0363-6127/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/3/F885    most recent
00519.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Traylor, A.
Right arrow Articles by Hill-Kapturczak, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Traylor, A.
Right arrow Articles by Hill-Kapturczak, N.

Specificity protein 1 and Smad-dependent regulation of human heme oxygenase-1 gene by transforming growth factor-beta1 in renal epithelial cells

Amie Traylor, Thomas Hock, and Nathalie Hill-Kapturczak

Division of Nephrology, Department of Medicine, Nephrology Research and Training Center, University of Alabama at Birmingham, Birmingham, Alabama

Submitted 26 December 2006 ; accepted in final form 9 June 2007


    ABSTRACT
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Excess transforming growth factor-beta1 (TGF-beta1) in the kidney leads to increased cell proliferation and deposition of extracellular matrix, resulting in progressive kidney fibrosis. TGF-beta1, however, stabilizes and attenuates tissue injury through the activation of cytoprotective proteins, including heme oxygenase-1 (HO-1). HO-1 catabolizes pro-oxidant heme into substances with anti-oxidant, anti-apoptotic, anti-fibrogenic, vasodilatory and immune modulatory properties. Little is known regarding the molecular regulation of human HO-1 induction by TGF-beta1 except that it is dependent on de novo RNA synthesis and requires a group of structurally related proteins called Smads. It is not known whether other DNA binding proteins are required to initiate transcription of HO-1 and, furthermore, the promoter region(s) involved in TGF-beta1-mediated induction of HO-1 has not been identified. The purpose of this study was to further delineate the molecular regulation of HO-1 by TGF-beta1 in human renal proximal tubular cells. Actinomycin D and nuclear run-on studies demonstrate that TGF-beta1 augments HO-1 expression by increased gene transcription and does not involve increased mRNA stability. Using transient transfection, mithramycin A, small interfering RNA, electrophoretic mobility shift assays, and decoy oligonucleotide experiments, a TGF-beta1-responsive region is identified between 9.1 and 9.4 kb of the human HO-1 promoter. This ~280-bp TGF-beta1-responsive region contains a putative Smad binding element and specificity protein 1 binding sites, both of which are required for human HO-1 induction by TGF-beta1.

gene regulation; fibrosis; renal proximal tubule cell


TRANSFORMING GROWTH FACTOR-beta1 (TGF-beta1) is a regulatory cytokine linked to the pathogenesis and progression of numerous kidney diseases due to its biological properties which result in increased extracellular matrix deposition and fibrosis (reviewed in Refs. 5, 54). TGF-beta1 levels are increased in human and animal models of progressive kidney disease (9, 17, 55, 56). Transgenic mice overexpressing TGF-beta1 develop progressive kidney fibrosis and die from renal failure (25). Paradoxically, TGF-beta1 is released in response to injury to regulate homeostasis and suppress inflammation through mechanisms that are not clearly understood. One mechanism may involve its ability to upregulate a cytoprotective protein, heme oxygenase-1 (HO-1) (20, 27, 37), an inducible 32-kDa enzyme that modulates adaptive responses to tissue injury in several pathophysiological states (reviewed in Refs. 1, 31, 36). HO-1 catalyzes the rate-limiting step in the degradation of pro-oxidant heme yielding iron, biliverdin, and carbon monoxide (CO), a vasodilator, with anti-apoptotic and immunomodulatory effects (31, 38). Biliverdin is transformed by biliverdin reductase into bilirubin, an antioxidant that can scavenge lipid peroxides (11, 49). Recent studies demonstrated that HO-1, via bilirubin and CO, also displays anti-fibrogenic properties (16, 29, 32, 51, 53, 59).

The molecular mechanisms of HO-1 induction by TGF-beta1 have not been entirely elucidated. TGF-beta1 signals through two receptor serine-threonine kinases (type I and type II) to initiate downstream signaling events through intracellular effector substrates, which include a group of structurally related proteins called Smads (reviewed in Refs. 12, 34). Activated TGF-beta receptors phosphorylate receptor-regulated Smads (Smad2, Smad3) which in turn form complexes with the common mediator Smad (Smad4) (12, 34). The Smad complex translocates to the nucleus and activates transcription by directly binding to a Smad binding element (SBE), a beta hairpin with the major groove of the sequence GTCT and CAGA, or by association with other DNA binding proteins (12, 48, 57). Smad3 and Smad4 have also been shown to bind to GC-rich sequences (12, 15, 23). Smads can interact with diverse transcriptional coactivators including the Jun family of proteins, CCATT/enhancer binding protein, and specificity protein 1 (Sp1) as well as others (reviewed in Ref. 12).

What is known regarding the molecular mechanism of HO-1 upregulation by TGF-beta1 is that HO-1 induction by TGF-beta1 is dependent on de novo RNA synthesis and is attenuated by overexpression of inhibitory Smad, Smad7, in human renal epithelial cells (20). Although it has been demonstrated that HO-1 induction by TGF-beta1 requires Smads (20, 26), it is not known whether other DNA binding proteins are required and, if so, which one(s) to initiate transcription of HO-1. Furthermore, the promoter region(s) involved in TGF-beta1-mediated activation of HO-1 has not been identified. It has been previously demonstrated that TGF-beta1-mediated HO-1 induction requires sequences outside the –4.5-kb promoter region responsive to hemin, cadmium, triterpenoid, and nerve growth factor (19, 20, 30, 44). In addition, we previously described an internal enhancer in the human HO-1 gene that, together with the 4.5-kb promoter, is responsible for maximal induction following heme and cadmium stimulation but it is not responsive to all stimuli, including TGF-beta1 (19). The purpose of this study was to identify the TGF-beta1-responsive region(s) in the human HO-1 promoter and further characterize the molecular mechanism(s) of TGF-beta1-mediated HO-1 induction.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reagents. Tissue culture media, serum and supplements, Hank's balanced saline solution, LipofectAMINE 2000, LTX, Oligofectamine, OptiMEM, Klenow, and restriction enzymes were obtained from Invitrogen (Carlsbad, CA). Recombinant human TGF-beta1 was from R & D Systems (Minneapolis, MN). Anti-HO-1 antibody (SPA 896) was from Stressgen (Vancouver, BC, Canada). Anti-actin antibody, actinomycin D, and mithramycin A were from Sigma (St. Louis, MO). Anti-Sp1 antibody was obtained from Upstate Cell Signaling Solutions. The peroxidase-conjugated goat anti-rabbit IgG antibody was from Jackson ImmunoResearch Laboratories (West Grove, PA) and siGENOME SMARTpool, a mixture of four different sequences designed to target Sp1, was purchased from Dharmacon (Lafayette, CO). Adenovirus containing Smad4 (AdSmad4) was a generous gift from Dr. W. Samuel, National Institutes of Health (Bethesda, MD).

Cell culture. An immortalized human renal proximal tubule epithelial cell line from normal adult kidney, transduced with HPV-16 (45), HK-2 cells (American Type Culture Collection, Manassas, VA), was grown in keratinocyte serum-free medium (Invitrogen) supplemented with 5 ng/ml recombinant epidermal growth factor, 40 µg/ml bovine pituitary extract, and 1% antibiotic-antimycotic solution (Invitrogen). MDA-MB-468 cells (American Type Culture Collection), a human breast cancer cell line deficient in Smad4, were kindly provided by Dr. W. Samuel and were grown in Leibovitz's L-15 medium with 2 mM L-glutamine, 10% FBS, and 1% antibiotic-antimycotic solution. All cells were grown in a humidified incubator at 37°C, 95% air-5% CO2.

Northern and immunoblot analysis. After treatments, total RNA and protein were collected and Northern and immunoblot analyses were performed as described previously (20).

HO enzyme activity. Confluent HK-2 cells were treated with vehicle (BSA/HCl), hemin (5 µM), or TGF-beta1 (10 ng/ml) for 6.5 h. HO enzyme activity was measured by previously described methods (2, 4). HO activity is expressed as picomoles of bilirubin formed per hour per milligram of protein.

Nuclear run-on assay. HK-2 cells were grown to confluency in 150-mm cell culture plates and treated with vehicle (BSA/HCl) or TGF-beta1 (10 ng/ml) for 2 h. The transcription rate of the HO-1 gene by TGF-beta1 was measured by nuclear run-on assay as previously described (3). Radiolabeled RNA was hybridized to a hybond membrane containing 3.5 µg of human HO-1 and GAPDH cDNAs in the form of linearized plasmids (HO-1/pcDNA3.1 and GAPDH/pCR2.1TOPO, respectively).

Plasmid constructs. The construction of the 4.5-, 9.1-, and 11.6-kb promoter fragments in a luciferase vector (pHOGL3/4.5, pHOGL3/9.1, pHOGL3/11.6) have been described previously (19, 21). Additional HO-1 promoter deletion constructs (pHOGL3/9.7, pHOGL3/9.4, pHOGL3/8.5) were prepared by excising the 11.6-kb promoter fragment from pHOGL3/11.6, with Sac2 and MluI followed by exonuclease digestion with 3 units of Bal-31. The ends were repaired with Klenow and then digested with NheI, leaving the 5'-end of the promoter fragments blunt ended and the 3'-end with an NheI overhang. The pHOGL3/11.6 vector was linearized, by digestion with MluI, filling in the overhang with Klenow, followed by digestion with NheI. This resulted in the pGL3 vector with 3.5 kb of the HO-1 promoter with an NheI overhang and the other end of the vector containing a blunt end. The linear vector containing the 3.5-kb HO-1 promoter was treated with calf intestinal alkaline phosphatase and then ligated with the Bal-31-digested inserts. The ligation products were transformed in DH10B competent cells and purified by Qiagen DNA isolation kits. All constructs were verified for orientation by sequencing and restriction digestion analysis.

Expression constructs for Smad2, Smad3, Smad4, and Smad7 were generously provided by Takeshi Imamura and Kohei Miyazono and have been described previously (22). The Sp1 expression vector was kindly provided by Kun-Sang Chang (MDACC South Campus) and has been described elsewhere (52).

Transfection and measurement of luciferase activity. HK-2 cells (80–90% confluent) were grown in 100-mm tissue culture dishes and were transfected with equimolar amounts of promoter reporter plasmids using Lipofectamine 2000 or LTX, according to the manufacturer's instructions. In some experiments, promoter-reporter plasmids were cotransfected with equimolar amounts of Smad2, Smad3, Smad4, Smad7, or Sp1 expression vectors and pcDNA3 empty vector. Three to six hours posttransfection of promoter-reporter plasmids, cells were passaged into 6- or 12-well tissue culture dishes to generate several sets of cells from the same transfection batch [a batch transfection protocol as previously described (19)]. Transfected cells were allowed to recuperate for 24 h before stimulus treatments with vehicle (BSA/HCl) or TGF-beta1 (5–10 ng/ml) for 16 h. Luciferase activity was monitored using the luciferase reporter assay system (Promega) according to the manufacturer's instructions using a Sirius Luminometer (Berthold Detection Systems, Pforzheim, Germany).

For Sp1 RNA interference, cells were transfected with a mixture of four different sequences designed to target Sp1 (siGENOME SMARTpool, 400 nM) or a nontargeting oligonucleotide as a control for nonsequence-specific effects (mock: AAUGGAAGACCACUCCCACUC, 400 nM), using Oligofectamine reagent. Oligofectamine without oligonucleotides was used as control. Cells were allowed to recover overnight before transfection with the promoter-reporter plasmids, treatment, and luciferase activity measurements as described above. Some cells were analyzed for Sp1 protein, HO-1 protein, or HO-1 RNA, by immunoblot or Northern analysis, as described above.

Nuclear extract and EMSA protocol. Nuclear extracts were prepared from HK-2 cells treated with TGF-beta1 for 30 min. Cells were harvested in 50-ml conical tubes, pelleted, and resuspended in 300 µl of a hypotonic buffer containing 10 mM HEPES (pH 7.9), 0.75 mM spermidine, 0.75 mM spermine, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 10 mM KCl and incubated on ice for 15 min. Fifteen microliters of 10% NP-40 were added and cells were vortexed for 10 s. The tube was centrifuged at 2,000 rpm, 4°C for 15 s to pellet the nuclei. The supernatant was removed and the nuclear pellet was resuspended in 118.6 µl of a nuclear resuspension buffer containing 20 mM HEPES (pH 7.9), 0.75 mM spermidine, 0.75 mM spermine, 0.2 mM EDTA, 0.2 mM EGTA, 25% glycerol, 2 mM DTT; and 21.4 µl of 4 M KCl was added to the tube and was rocked vigorously on ice for 20 min. Forty-six microliters of cold resuspension buffer were added to the tube and mixed thoroughly. The nuclear extract was centrifuged at 10,000 rpm, 4°C for 15 min and the supernatant was transferred to a new tube and stored at –80°C.

The Sp1 and mutated Sp1 probes consisted of the oligonucleotides described in GoGoGoGoGoGoFig. 7A annealed to their respective complements. Nuclear extracts (4 µg) were incubated with oligonucleotide inhibitor (20-fold molar excess) or Sp1 antibody (1 µg) in a 20-µl reaction containing 20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris (pH 7.5), and 500 µg poly (dI.dC) for 20 min at room temperature with 0.1 pmol of an end labeled probe. The resulting protein-DNA complexes were analyzed by electrophoresis in a 5% (wt/vol) nondenaturing gel. The gels were fixed in methanol (10%)/acetic acid solution (10%), then dried, and exposed to film.


Figure 1
View larger version (58K):
[in this window]
[in a new window]

 
Fig. 1. Heme oxygenase-1 (HO-1) mRNA and protein are upregulated by transforming growth factor-beta1 (TGF-beta1) in HK-2 cells. A: confluent HK-2 cells were treated with TGF-beta1 (5 ng/ml) for 2–24 h and TGF-beta1 (3.0–7.0 ng/ml) for 4 h. RNA was collected and Northern analysis was performed using 32P-labeled human HO-1 and GAPDH cDNA probes as described in EXPERIMENTAL PROCEDURES. B: HK-2 cells were treated with TGF (5 or 10 ng/ml) for 4–24 h. For immunoblot analysis, total cell lysates were collected and separated as described in EXPERIMENTAL PROCEDURES. Membranes were incubated with anti-HO-1 (1:5,000) followed by a 1:10,000 dilution of peroxidase-conjugated goat anti-rabbit IgG antibody (1:10,000). Vehicle (V) for TGF-beta1 (BSA/HCl) was used as control. Representative Northern immunoblots of n = 3.

 

Figure 2
View larger version (60K):
[in this window]
[in a new window]

 
Fig. 2. TGF-beta1-mediated HO-1 induction occurs at the transcriptional level and not by stabilization of HO-1 mRNA. A: confluent HK-2 cells were treated with V (BSA/HCl) or TGF-beta1 (10 ng/ml) for 2 h and nuclei were collected. Nuclei were allowed to transcribe RNA in the presence of ATP, CTP, GTP, and radiolabeled 32P-UTP as described in EXPERIMENTAL PROCEDURES. Radiolabeled RNA was purified and hybridized to a hybond membrane containing 3.5 µg of HO-1 and GAPDH cDNA in the form of linearized plasmids (HO-1/pcDNA3.1 and GAPDH/pCR2.1TOPO, respectively). Representative of n = 2. B: confluent HK-2 cells were all exposed to TGF-beta1 (5 ng/ml) for 4 h, the time at which maximal induction is observed, except V (BSA/HCl)-treated control (lane 1). Cells were then washed with HBSS and fresh media was added containing actinomycin D (Act. D; 4 µM) with or without additional TGF-beta1 (5 ng/ml). RNA was collected at 0 (no additional treatment) and various time points up to 8 h. Northern analysis was performed as described in EXPERIMENTAL PROCEDURES. Representative of n = 3.

 

Figure 3
View larger version (26K):
[in this window]
[in a new window]

 
Fig. 3. A region between –9.1 and –9.4 kb of the HO-1 promoter is necessary for TGF-beta1 responsiveness. A: HK-2 cells were transiently transfected, using a batch transfection protocol as described in EXPERIMENTAL PROCEDURES, with equimolar amounts of the indicated HO-1 promoter fragments in pGL3. Transfected cells were split into 12-well trays, 5–7 h posttransfection and allowed to recover for 24 h. After recovery, cells were treated with TGF-beta1 (5 ng/ml) or V (BSA/HCl) for 16 h to elicit maximum luciferase reporter response. Cell lysates were analyzed for luciferase activity. Each bar represents n ≥ 3 independent experiments with 12 replicates per group per experiment. *P < 0.001 compared with respective expression vector, V-treated control. {dagger}P < 0.001 compared with TGF-beta1-treated pHOGL3/9.1 (–9.1-kb HO-1 promoter). B: 280-bp sequence between –9.1 and –9.4 kb of the human HO-1 promoter is depicted. Putative SBE is underlined. Sp1 consensus sequences (GT and GC boxes) are capitalized and in a larger font. GC boxes are underlined. The oligonucleotide region that is boxed depicts the sequence used in EMSA experiments in Fig. 7 and the region that is heavily underlined depicts the sequence used for Decoy experiments in Fig. 8.

 

Figure 4
View larger version (29K):
[in this window]
[in a new window]

 
Fig. 4. HO-1 induction by TGF-beta1 requires Smads. A: HK-2 cells were transiently transfected with pHOGL3/11.6 (–11.6-kb HO-1 promoter) and Smad7 (in pcDNA3) or empty vector (pcDNA3) as described in EXPERIMENTAL PROCEDURES. Cells were exposed to TGF-beta1 (5 ng/ml) or V (BSA/HCl) for 16 h and cell lysates were collected and luciferase activity was measured (n = 3, 12 replicates/group/experiment). *P < 0.001 vs. V-treated empty vector. {dagger}P < 0.05 vs. V-treated Smad7. B: HK-2 cells were cotransfected with pHOGL3/9.4 (–9.4-kb HO-1 promoter) and equimolar amounts of Smads and/or empty vector (pcDNA3) alone or in combination as indicated. Total cell lysates were collected 40 h posttransfection and assayed for luciferase activity (n = 4, 6–12 replicates/group/experiment). *P < 0.001 and {ddagger}P < 0.01 vs. V-treated empty vector (pcDNA3). C and D: MDA-MB-468 cells, a Smad 4-deficient cell line, were exposed to AdSmad4 (C) or AdGFP (D) for 1 h and allowed to recuperate for an additional 44 h. Cells were then treated with TGF-beta1 (10 ng/ml), hemin (5 µM), or V (BSA/HCl) for 4 h and the RNA was processed by Northern analysis (representative of n = 3) as described in EXPERIMENTAL PROCEDURES.

 

Figure 5
View larger version (40K):
[in this window]
[in a new window]

 
Fig. 5. GC-binding inhibitor, mithramycin A, prevents TGF-beta1-mediated HO-1 promoter activity as well as HO-1 mRNA and protein induction. A: HK-2 cells were transiently transfected with pHOGL3/9.4 (–9.4-kb HO-1 promoter). Five to seven hours posttransfection, cells were split into 12-well trays and allowed to recover for 24 h. Cells were exposed to mithramycin A (MA; 100 nM) or V for MA (VMA; methanol) for 3 h before TGF-beta1 (5 ng/ml) or V for TGF-beta1 (BSA/HCl) for 16 h. Cell lysates were collected and luciferase activity was measured (n = 3, with 12 replicates/group/experiment, *P < 0.001 vs. V-treated pHOGL3/9.4). B and C: HK-2 cells were treated with MA (10 or 100 nM) or VMA (methanol) for 16 h and then TGF-beta1 (5 ng/ml) or V for TGF-beta1 (BSA/HCl) for 4 h for Northern analysis (B, representative of n = 3) or 8 h for immunoblot analysis (C, representative of n = 3) as described in EXPERIMENTAL PROCEDURES.

 

Figure 6
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 6. Effects of overexpression of Sp1 or siRNA targeted against Sp1. A: HK-2 cells were cotransfected with pHOGL3/9.4 (–9.4-kb HO-1 promoter) and an Sp1 expression vector or empty vector (pcDNA3). Five to seven hours posttransfection, cells were split into 12-well trays and allowed to recover for 40 h (n = 3, with 12 replicates/group/experiment, *P < 0.0001 vs. empty vector control). B: HK-2 cells were transfected with siRNA against Sp1 (siSp1, 400 nM) or mock (400 nM) and allowed to recover for 24 h than transfected with pHOGL3/9.4. Five to seven hours posttransfection, cells were split into 12-well trays and allowed to recover for 24 h before treatment with TGF-beta1 (5 ng/ml) or V for TGF-beta1 (BSA/HCl) for 16 h (n = 2, with 12 replicates/group/experiment, {dagger}P < 0.001 vs. all other groups, {ddagger}P < <0.05 vs. mock control). C: HK-2 cells were transfected with oligofectamine alone (control), 400 nM mock control (mock), or 400 nM siSP1. Protein was collected 28 h later and immunoblot analysis of Sp1 was performed. Top: immunoblot (representative of n = 5). Bottom: graphical representation of arbitrary units of Sp1/actin densitometry. {ddagger}P < <0.05 vs. oligofectamine control.

 

Figure 7
View larger version (46K):
[in this window]
[in a new window]

 
Fig. 7. EMSA showing DNA-protein interaction with Sp1-binding site. A: sequences of the forward strand for the oligonucleotides containing the Sp1 site just 3' proximal to the SBE site of the human HO-1 promoter (boxed oligonucleotide region in Fig. 3B) used for EMSA probes are shown. The Sp1 core sequence is underlined, and mutated base pairs are shown in larger font. B: nuclear extracts were prepared from TGF-beta1-treated HK-2 cells and incubated with the Sp1 probe (lane 2). The arrow and arrowhead indicate the shifted DNA-protein complexes. A 20-fold excess of cold competitor (cc) was added as indicated consisting of the cold probe itself (lane 3). Specific Sp1 antibody (Ab) was added and the supershift marked with an * (lane 4). C: nuclear extracts were prepared from TGF-beta1-treated HK-2 cells and incubated with the Sp1 probe (lane 1) or mutated probes (Mut1-Mut4, lanes 2–5, respectively). The arrow and arrowhead indicate the shifted DNA-protein complexes. Representative EMSAs of n = 3, using different nuclear extracts each time.

 
Decoy oligonucleotide assays. The sequences of the forward strand for the wild-type, SBE-mutated, and Sp1-mutated decoy oligonucleotides are presented in Fig. 8A. Double-strand oligonucleotides were prepared by combining equal amounts of forward and reverse strand oligonucleotides in annealing buffer [10 mM Tris (pH 8), 1 mM EDTA, and 50 mM NaCl], boiling for 10 s, and slow cooling overnight at room temperature. The double-strand oligonucleotides were cotransfected in HK-2 cell cultures together with the pHOGL3/9.4 reporter construct, using 5- to 200-fold (3.25–130 pmol) greater molar equivalents of the double-strand decoy oligonucleotides vs. the reporter construct, treated with TGF-beta1, and assayed for luciferase activity as described above.


Figure 8
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 8. Both the SBE and Sp1-like sequences are required for TGF-beta1-mediated HO-1 induction. A: sequences of the forward strand for the wild-type, SBE-mutated, and Sp1-mutated decoy oligonucleotides are shown. The SBE and Sp1 consensus sequences are underlined and mutated base pairs are in larger font. B and C: HK-2 cells were transiently cotransfected, using a batch transfection protocol as described in EXPERIMENTAL PROCEDURES, with pHOGL3/9.4 (–9.4-kb HO-1 promoter) and double-strand decoy oligonucleotides. Transfected cells were split into 12-well trays 5–7 h posttransfection and allowed to recover for 24 h. After recovery, cells were treated with TGF-beta1 (5 ng/ml) or V (BSA/HCl) for 16 h to elicit maximum luciferase reporter response. Cell lysates were analyzed for luciferase activity. B: pHOGL3/9.4 (0.65 pmol):wild-type (WT) decoy oligonucleotide (3.25–130 pmol) dose response; each bar represents n = 1, with 12 replicates/group. C: wild-type and mutated decoy oligonucleotides (expression vector:decoy equal to 1:200), each bar represents n = 2–8 independent experiments with 12 replicates/group/experiment. *P < 0.001, {dagger}P < 0.01 compared with respective expression vector/decoy, V-treated control.

 
Data analysis. All results are derived from at least two to four independent experiments. Unpaired t-test with Welch correction was used to compare two groups. For multiple group comparisons, ANOVA and Student-Newman-Keuls posttest were used. Data are represented as means ± SE and considered significant at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
TGF-beta1 induces HO-1 mRNA, protein expression, and HO activity in an immortalized human renal proximal tubule (HK-2) cell line. HK-2 cells, an immortalized renal proximal tubular epithelial cell line, were examined for TGF-beta1 responsiveness and steady-state levels of HO-1 mRNA and protein were analyzed. Similar to a primary human renal proximal tubular cell line (20), HK-2 cells treated with TGF-beta1 exhibited a significant induction in HO-1 mRNA and protein over vehicle-treated control (Fig. 1). Maximum HO-1 mRNA induction (~5.4-fold) was observed at 4 h (Fig. 1A) and maximum induction of HO-1 protein was observed at 4–8 h (~3.1-fold, Fig. 1B). HO enzyme activity was ~1.5-fold higher in TGF-beta1-treated HK-2 cells than vehicle-treated cells [10.17 ± 0.12, 15.77 ± 0.47, and 73.93 ± 10.75 pmol of bilirubin formed·h–1·mg protein–1 for vehicle-, TGF-beta1-, and hemin (positive control)-treated cells, respectively, n = 2].

Transcriptional activation of HO-1 by TGF-beta1. The importance of de novo transcription was assessed by nuclear run-on analysis following stimulation with TGF-beta1. HK-2 cells were treated with media containing vehicle (control) or TGF-beta1 (10 ng/ml) and nuclei were collected after 2 h. Nuclei were then allowed to transcribe RNA in the presence of radiolabeled 32P-UTP as described in EXPERIMENTAL PROCEDURES. As shown in Fig. 2A, TGF-beta1 augmented HO-1 gene transcription by about twofold compared with control cells. Therefore, the induction of HO-1 by TGF-beta1 occurs by direct increases in de novo transcription.

Since nitric oxide-mediated HO-1 induction occurs, at least in part, through increased HO-1 mRNA stability (6), the effects of TGF-beta1 on HO-1 mRNA abundance and stability were explored by measuring the half-life of HO-1 mRNA in HK-2 cells. As shown in Fig. 2B, the half-life of HO-1 mRNA following TGF-beta1 stimulation was ~2 h and was similar in the presence or absence of additional TGF-beta1 exposure. Similar results were obtained in the primary renal proximal tubular cell culture (data not shown). These data suggest that, similar to most other inducers of HO-1 including hemin, mRNA stability is not involved in TGF-beta1-mediated HO-1 mRNA induction.

A cis-acting region between –9.1 and –9.4 kb of the human HO-1 promoter is responsible for TGF-beta1-mediated HO-1 induction. To identify promoter elements in the human HO-1 gene that mediate its transcription following stimulation with TGF-beta1, we performed transient transfection experiments in HK-2 cells using equimolar amounts of 4.5-, 8.5-, 9.1-, 9.4-, 9.7-, and 11.6-kb promoter fragments of the HO-1 gene cloned into a promoterless luciferase vector (pGL3). Previously, we showed that the 4.5-kb construct demonstrates significant promoter activity with heme, cadmium, and triterpenoids but not with TGF-beta1 or oxidized LDL, implying that the mechansim of the upregulation of HO-1 differs depending on the inducer (3, 19, 20, 30). As shown in Fig. 3A, the 4.5- and 8.5-kb promoter fragments were not responsive to TGF-beta1 (5 ng/ml, 16 h). The 9.1-kb fragment demonstrated increased luciferase activity (~1.5-fold) and the 9.4-, 9.7-, and 11.6-kb fragments each demonstrated increased activity (~2-fold) following TGF-beta1 exposure (Fig. 3A). Therefore, two regions, a partial one between 8.5 and 9.1 kb, and a 280-bp region between –9.1 and –9.4 kb of the human HO-1 promoter are required for induction of HO-1 by TGF-beta1. Computer analysis reveals that there is a putative SBE and several putative Sp1-binding sites within the region between –9.1 and –9.4 kb (Fig. 3B).

TGF-beta1-mediated HO-1 induction is Smad dependent. To examine the effects of overexpression of Smads on TGF-beta1-mediated reporter activity, HK-2 cells were transiently transfected with a TGF-beta1-responsive HO-1 promoter in PGL3 (pHOGL3/11.6 or pHOGL3/9.4) and Smad7 (inhibitory Smad), Smad2, Smad3, Smad4 overexpression vectors or equimolar amounts of pcDNA3 empty vector. Cells were exposed to TGF-beta1 (5 ng/ml) for 16 h, and luciferase activity was measured. Cotransfection of the inhibitory Smad7 with the HO-1 promoter blocked TGF-beta1-inducible promoter activity (Fig. 4A) while overexpression of Smad2, Smad3, and/or Smad4 increased basal luciferase activity over that of an empty vector (Fig. 4B), with Smad3 combinations having the greater effects (pcDNA3/Smad3 by 3.8-fold, Smad3/Smad4 by 4-fold, and Smad2/Smad3 by 5-fold over empty vector alone).

To further explore the involvement of Smads in TGF-beta1-mediated HO-1 induction, a Smad4-deficient breast cancer cell line (MDA-MB-468) was employed. As seen in Fig. 4C, TGF-beta1 (5 ng/ml, 4 h) was not capable of inducing HO-1 mRNA in the Smad4-deficient cells; however, transduction of these cells with AdSmad4 restored HO-1 mRNA induction by TGF-beta1 (5 ng/ml, 4 h). AdGFP alone did not affect basal or TGF-beta1-inducible HO-1 expression in Smad4-deficient cells (Fig. 4D). Hemin (5 µM, 4 h), a potent inducer of HO-1, produced a robust induction in HO-1 mRNA in wild-type Smad4-deficient MDA-MB-468 cells (Fig. 4D). Taken together, these results further demonstrate the dependency of HO-1 induction by TGF-beta1, but not hemin, on Smads.

Mithramycin A blocks TGF-beta1-mediated HO-1 induction. HO-1 expression induced by TGF-beta1 was investigated using mithramycin A, a GC-binding inhibitor (42, 43, 58). The 9.4-kb promoter fragment of the HO-1 gene (pHOGL3/9.4) containing the ~280-bp TGF-beta1-responsive region with its putative Sp1 sites was assayed for luciferase activity after exposure to TGF-beta1 in the presence or absence of mithramycin A (100 nM). Interruption of GC-binding suppressed TGF-beta1-inducible promoter activity as well as basal promoter activity (Fig. 5A). In addition, mithramycin A also blocked endogenous HO-1 mRNA and protein expression induced by TGF-beta1 in HK-2 cells (Fig. 5, B and C).

Effect of Sp1 on the transcriptional activity of the 9.4-kb HO-1 promoter. Cotransfections were performed in HK-2 cells with the pHOGL3/9.4 construct and an Sp1 expression vector or siRNA targeted against Sp1. Overexpression of Sp1 enhanced basal HO-1 promoter-reporter activity by ~2.5-fold (Fig. 6A), whereas siRNA-based inhibition of Sp1 reduced basal reporter activity by ~28% compared with mock siRNA control and prevented TGF-beta1-mediated activation (Fig. 6B). As shown in 6C, siRNA against Sp1 reduced Sp1 proteins levels by ~76% which was sufficient to reduce reporter activity, but not TGF-beta1-mediated increases in endogenous HO-1 mRNA or endogenous HO-protein (data not shown).

EMSA indicates that Sp1 interacts with the HO-1 promoter in vitro. To further examine the role of Sp1 in TGF-beta1-mediated HO-1 induction in renal proximal tubular epithelial cells, EMSA was performed using end-labeled dsDNA probes containing the putative Sp1-binding site (Sp1 probe, Fig. 7A). Obvious protein-DNA complexes were observed with the wild-type Sp1 oligonucleotide probe (Fig. 7B, lane 2 and Fig. 7C, lane 1). Protein-DNA complexes were competed out with 20-fold molar excess of unlabeled wild-type probe (Fig. 7B, lane 3). To show specificity, supershift experiments were performed with an anti-Sp1 antibody, which produced a reduction in the upper band shift intensity and a small supershift (Fig. 7B, lane 4). When the GT/GC-box was mutated in the Sp1 probe, there was no formation of the upper protein-DNA complex (lanes 2–5). Interestingly, when Mut2 and Mut4 (regions 5' of the GT-box/GC-box also mutated) were used as probes (Fig. 7C, lanes 3 and 5), there was no formation of either protein-DNA complex. Taken together, Sp1 appears to bind to putative Sp1-binding sites in the HO-1 promoter.

Effect of decoy oligonucleotides on TGF-beta1-mediated HO-1 induction. The region between 9.1 and 9.4 kb of the HO-1 promoter is very GC rich, including a sequence of 22 G's and/or C's between the GT-box/GC-boxes 3' of the SBE. Attempts to make mutations in the pHOGL3/9.4 based on PCR were limited by several factors such as the size of the plasmid, difficulty in designing unique primers, and most notable, the string of G's and C's. In fact, in several experiments all elongation ceases at the GC box located at 9.19 kb. Thus we performed studies using a decoy oligonucleotide method that has been well described (10, 14, 24). Double-strand decoy oligonucleotides were cotransfected with the HO-1 promoter construct in HK-2 cell cultures to interfere with Smad and/or Sp1 binding to respective cis-acting elements within the 9.4-kb HO-1 promoter-reporter vector. Figure 8A lists the top strand sequences of wild-type and mutated oligonucleotides used for these decoy studies. To establish the amount of decoy oligonucleotides required, HK-2 cells were batch transfected with the pHOGL3/9.4 construct (0.65 pmol) and 5- to 200-fold greater (3.25–130 pmol) wild-type double-strand oligonucleotide bearing the putative SBE and the Sp1 cis-sequence. HO-1 promoter transcription was determined after TGF-beta1 (5 ng/ml, 16 h) or vehicle treatment. When the reporter construct was cotransfected with 100- and 200-fold more wild-type decoy oligonucleotide, TGF-beta1-induced transcription was inhibited (Fig. 8B). Using 200-fold greater Sp1 and/or SBE mutated decoy oligonucleotides, TGF-beta1-induced reporter activities were restored (Fig. 8C). Thus both the SBE and Sp1-binding sites are required for transcriptional activation of the human HO-1 promoter by TGF-beta1.


    DISCUSSION
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
TGF-beta regulates a broad range of cellular activities that are often cell type and context dependent, including proliferation, differentiation, apoptosis, adhesion, motility, and extracellular matrix deposition (reviewed in Ref. 33). While the Smad pathway is the best-characterized mechanism of TGF-beta signaling, alternate pathways also play key roles in modulating TGF-beta responsiveness. In fact, combinatorial signaling of a diversity of DNA sequence-binding transcription factors and the Smad pathway has been shown to modulate the wide range of different responses to TGF-beta (reviewed in Refs. 8, 12, 47). Smads have been shown to interact with several transcription factor members of the bHLH, the bZip, the forkhead, the nuclear receptor, the Runx, the zinc finger protein families as well as others (reviewed in Refs. 12, 33). In this way, TGF-beta can elicit different gene responses based on the availability of cofactors within a cell type. Thus identifying Smad DNA-binding cofactors is important for delineating cell-specific responses of TGF-beta action. One such regulatory mechanism for several TGF-beta-responsive genes, including amyloid-beta peptide, a cyclin-dependent kinase inhibitor (p15Ink4B), and others, involves the cooperation between Smads and the transcription factor Sp1, a member of the zinc finger protein family, to regulate gene expression (7, 10, 13, 28, 39, 42, 46, 58). Here, we identify a TGF-beta-responsive region between 9.1 and 9.4 kb (~280 bp) of the human HO-1 promoter that contains a putative SBE and several putative Sp1-binding sites.

There are several putative Sp1 consensus sequences throughout the human HO-1 promoter and, recently, the Sp1-binding site between –121 and –107 bp from the transcriptional start site has been shown to be involved in nerve growth factor-mediated HO-1 induction (44). It has also been demonstrated that there is interaction of Sp1, Sp3, and hepatocyte nuclear factor-4 with the –1.793- to –1.744-kb fragment of the HO-1 gene to elicit basal HO-1 induction in human hepatoma HepG2 cells (50). The 280-bp TGF-beta-responsive region between 9.1 and 9.4 kb of the human HO-1 promoter contains a putative SBE in close proximity to several GC-rich potential Sp1-binding sites (Fig. 3B). TGF-beta1 has been previously shown to increase the association between Sp1 and Smads in human mesangial cells and human renal proximal tubular epithelial cells using a biotinylated DNA precipitation assay and immunoprecipitation studies (42, 58). Herein, we demonstrate that mithramycin A, a G-C-specific DNA binding antibiotic that inhibits RNA synthesis by preventing binding of regulatory proteins such as Sp1 to G-C-rich sequences (42, 43, 58), prevented TGF-beta1-mediated HO-1 mRNA, protein expression, and promoter activity. In EMSA, a protein-DNA complex that is formed using a probe containing the Sp1-binding sequence within the 280-bp TGF-beta1-responsive region is supershifted by Sp1 antibody. When the Sp1-binding sequence is mutated, binding of the upper protein-DNA complex is lost. Furthermore, siRNA targeted against Sp1 reduced both basal and TGF-beta-mediated promoter activity while overexpression of Sp1 enhanced HO-1 promoter activity.

Overexpression of Smad2, Smad3, and/or Smad4 increased basal promoter activity, with Smad3 having the largest effect on activation of the human HO-1 promoter. Smad2 and Smad3 have been shown to have differential roles in TGF-beta1-induced cellular responses. TGF-beta1-Smad3 signaling is a key mediator of TGF-beta-induced profibrotic outcomes in renal and nonrenal cells (26, 41). Recently, it has been suggested that early TGF-beta1 responses that initiate tubulointerstitial fibrosis (induction of connective tissue growth factor, downregulation of E-cadherin) are critically dependent on Smad3; however, delayed responses involved in the development of tubulointerstitial fibrosis (induction of matrix metalloproteinase-2) require Smad2 (40). HO-1 induction has been shown to be anti-fibrogenic and perhaps its upregulation by TGF-beta1 may serve as a counterbalance to the profibrotic effects observed in early events (16, 18, 29, 32, 35, 51, 53, 59).

HO-1 induction by TGF-beta1 is dependent on the Smad pathway and was first observed by overexpression of the inhibitor Smad, Smad7, in human renal proximal tubular cells (20). Here, we show that overexpression of Smad7 inhibits basal and TGF-beta1-mediated HO-1 promoter/reporter activity. Further corroboration of the involvement of Smads was provided using a Smad4-deficient breast cancer cell line to reveal that Smad4 is required for TGF-beta1- but not hemin-mediated HO-1 induction. These observations are consistent with a report by Kretschmer et al. (26) who used antisense oligonucleotides to knockdown Smad2, Smad3, and Smad4 expression to demonstrate that the presence of all three Smads is required for the induction of HO-1 by TGF-beta in HaCaT cells, a human keratinocyte cell line.

The critical TGF-beta1-responsive elements within the HO-1 promoter were further explored using an oligonucleotide decoy assay as described in numerous other studies, including the transcriptional regulation of amyloid-beta precursor protein by TGF-beta1 (10, 14, 24). In this approach, transcription factors interact with wild-type decoy oligonucleotides instead of the natural regulatory motifs (reviewed in Ref. 14). A 33-bp wild-type decoy oligonucleotide containing the SBE and the proximal Sp1 consensus sequences located in the human HO-1 promoter prevented TGF-beta1-mediated activity of the HO-1 promoter-reporter vector, implicating the importance of both the SBE and Sp1-binding sites. When the SBE site or the Sp1 site in the decoy oligonucleotide was mutated, the decoy no longer functioned and TGF-beta1-mediated HO-1 promoter/reporter activity was restored. Thus both the Smads and Sp1 are required for TGF-beta1-inducible HO-1 promoter-reporter activity. HO-1 upregulation by TGF-beta1 may therefore follow a model similar to that described by Feng et al. (13) regarding TGF-beta1-mediated upregulation of p15Ink4B, where upon TGF-beta1 treatment, the Smad complex undergoes nuclear translocation and interacts directly with an SBE adjacent to DNA-bound Sp1 to increase transcription. Conversely, TGF-beta1-mediated induction of HO-1 may resemble a more complex model similar to that described for TGF-beta-mediated erythropoietin upregulation. Sanchez-Elsner et al. (46) reported that TGF-beta stimulation causes a region of the upstream erythropoietin promoter and a 3' downstream enhancer to become in physical contact through Sp1 and Smad3, which occurs through bending of the intervening sequences. Sp1 reinforces the promoter/enhancer contact, while Smad3 stabilizes the complex by interacting with hypoxia-inducible factor-1/Sp1/HNF-4 and the coactivator CBP/p300 (46).

In summary, a region between 9.1 and 9.4 kb of the human HO-1 promoter, Smads, and Sp1 are required to activate transcription of HO-1 in response to TGF-beta1 in renal proximal tubular cells. This is a molecular mechanism that differs from that of other known inducers of human HO-1. We speculate that TGF-beta1 release after tissue injury promotes healing and restoration of organ function through a balanced activation of signaling systems which counteract excessive fibrosis development such as HO-1 with its protective and antifibrogenic properties.


    GRANTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institutes of Health Grants K01-DK-02902, R01-DK-071875, and American Heart Association Grant-in-Aid to N. Hill-Kapturczak.


    ACKNOWLEDGMENTS
 
We are very grateful to T. Imamura and K. Miyazono for the Smad plasmids and K.-S. Chang for the Sp1 expression vector. We also acknowledge the generous gift of AdSmad4 and MDA-MB-468 cells from W. Samuel and we also thank L. Zhang for technical help in preparing AdSmad4. We gratefully acknowledge A. Agarwal for helpful discussions and critical review of this manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: N. Hill-Kapturczak, Division of Nephrology, Univ. of Alabama at Birmingham, Zeigler Research Bldg. 620, 1530 3rd Ave. South, Birmingham, AL 35294 (e-mail: hillkn{at}uab.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Abraham NG, Kappas A. Heme oxygenase and the cardiovascular-renal system. Free Radic Biol Med 39: 1–25, 2005.[Web of Science][Medline]
  2. Agarwal A, Balla J, Balla G, Croatt AJ, Vercellotti GM, Nath KA. Renal tubular epithelial cells mimic endothelial cells upon exposure to oxidized LDL. Am J Physiol Renal Fluid Electrolyte Physiol 271: F814–F823, 1996.[Abstract/Free Full Text]
  3. Agarwal A, Shiraishi F, Visner GA, Nick HS. Linoleyl hydroperoxide transcriptionally upregulates heme oxygenase-1 gene expression in human renal epithelial and aortic endothelial cells. J Am Soc Nephrol 9: 1990–1997, 1998.[Abstract]
  4. Balla G, Jacob H, Balla J, Rosenberg M, Nath K, Apple F, Eaton J, Vercellotti G. Ferritin: a cytoprotective antioxidant strategem of endothelium. J Biol Chem 267: 18148–18153, 1992.[Abstract/Free Full Text]
  5. Bottinger EP, Bitzer M. TGF-beta signaling in renal disease. J Am Soc Nephrol 13: 2600–2610, 2002.[Abstract/Free Full Text]
  6. Bouton C, Demple B. Nitric oxide-inducible expression of heme oxygenase-1 in human cells. Translation-independent stabilization of the mRNA and evidence for direct action of nitric oxide. J Biol Chem 275: 32688–32693, 2000.[Abstract/Free Full Text]
  7. Datta PK, Blake MC, Moses HL. Regulation of plasminogen activator inhibitor-1 expression by transforming growth factor-beta-induced physical and functional interactions between Smads and Sp1. J Biol Chem 275: 40014–40019, 2000.[Abstract/Free Full Text]
  8. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 425: 577–584, 2003.[CrossRef][Medline]
  9. Diamond JR, Kees-Folts D, Ding G, Frye JE, Restrepo NC. Macrophages, monocyte chemoattractant peptide-1, and TGF-beta1 in experimental hydronephrosis. Am J Physiol Renal Fluid Electrolyte Physiol 266: F926–F933, 1994.[Abstract/Free Full Text]
  10. Docagne F, Gabriel C, Lebeurrier N, Lesne S, Hommet Y, Plawinski L, Mackenzie ET, Vivien D. Sp1 and Smad transcription factors co-operate to mediate TGF-beta-dependent activation of amyloid-beta precursor protein gene transcription. Biochem J 383: 393–399, 2004.[CrossRef][Web of Science][Medline]
  11. Dore S, Takahashi M, Ferris CD, Hester LD, Guastella D, Snyder SH. Bilirubin, formed by activation of heme oxygenase-2, protects neurons against oxidative stress injury. Proc Natl Acad Sci USA 96: 2445–2450, 1999.[Abstract/Free Full Text]
  12. Feng XH, Derynck R. Specificity and versatility in TGF-signaling through Smads. Annu Rev Cell Dev Biol 21: 659–693, 2005.[CrossRef][Web of Science][Medline]
  13. Feng XH, Lin X, Derynck R. Smad2, Smad3 and Smad4 cooperate with Sp1 to induce p15(Ink4B) transcription in response to TGF-beta. EMBO J 19: 5178–5193, 2000.[CrossRef][Web of Science][Medline]
  14. Fichou Y, Ferec C. The potential of oligonucleotides for therapeutic applications. Trends Biotechnol 24: 563–570, 2006.[CrossRef][Web of Science][Medline]
  15. Frederick JP, Liberati NT, Waddell DS, Shi Y, Wang XF. Transforming growth factor beta-mediated transcriptional repression of c-myc is dependent on direct binding of Smad3 to a novel repressive Smad binding element. Mol Cell Biol 24: 2546–2559, 2004.[Abstract/Free Full Text]
  16. Fujita T, Toda K, Karimova A, Yan SF, Naka Y, Yet SF, Pinsky DJ. Paradoxical rescue from ischemic lung injury by inhaled carbon monoxide driven by derepression of fibrinolysis. Nat Med 7: 598–604, 2001.[CrossRef][Web of Science][Medline]
  17. Fukuda K, Yoshitomi K, Yanagida T, Tokumoto M, Hirakata H. Quantification of TGF-beta 1 mRNA along rat nephron in obstructive nephropathy. Am J Physiol Renal Physiol 281: F513–F521, 2001.[Abstract/Free Full Text]
  18. Gong L-M, Du J-B, Shi L, Shi Y, Tang C-S. Effects of endogenous carbon monoxide on collagen synthesis in pulmonary artery in rats under hypoxia. Life Sci 74: 1225–1241, 2004.[CrossRef][Web of Science][Medline]
  19. Hill-Kapturczak N, Sikorski E, Voakes C, Garcia J, Nick HS, Agarwal A. An internal enhancer regulates heme- and cadmium-mediated induction of human heme oxygenase-1. Am J Physiol Renal Physiol 285: F515–F523, 2003.[Abstract/Free Full Text]
  20. Hill-Kapturczak N, Truong L, Thamilselvan V, Visner GA, Nick HS, Agarwal A. Smad7-dependent regulation of heme oxygenase-1 by transforming growth factor-beta in human renal epithelial cells. J Biol Chem 275: 40904–40909, 2000.[Abstract/Free Full Text]
  21. Hill-Kapturczak N, Voakes C, Garcia J, Visner G, Nick HS, Agarwal A. A cis-acting region regulates oxidized lipid-mediated induction of the human heme oxygenase-1 gene in endothelial cells. Arterioscler Thromb Vasc Biol 23: 1416–1422, 2003.[Abstract/Free Full Text]
  22. Imamura T, Takase M, Nishihara A, Oeda E, Hanai J-I, Kawabata M, Miyazono K. Smad6 inhibits signalling by the TGF-beta superfamily. Nature 389: 622–626, 1997.[CrossRef][Medline]
  23. Ishida W, Hamamoto T, Kusanagi K, Yagi K, Kawabata M, Takehara K, Sampath TK, Kato M, Miyazono K. Smad6 is a Smad1/5-induced smad inhibitor. Characterization of bone morphogenetic protein-responsive element in the mouse Smad6 promoter. J Biol Chem 275: 6075–6079, 2000.[Abstract/Free Full Text]
  24. Kim SS, Pandey KK, Choi HS, Kim SY, Law PY, Wei LN, Loh HH. Poly(C) binding protein family is a transcription factor in µ-opioid receptor gene expression. Mol Pharmacol 68: 729–736, 2005.[Abstract/Free Full Text]
  25. Kopp JB, Factor VM, Mozes M, Nagy P, Sanderson N, Bottinger EP, Klotman PE, Thorgeirsson SS. Transgenic mice with increased plasma levels of TGF-beta 1 develop progressive renal disease. Lab Invest 74: 991–1003, 1996.[Web of Science][Medline]
  26. Kretschmer A, Moepert K, Dames S, Sternberger M, Kaufmann J, Klippel A. Differential regulation of TGF-beta signaling through Smad2, Smad3 and Smad4. Oncogene 22: 6748–6763, 2003.[CrossRef][Web of Science][Medline]
  27. Kutty RK, Nagineni CN, Kutty G, Hooks JJ, Chader GJ, Wiggert B. Increased expression of heme oxygenase-1 in human retinal pigment epithelial cells by transforming growth factor-beta. J Cell Physiol 159: 371–378, 1994.[CrossRef][Web of Science][Medline]
  28. Lai CF, Feng X, Nishimura R, Teitelbaum SL, Avioli LV, Ross FP, Cheng SL. Transforming growth factor-beta upregulates the beta 5 integrin subunit expression via Sp1 and Smad signaling. J Biol Chem 275: 36400–36406, 2000.[Abstract/Free Full Text]
  29. Li L, Grenard P, Nhieu JT, Julien B, Mallat A, Habib A, Lotersztajn S. Heme oxygenase-1 is an antifibrogenic protein in human hepatic myofibroblasts. Gastroenterology 125: 460–469, 2003.[CrossRef][Web of Science][Medline]
  30. Liby K, Hock T, Yore MM, Suh N, Place AE, Risingsong R, Williams CR, Royce DB, Honda T, Honda Y, Gribble GW, Hill-Kapturczak N, Agarwal A, Sporn MB. The synthetic triterpenoids, CDDO and CDDO-imidazolide, are potent inducers of heme oxygenase-1 and Nrf2/ARE signaling. Cancer Res 65: 4789–4798, 2005.[Abstract/Free Full Text]
  31. Maines MD. The heme oxygenase system: a regulator of second messenger gases. Annu Rev Pharmacol Toxicol 37: 517–554, 1997.[CrossRef][Web of Science][Medline]
  32. Mark A, Hock T, Kapturczak MH, Agarwal A, Hill-Kapturczak N. Induction of heme oxygenase-1 modulates the profibrotic effects of transforming growth factor-beta in human renal tubular epithelial cells. Cell Mol Biol (Noisy-le-grand) 51: 357–362, 2005.[Medline]
  33. Massague J, Gomis RR. The logic of TGFbeta signaling. FEBS Lett 580: 2811–2820, 2006.[CrossRef][Web of Science][Medline]
  34. Massague J, Wotton D. Transcriptional control by the TGF-beta/Smad signaling system. EMBO J 19: 1745–1754, 2000.[CrossRef][Web of Science][Medline]
  35. Morse D. The role of heme oxygenase-1 in pulmonary fibrosis. Am J Respir Cell Mol Biol 29: S82–S86, 2003.[Web of Science][Medline]
  36. Nath KA. Heme oxygenase-1: a provenance for cytoprotective pathways in the kidney and other tissues. Kidney Int 70: 432–443, 2006.[Web of Science][Medline]
  37. Ning W, Song R, Li C, Park E, Mohsenin A, Choi AMK, Choi ME. TGF-beta1 stimulates HO-1 via the p38 mitogen-activated protein kinase in A549 pulmonary epithelial cells. Am J Physiol Lung Cell Mol Physiol 283: L1094–L1102, 2002.[Abstract/Free Full Text]
  38. Otterbein LE, Bach FH, Alam J, Soares M, Tao Lu H, Wysk M, Davis RJ, Flavell RA, Choi AM. Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway. Nat Med 6: 422–428, 2000.[CrossRef][Web of Science][Medline]
  39. Pardali K, Kurisaki A, Moren A, ten Dijke P, Kardassis D, Moustakas A. Role of Smad proteins and transcription factor Sp1 in p21Waf1/Cip1 regulation by transforming growth factor-beta. J Biol Chem 275: 29244–29256, 2000.[Abstract/Free Full Text]
  40. Phanish MK, Wahab NA, Colville-Nash P, Hendry BM, Dockrell ME. The differential role of Smad2 and Smad3 in the regulation of profibrotic TGFbeta1 responses in human proximal-tubule epithelial cells. Biochem J 393: 601–607, 2006.[CrossRef][Web of Science][Medline]
  41. Piek E, Ju WJ, Heyer J, Escalante-Alcalde D, Stewart CL, Weinstein M, Deng C, Kucherlapati R, Bottinger EP, Roberts AB. Functional characterization of transforming growth factor beta signaling in Smad2- and Smad3-deficient fibroblasts. J Biol Chem 276: 19945–19953, 2001.[Abstract/Free Full Text]
  42. Poncelet AC, Schnaper HW. Sp1 and Smad proteins cooperate to mediate transforming growth factor-beta 1-induced alpha 2(I) collagen expression in human glomerular mesangial cells. J Biol Chem 276: 6983–6992, 2001.[Abstract/Free Full Text]
  43. Ray R, Snyder RC, Thomas S, Koller CA, Miller DM. Mithramycin blocks protein binding and function of the SV40 early promoter. J Clin Invest 83: 2003–2007, 1989.[Web of Science][Medline]
  44. Rojo AI, Salina M, Salazar M, Takahashi S, Suske G, Calvo V, de Sagarra MR, Cuadrado A. Regulation of heme oxygenase-1 gene expression through the phosphatidylinositol 3-kinase/PKC-zeta pathway and Sp1. Free Radic Biol Med 41: 247–261, 2006.[CrossRef][Web of Science][Medline]
  45. Ryan MJ, Johnson G, Kirk J, Fuerstenberg SM, Zager RA, Torok-Storb B. HK-2: an immortalized proximal tubule epithelial cell line from normal adult human kidney. Kidney Int 45: 48–57, 1994.[Web of Science][Medline]
  46. Sanchez-Elsner T, Ramirez JR, Sanz-Rodriguez F, Varela E, Bernabeu C, Botella LM. A cross-talk between hypoxia and TGF-beta orchestrates erythropoietin gene regulation through SP1 and Smads. J Mol Biol 336: 9–24, 2004.[CrossRef][Web of Science][Medline]
  47. Schnaper HW, Hayashida T, Hubchak SC, Poncelet AC. TGF-beta signal transduction and mesangial cell fibrogenesis. Am J Physiol Renal Physiol 284: F243–F252, 2003.[Abstract/Free Full Text]
  48. Shi Y, Wang YF, Jayaraman L, Yang H, Massague J, Pavletich NP. Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA binding in TGF-beta signaling. Cell 94: 585–594, 1998.[CrossRef][Web of Science][Medline]
  49. Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN. Bilirubin is an antioxidant of possible physiological importance. Science 235: 1043–1046, 1987.[Abstract/Free Full Text]
  50. Takahashi S, Matsuura N, Kurokawa T, Takahashi Y, Miura T. Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line. Biochem J 367: 641–652, 2002.[CrossRef][Web of Science][Medline]
  51. Tsui TY, Wu X, Lau CK, Ho DWY, Xu T, Siu YT, Fan ST. Prevention of chronic deterioration of heart allograft by recombinant adeno-associated virus-mediated heme oxygenase-1 gene transfer. Circulation 107: 2623–2629, 2003.[Abstract/Free Full Text]
  52. Vallian S, Chin KV, Chang KS. The promyelocytic leukemia protein interacts with Sp1 and inhibits its transactivation of the epidermal growth factor receptor promoter. Mol Cell Biol 18: 7147–7156, 1998.[Abstract/Free Full Text]
  53. Wang HD, Yamaya M, Okinaga S, Jia YX, Kamanaka M, Takahashi H, Guo LY, Ohrui T, Sasaki H. Bilirubin ameliorates bleomycin-induced pulmonary fibrosis in rats. Am J Respir Crit Care Med 165: 406–411, 2002.[Abstract/Free Full Text]
  54. Wang W, Koka V, Lan HY. Transforming growth factor and Smad signalling in kidney diseases. Review Article Nephrology 10: 48–56, 2005.
  55. Yamamoto T, Noble NA, Cohen AH, Nast CC, Hishida A, Gold LI, Border WA. Expression of transforming growth factor-beta isoforms in human glomerular diseases. Kidney Int 49: 461–469, 1996.[Web of Science][Medline]
  56. Yamamoto T, Noble NA, Miller DE, Gold LI, Hishida A, Nagase M, Cohen AH, Border WA. Increased levels of transforming growth factor in HIV-associated nephropathy. Kidney Int 55: 579–592, 1999.[CrossRef][Web of Science][Medline]
  57. Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B, Kern SE. Human Smad3 and Smad4 are sequence-specific transcription activators. Mol Cell 1: 611–617, 1998.[CrossRef][Web of Science][Medline]
  58. Zhang X, Yang J, Li Y, Liu Y. Both Sp1 and Smad participate in mediating TGF-beta1-induced HGF receptor expression in renal epithelial cells. Am J Physiol Renal Physiol 288: F16–F26, 2005.[Abstract/Free Full Text]
  59. Zhou Z, Song R, Fattman CL, Greenhill S, Alber S, Oury TD, Choi AMK, Morse D. Carbon monoxide suppresses bleomycin-induced lung fibrosis. Am J Pathol 166: 27–37, 2005.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
J.-H. Kie, M. H. Kapturczak, A. Traylor, A. Agarwal, and N. Hill-Kapturczak
Heme Oxygenase-1 Deficiency Promotes Epithelial-Mesenchymal Transition and Renal Fibrosis
J. Am. Soc. Nephrol., September 1, 2008; 19(9): 1681 - 1691.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/3/F885    most recent
00519.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Traylor, A.
Right arrow Articles by Hill-Kapturczak, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Traylor, A.
Right arrow Articles by Hill-Kapturczak, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.