AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 293: F1501-F1511, 2007. First published September 12, 2007; doi:10.1152/ajprenal.00243.2007
0363-6127/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
293/5/F1501    most recent
00243.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grenz, A.
Right arrow Articles by Osswald, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grenz, A.
Right arrow Articles by Osswald, H.

Lack of effect of extracellular adenosine generation and signaling on renal erythropoietin secretion during hypoxia

Almut Grenz,1 Hua Zhang,1,2 Jochen Weingart,1 Simone von Wietersheim,1 Tobias Eckle,3 Juergen Schnermann,4 Christoph Köhle,1 Doris Kloor,1 Christoph H. Gleiter,1 Volker Vallon,5 Holger K. Eltzschig,3,6 and Hartmut Osswald1

1Department of Pharmacology and Toxicology, Tübingen University Hospital, Tübingen; 2University of Applied Sciences, Albstadt-Sigmaringen; 3Department of Anesthesiology and Intensive Care Medicine, Tübingen University Hospital, Tübingen, Germany; 4National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland; 5Departments of Medicine and Pharmacology, University of California, San Diego, and Veterans Affairs San Diego Healthcare System, San Diego, California; and 6Department of Anesthesiology and Perioperative Medicine, University of Colorado Health Sciences Center, Denver, Colorado

Submitted 24 May 2007 ; accepted in final form 5 September 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Previous studies have yielded conflicting results as to whether extracellular adenosine generation and signaling contributes to hypoxia-induced increases in renal erythropoietin (EPO) secretion. In this study, we combined pharmacological and genetic approaches to elucidate a potential contribution of extracellular adenosine to renal EPO release in mice. To stimulate EPO secretion, we used murine carbon monoxide exposure (400 and 750 parts per million CO, 4 h), ambient hypoxia (8% oxygen, 4 h), or arterial hemodilution. Because the ecto-5-nucleotidase (CD73, conversion of AMP to adenosine) is considered the pacemaker of extracellular adenosine generation, we first tested the effect of blocking extracellular adenosine generation with the specific CD73-inhibitor adenosine 5'-({alpha},beta-methylene) diphosphate (APCP) or by gene-targeted deletion of cd73. These studies showed that neither APCP-treatment nor targeted deletion of cd73 resulted in changes of stimulated EPO mRNA or serum levels, although the increases of adenosine levels in the kidney following CO exposure were attenuated in mice with APCP treatment or in cd73–/– mice. Moreover, pharmacological studies using specific inhibitors of individual adenosine receptors (A1AR, DPCPX; A2AAR, DMPX; A2BAR, PSB 1115; A3AR, MRS 1191) showed no effect on stimulated increases of EPO mRNA or serum levels. Finally, stimulated EPO secretion was not attenuated in gene-targeted mice lacking A1AR–/–, A2AAR–/–, A2BAR–/–, or A3AR–/–. Together, these studies combine genetic and pharmacological in vivo evidence that increases of EPO secretion during limited oxygen availability are not affected by extracellular adenosine generation or signaling.

adenosine receptors; ecto-5'-nucleotidase; CD73; carbon monoxide


THE GLYCOPROTEIN HORMONE ERYTHROPOIETIN (EPO) is an essential growth factor for the regulation and differentiation of erythrocytic progenitor cells in bone marrow, thus regulating the supply of red blood cells (19). EPO is predominantly synthesized in the kidneys and to a smaller extent also in the liver (~5% of total EPO production) (18, 19). EPO concentrations are decreased in patients with malignant, infectious, autoimmune, or renal diseases (26). Since the 1980s, recombinant human erythropoietin has been available and can be used clinically in the treatment of anemia from different etiologies (1). The most important transcription factor for hypoxic stimulation of EPO production is the hypoxia-inducible factor 1 (HIF-1) (43). During hypoxia, HIF-1 is stabilized and finally results in the transcriptional induction of its target genes, such as EPO, by binding to an hypoxia-response element within the EPO promoter, resulting in prompt and robust induction of EPO (46).

Several studies have implicated extracellular adenosine in the modulation of EPO secretion (3, 8, 30, 33, 51). Extracellular adenosine is derived mainly from phosphohydrolysis of adenosine 5'-monophosphate (AMP). Ecto-5'-nucleotidase (CD73), an ubiquitously expressed glycosyl phosphatidylinositol-anchored ectoenzyme, is the pacemaker of this reaction (49). Because of its transcriptional induction by hypoxia (18), CD73-dependent adenosine generation is particularly prominent during conditions of limited oxygen availability (48, 49). Furthermore, recent studies have shown that the EPO-producing peritubular renal fibroblasts express high amounts of ecto-5'-nucleotidase on their surface (2).

Extracellular adenosine produced by CD73 can signal through any of four extracellular adenosine receptors (A1AR, A2AAR, A2BAR, or A3AR). All four ARs have been associated with tissue protection in a variety of physiological settings (45). In the kidney, CD73-dependent adenosine production plays a central role in the regulation of tubuloglomerular feedback (5, 50) and during ischemic preconditioning (15).

Experimental studies and human trials on the effect of adenosine analogs and AR antagonists on EPO secretion have shown conflicting results (8, 12, 13, 29, 3133, 41, 51). Nakashima et al. (28) showed an increase of EPO production in hepatocellular carcinoma (Hep3B) cells following adenosine administration. The hypoxia-induced increase in EPO levels in cell cultures was inhibited by administration of a selective A2AAR antagonist, whereas A2AAR and A2BAR agonists increased EPO mRNA levels (8). Furthermore, selective A2BAR inhibition produced a significant inhibition of EPO secretion in mice exposed to hypoxia, suggesting that EPO secretion is stimulated by activation of adenylate cyclase by A2AAR and A2BAR (8). However, another group (12) could not reproduce the above findings using different adenosine synergistic and antagonistic compounds in models of hypoxia-stimulated EPO production in rats. A very elegant study by Ozuyaman et al. (37) has shown that cd73–/– mice do not respond to hypoxic stimuli with different EPO plasma levels compared with wild-type mice. However, and in contrast to other studies showing elevated adenosine levels with hypoxia or ischemia (15, 16, 21, 49), renal adenosine levels were not increased in this study (37). Moreover, in patients with erythrocytosis and high EPO serum concentrations following kidney transplantation, EPO levels were attenuated by treatment with theophylline, a nonselective AR antagonist (3). Again, other studies could not confirm these findings (10, 17).

Based on these conflicting findings, we used a combination of pharmacological and genetic approaches to define in more detail the contribution of extracellular adenosine generation and to clarify the role of the different adenosine receptor subtypes in the hypoxia-induced EPO secretion. In these studies, no influence of extracellular adenosine generation and AR signaling on stimulation of EPO secretion was found.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mice. All mice, weighing 22–32g, were kept on a regular 12:12-h dark-light cycle with free access to standard mice chow (Altromin 1320; Lage, Germany) and water. Experimental protocols were approved in accordance with the German Law on the Protection of Animals. C57BL/6J mice were obtained from Charles River (Sulzfeld, Germany). Mice deficient in cd73, A1AR, A2BAR, or A3AR on the C57BL/6 strain or in A2AAR on the CD1 strain were generated, validated, and characterized as described previously (7, 24, 40, 47, 49). PCR genotyping and real-time RT-PCR for determination of expression patterns of CD73 and ARs confirmed successful knockdown of renal cd73, A1AR, A2AAR, A2BAR or A3AR transcript levels in the respective mice. In short, measurement of cd73 or AR mRNA expression confirmed intermediate levels of CD73 or ARs in heterozygotes and their absence in homozygous mutant mice (Supplemental Fig. 1). (Supplemental data for this article are available at the American Journal of Physiology-Renal Physiology website.)


Figure 1
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 1. Erythropoietin (EPO) secretion during carbon monoxide (CO) exposure, ambient hypoxia, or arterial hemodilution. A: in vivo kinetics of carboxyhemoglobin (HbCO) expressed as a percentage of total Hb in response to increasing CO concentrations in inspired air for 4 h in C57BL/6 conscious mice. B: EPO/CO dose response curve. Serum EPO in C57BL/6 mice after 4 h of exposure to increasing CO concentrations [0–1,400 parts per million (ppm)] in inspired air. *P < 0.05 vs. mice under normoxic conditions (0 ppm CO). C: time-dependent increase in EPO concentrations after exposure to 400 ppm CO for 3, 4, and 5 h. *P < 0.05 vs. 3 h. D: time-dependent increase in EPO concentrations after exposure to 750 ppm CO for 3, 4, and 5 h. *P < 0.05 vs. 3 h. E: EPO serum concentrations in mice following exposure to 8% O2. *P < 0.05 vs. 21% O2. F: erythropoiesis was induced in mice by arterial hemodilution (initial bleeding of 1.25% of body weight followed by a second bleeding of 1% of body weight after 3 h by retroorbital puncture). Eight and 24 h after the initial bleeding, additional blood samples were taken (75 µl). The volume was substituted by intraperitoneal application of isotonic Ringer solution. Hematocrit before blood withdrawal (0 h) and 3, 8, and 24 h after initial hemodilution in C57BL/6 mice. *P < 0.05 vs. 0 h. G: EPO serum concentrations before blood withdrawal (time 0) and 3, 8 and 24 h after hemodilution in C57BL/6 mice. *P < 0.05 vs. 0 h. Data are derived from 5–8 mice per condition. Results are means ± SE.

 
Murine carbon monoxide or 8% O2 exposure. For carbon monoxide (CO) exposure [200 to 1,400 parts per million (ppm) CO], conscious male and female mice (paired in all groups, n = 5–7 per group) were placed into a ventilated cage as previously described (9). In the normobaric hypoxic group, mice were exposed to 8% O2. After 4 h of exposure to CO or 8% O2, the animals were killed, and whole blood was collected into serum tubes for determination of hematocrit and EPO serum concentrations. Kidneys were quickly removed, frozen in liquid nitrogen, and stored at –80°C until further analysis.

EPO stimulation by arterial hemodilution. Erythropoiesis was induced in mice by hemodilution (initial bleeding of 1.25% of body weight followed by a second bleeding of 1% of body weight after 3 h by retroorbital puncture). The volume was substituted by intraperitoneal application of isotonic Ringer solution. Eight and twenty-four hours after the initial bleeding, blood samples (75 µl) were obtained to measure the hematocrit and EPO serum concentration.

Pharmacological studies. In subsets of experiments, CD73 or A1AR, A2AAR, A2BAR, or A3AR were blocked. The doses of all substances that we have tested were based on earlier reports in which clear antagonistic effects were demonstrated on different organ function in experimental animals. We used 8-phenyltheophylline (8-PT) as a nonspecific AR antagonist (10 mg/kg ip) (14) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX; 1 mg/kg ip) (20, 44), 3,7-dimethyl-1-propargylxanthine (DMPX; 1 mg/kg ip) (42), PSB 1115 (10 mg/kg ip) (7), and MRS 1119 (1 mg/kg ip) (25) as specific AR subtype inhibitors. CD73 was inhibited using adenosine 5'-({alpha},beta-methylene) diphosphate (APCP; 2 mg ip) (7, 15). All drugs were given 30 min before the experimental procedure. All reagents were purchased from Sigma-Aldrich.

Assays. Serum EPO concentrations were determined via quantitative enzyme-linked immunosorbent assay (EPO ELISA; Medac, Wedel, Germany). Hematocrit was measured by routine Coulter counter technique.

Transcriptional analysis. To assess the CD73, A1AR, A2AAR, A2BAR, and A3AR transcript levels in the different mouse strains, kidneys were excised under control conditions in wild-type, heterozygote, and gene-targeted mice, and transcript levels were determined. Total RNA was isolated from kidney tissue using the total RNA isolation NucleoSpin RNA II kit according to the manufacturer's instructions (Macherey & Nagel, Düren, Germany). For this purpose, tissue frozen in liquid nitrogen was homogenized in the presence of RA1 lysis buffer (Micra D8 homogenizer; ART-Labortechnik, Müllheim, Germany), and after filtration, lysates were loaded on NucleoSpin RNA II columns, followed by desalting and DNaseI digestion (Macherey & Nagel). RNA was washed, and the concentration was quantified. The PCR reactions contained 1 µM sense and 1 µM antisense oligonucleotides with SYBR green I (Molecular Probes). Primer sets (sense sequence, antisense sequence, and transcript size, respectively) for the following genes were cd73 (5'-CAA ATC CCA CAC AAC CAC TG-3', 5'-TGC TCA CTT GGT CAC AGG AC-3', 123 bp); A1AR (5'-AGG GAG GGG TCA AGA ACT GT-3', 5'-TCC CAG TCT CTG CCT CTG TT-3', 109 bp); A2AAR (5'-GAA GAC CAT GAG GCT GTT CC-3', 5'-GAG TAT GGG CCA ATG GGA GT-3', 253 bp); A2BAR (5'-GGA AGG ACT TCG TCT CTC CA-3', 5'-GGG CAG CAA CTC AGA AAA CT-3', 322 bp); and A3AR (5'-CAA TTC GCT CCT TCT GTT CC-3', 5'-TCC CTG ATT ACC ACG GAC TC-3', 334 bp). Each target sequence was amplified using increasing numbers of cycles of 94°C for 1 min, 58°C for 0.5 min, and 72°C for 1 min. Murine beta-actin mRNA (sense primer: 5'-ACA TTG GCA TGG CTT TGT TT-3'; antisense primer, 5'-GTT TGC TCC AAC CAA CTG CT-3') was amplified in identical reactions to control for the amount of starting template.

For measurement of renal EPO transcript, total RNA from mice kidney was isolated using PeqGold RNApure (PeqLab, Erlangen, Germany). Synthesis of cDNA was performed using oligo(dT15) and random hexamers as primers and avian myeloblastosis virus reverse transcriptase (PeqLab, Erlangen, Germany). PCR was carried out on the LightCycler instrument with the FastStart DNA Master SYBR green I kit (Roche, Mannheim, Germany). Primer sequences used for amplification were as follows: EPO (RefSeq accession no. NM_007942): sense, 5'-237AATGGAGGTGGAAGAACAGG256-3'; antisense, 5'-410ACCCGAAGCAGTGAAGTGA392-3'; and beta-actin (RefSeq accession no. NM_007393): sense, 5'-334TCTGGCACCACACCTTCTACA354-3'; antisense, 5'-469GGGGTGTTGAAGGTCTCAAAC449-3'. beta-Actin served as internal control. Standard samples were included for comparison between different PCR runs. The relative expression ratio of the target gene EPO was calculated according to Pfaffl et al. (38).

Adenosine measurements. Kidneys, following exposure to 4 h of CO or O2 or following hemodilution, were removed and immediately snap-frozen with clamps precooled to the temperature of liquid nitrogen within a time lag of 1–3 s. The frozen kidneys were pulverized under liquid nitrogen, and the tissue protein was precipitated with 0.6 N ice-cold perchloric acid. Tissue adenosine levels were determined as described previously (21).

Statistical methods. Data were compared using two-factor ANOVA or Student's t-test where appropriate. All values are means ± SE. P values <0.05 were considered to be statistically significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
EPO secretion is induced by CO exposure, ambient hypoxia, or arterial hemodilution. To study the effect of extracellular adenosine production and signaling on hypoxia-associated EPO secretion, we first tested different murine models of EPO stimulation by limited O2 availability. As a first experimental strategy, we exposed mice to CO (200 to 1,400 ppm). As shown in Fig. 1, A and B, increasing concentrations of CO, applied over 4 h, were associated with elevated hemoglobin-CO (HbCO) levels (to 48% with 1,400 ppm) and increasing EPO serum levels, with the latter peaking at ~1,000 ppm CO. Furthermore, we performed CO exposure over 3, 4, or 5 h at 400 or 750 ppm CO (Fig. 1, C and D). Based on these initial experiments, all subsequent experiments were performed using 400 or 750 ppm CO for 4 h, resulting in HbCO concentrations of 25 or 35%, respectively. The second experimental strategy exposed the mice to ambient hypoxia. Exposure to 8% (instead of 21%) O2 over 4 h was associated with an 11-fold increase in EPO serum concentrations (Fig. 1E) P < 0.05. For the third model of stimulating EPO secretion, we used arterial hemodilution. In fact, the applied maneuver reduced the hematocrit by 23, 32, and 41% after 3, 8, and 24 h, which was accompanied by EPO increases to 60 ± 9, 176 ± 34, and 396 ± 63 mU/ml, respectively (Fig. 1, F and G) P < 0.05. Together, these studies indicate the feasibility of investigating EPO secretion in the above models of limited O2 availability (CO exposure, ambient hypoxia, or arterial hemodilution).

Pharmacological inhibition or genetic deletion of CD73 does not alter hypoxia-induced EPO secretion. After having shown dramatic increases in EPO stimulation with CO exposure, ambient hypoxia, or arterial hemodilution, we next pursued the consequences of blocking extracellular adenosine generation by pharmacological inhibition of CD73. Mice received APCP (2 mg ip), a dose previously shown by our group (15) to inhibit adenosine generation under hypoxic conditions, 30 min before the experimental procedure and were then exposed for 4 h to 400 or 750 ppm CO or to ambient hypoxia (8% O2). Vehicle-treated controls showed significant increases of renal EPO mRNA (Fig. 2, A and B) or EPO serum levels (Fig. 2, C and D), but these responses were not affected by APCP treatment (Fig. 2, A–D). Similarly, EPO stimulation by hemodilution was not affected by APCP treatment (Fig. 2E). These studies provide pharmacological evidence that inhibition of extracellular adenosine generation by APCP does not affect hypoxia-induced EPO secretion.


Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 2. Stimulated renal EPO secretion following pharmacological inhibition of extracellular adenosine production. A: renal EPO mRNA under control conditions or after 4 h of exposure to 400 or 750 ppm CO in mice with or without prior application of adenosine 5'-({alpha},beta-methylene) diphosphate (APCP; 2 mg ip). B: renal EPO mRNA under control conditions or after 4 h of exposure to 8% O2 in mice with or without APCP application. C: EPO serum concentrations under control conditions or after 4 h of exposure to 400 or 750 ppm CO in mice with or without APCP administration. D: EPO serum concentrations under control conditions or after 4 h of exposure to 8% ambient hypoxia. E: EPO serum concentrations before (0 h) or after 3, 8, or 24 h of arterial hemodilution with or without previous APCP treatment. Data are derived from 5–8 mice per condition. Results are means ± SE. *P < 0.05 vs. normoxic controls.

 
After having shown in pharmacological studies that EPO secretion is not affected by inhibition of CD73, we next pursued the same lines of studies in a genetic model. For this purpose, we used previously characterized cd73–/– mice (49). Exposure of cd73–/– mice to 400 or 750 ppm CO or to 8% O2 resulted in a stimulation of EPO mRNA (Fig. 3, A and B) or EPO serum concentrations (Fig. 3, C and D) that was not different from that of littermate wild-type controls. Similarly, arterial hemodilution did not alter EPO serum secretion differently in cd73–/– mice compared with their littermate controls (Fig. 3E). Together, these studies provide strong pharmacological and genetic evidence that renal EPO stimulation by hypoxia does not depend on CD73-dependent adenosine generation.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 3. Stimulated renal EPO secretion in gene-targeted mice for CD73. A: renal EPO mRNA under control conditions and after 4 h of exposure to 400 or 750 ppm CO in cd73–/– mice and their littermate controls (WT). B: renal EPO mRNA under normoxic conditions or after 4 h of exposure to 8% O2 in cd73–/– and WT mice. C: EPO serum concentrations under normoxic conditions or after 4 h of exposure to 400 or 750 ppm CO in cd73–/– and WT mice. D: EPO serum concentrations under normoxic conditions or after 4 h of exposure to 8% O2 in cd73–/– and WT mice. E: EPO serum concentrations before (0 h) or after 3, 8, or 24 h of arterial hemodilution in cd73–/– and WT mice. Data are derived from 5–8 mice per condition. Results are means ± SE. *P < 0.05 vs. normoxic controls.

 
Adenosine renal tissue content is reduced in CD73–/– mice following hypoxic stimuli. To assess to which extent CD73 may contributes to renal tissue adenosine content, we determined adenosine in kidneys of cd73–/– mice and their littermate controls under normoxic and three hypoxic conditions. Under normoxic conditions, adenosine tissue contents were similar in wild-type mice of all three groups. However, cd73–/– mice exhibited significantly lower adenosine tissue levels under normoxic and hypoxic conditions (750 ppm CO, 8% O2, or hemodilution) compared with wild-type mice (Fig. 4, A–C).


Figure 4
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 4. Renal adenosine content in gene-targeted mice for CD73. A: renal adenosine levels under control conditions or after 4 h of exposure to 750 ppm CO in cd73–/– and WT mice. B: renal adenosine levels under normoxic conditions or after 4 h of exposure to 8% O2 in cd73–/– and WT mice. C: renal adenosine levels before (0 h) or after arterial hemodilution (h) in cd73–/– and WT mice. Ado, adenosine. Data are derived from 4 mice per condition. Results are means ± SE. *P < 0.05 vs. WT littermate controls. §P < 0.05 vs. normoxic cd73–/– mice.

 
Pharmacological inhibition or genetic deletion of adenosine receptors does not alter hypoxia-induced EPO secretion. After having shown that CD73-dependent adenosine production does not affect renal EPO secretion, we next performed studies using AR antagonists. As the first step, we used the nonselective antagonist 8-PT. Intraperitoneal treatment with 8-PT 30 min before the experimental maneuver did not influence hypoxia-induced increases in EPO serum concentrations (Table 1). Similarly, selective blockade of the A1AR (DPCPX), A2AAR and A2BAR (DMPX), A2BAR (PSB 1115), or A3AR (MRS 1119) had no impact on stimulated EPO serum concentrations (Table 1). Since compensatory upregulation or downregulation of the receptor density might occur in the different AR gene-targeted mice, we administered a cocktail containing DPCPX, DMPX, PSB 1115, and MRS 1191 as well in the doses described above before exposure to 600 ppm CO. However, as shown in Table 1, we could not detect any effect of this cocktail of the different AR antagonists on EPO secretion.


View this table:
[in this window]
[in a new window]

 
Table 1. Stimulated EPO secretion in mice following pharmacological blockade of ARs

 
After having demonstrated that pharmacological inhibition of ARs does not affect the EPO secretory response to different hypoxic stimuli, we next investigated the EPO response in previously characterized A1AR–/– (47), A2AAR–/– (24), A2BAR–/– (7), or A3AR–/– mice (40) and their respective littermate controls. As shown in Table 2, A1AR–/–, A2AAR–/–, A2BAR–/–, or A3AR–/– mice and their respective littermates had approximately the same basal EPO mRNA level under normoxia, indicating that AR deletion does not interfere with basal EPO secretion. Exposure to 400 and 750 ppm CO for 4 h induced a similar, dose-dependent increase in EPO mRNA levels in all four groups of gene-targeted mice and their respective littermate controls (Table 2). EPO serum concentrations increased in parallel to EPO mRNA levels after exposure to 400 and 750 ppm CO in A1AR–/–, A2AAR–/–, A2BAR–/–, or A3AR–/– mice and their respective littermate controls (Table 2).


View this table:
[in this window]
[in a new window]

 
Table 2. EPO mRNA and serum levels in mice following CO exposure, ambient hypoxia, or arterial hemodilution

 
After having demonstrated a similar EPO secretory response in gene-targeted mice for individual ARs following CO exposure, we next exposed these mice to normobaric hypoxia. Exposure to 8% O2 over 4 h revealed a similar increase in renal EPO mRNA levels in mice with deletion of A1AR, A2AAR, A2BAR, and A3AR compared with their respective littermate controls (Table 2). Likewise, the increase of EPO serum concentrations was similar in gene-targeted mice and their corresponding littermate controls (Table 2).

Finally, we tested the effect of arterial hemodilution on EPO stimulation and observed that EPO serum levels increased similarly 3, 8, and 24 h after hemodilution in A1AR–/–, A2AAR–/–, A2BAR–/–, or A3AR–/– mice compared with littermate controls (Table 2). Moreover, we did not detect any difference in the EPO secretory response following CO exposure (Fig. 5A), 8% O2 exposure (Fig. 5B) and at 24 h following hemodilution (Fig. 5C) among the different mouse strains. Furthermore, there were no differences in hematocrit and hemoglobin levels among the different mouse populations (data not shown). Together, these studies combine pharmacological and genetic evidence that extracellular adenosine signaling through the four known ARs does not alter basal or stimulated EPO levels.


Figure 5
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 5. EPO serum levels in the different mouse populations following exposure to carbon monoxide (CO), ambient hypoxia, or arterial hemodilution. A: EPO serum concentrations after 4 h of exposure to 750 ppm CO. B: EPO serum concentrations after 4 h of exposure to 8% O2. C: EPO serum concentrations 24 h after hemodilution in CD73 or A1 adenosine receptor (A1AR), A2AAR, A2BAR, or A3AR gene-targeted mice and their respective controls. Data are derived from 5–8 mice per condition. Results are means ± SE.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Contradictory results have been reported in previous pharmacological studies with regard to the role of adenosine in the regulation of EPO secretion by the kidneys. In the present study we used a combination of pharmacological and gene deletion approaches to examine the contribution of extracellular adenosine production and signaling to renal EPO secretion. Transcriptional profiling of renal tissue following exposure to three different hypoxic stimuli (CO, hypoxia, or hemodilution) revealed a prominent induction of EPO mRNA. Pharmacological inhibition or targeted gene deletion of cd73 had no impact on hypoxia-induced increases in EPO mRNA or EPO serum concentrations. Moreover, pharmacological studies using a nonselective AR inhibitor or specific inhibitors of individual ARs or experiments in gene-targeted mice for these receptors (A1AR, A2AAR, A2BAR, or A3AR) showed no differences in hypoxia-induced increases in EPO mRNA or serum levels. Together, these studies provide genetic and pharmacological in vivo evidence that neither the ecto-5'-nucleotidase nor signal transduction through individual ARs is required for the stimulation of EPO by limited O2 availability.

EPO expression is known to be controlled by several transcription factors and thus possesses several regulatory DNA elements. Of primary importance are hypoxic response elements in the 3'-EPO enhancer to which specific heterodimeric HIFs (HIF-{alpha}/beta) can bind (53). Besides HIFs, the EPO promoter has binding sites for GATA factors (46). GATA-2 and GATA-3 are thought to suppress EPO secretion, whereas GATA-4 induces EPO secretion by binding at the 5'-promoter (4). Moreover, the EPO promoter and the 5'-flanking region contain binding sites for NF-{kappa}B, inhibiting EPO gene expression in inflammatory diseases (23). Proinflammatory cytokines, such as TNF-{alpha} and IL-1, also have been shown to inhibit EPO expression (46). Besides these modulators of EPO secretion, other factors such as adenosine have been proposed to regulate EPO secretion.

The hypothesis that adenosine modulates EPO secretion is based on several observations. Adenosine is known to accumulate in the kidney in response to ischemia or increased tubular workload (27, 35, 36) and can change intrarenal hemodynamics by induction of vasoconstriction in the kidney and thus change local O2 concentrations (52). The enzyme ecto-5'-nucleotidase, converting extracellular AMP into adenosine, is present on the cell surface of interstitial cells, which also positively stained for EPO mRNA (2, 9, 22). Furthermore, ARs and CD73 itself are transcriptionally induced by HIF-1 (34, 48). Examination of the cd73 gene promoter identified a site for HIF-1{alpha} binding, and inhibition of HIF-1{alpha} expression by antisense oligonucleotides resulted in significant attenuation of hypoxia-inducible cd73 expression. Analysis of the cloned A2BAR promoter identified a functional hypoxia-responsive region, including a binding site for HIF-1{alpha}. Thus the hypothesis that adenosine may regulate EPO secretion would fit into published models of hypoxia-induced signaling cascades. To which extent unidentified factors may modulate CD73 activity to generate adenosine extracellularly may contribute to changes in A2BAR signaling is subject to further investigation.

Previous studies of the contribution of AR signaling to EPO secretion have yielded conflicting results. In vitro investigations using the human hepatoma cell lines Hep3B and HepG2, which produce EPO in an oxygen-dependent fashion (51), showed an increase in the EPO secretory response following application of the selective A1AR agonist 6-cyclohexyladenosine (CHA) at concentrations of 10–5 and 5 x 10–5 M (28). However, cyclopentyladenosine, another selective A1AR agonist, inhibited (32), 5'-N-ethylcarboxamideadenosine (NECA), a nonselective AR agonist, stimulated (30), and CGS-21680 [2-p-(2-carboxyethyl) phenethylamino-5'-N-ethylcarboxamidoadenosine hydrochloride], a selective A2AR agonist, had no effect on EPO secretion (17). Apart from inconsistencies in these findings, the extent to which EPO production in liver cells reflects regulation of the hormone in the kidney remains questionable.

One study (8) proposed that adenosine regulated EPO secretion through the activation of the A2AAR and A2BAR. The investigators postulated that A2AAR and A2BAR increase EPO mRNA through an increase in cAMP and HIF-1{alpha}. However, these findings of selective inhibition of EPO secretion by A2AAR and A2BAR antagonism could not be reproduced by other groups (11–13). These conflicting results could be due to weak selectivity of the compounds and different experimental settings. Another study (51) reported that, in vitro, the A1AR agonist CHA inhibited albuterol-stimulated 59Fe incorporation. This effect was blocked by high doses of theophylline (up to 80 mg/kg). However, this theophylline dose cannot be considered to block ARs only (39). In another study (6), it was shown recently that theophylline in therapeutic concentrations (3 µM) could stimulate a histone deacetylase independently of adenosine receptors or phosphodiesterase inhibition, rendering theophylline as a substance too nonspecific to interfere with adenosine receptors.

Our current results in the mouse model confirm and extend the results of a previous, very thoroughly performed in vivo study in rats. That study, using different AR antagonists such as theophylline, 9-cyclopentyl-1,3-dipropylxanthine, 8-noradamantyl-1,3-dipropylxanthine (KW-3902), and DMPX as well as the AR agonists CHA and CGS-21680 failed to show any effects of these compounds on EPO secretory responses under normoxic or hypoxic conditions (12). Moreover, the same group administered APCP or dipyridamole to increase extracellular adenosine concentrations, but these maneuvers were also without effect on renal EPO mRNA or EPO serum concentrations, suggesting that adenosine is not critical for normal regulation of EPO secretion. These observations were confirmed in two human trials in which the induction of EPO secretion by phlebotomy (13) or exposure to hypobaric hypoxia in healthy volunteers was not modified by theophylline, a nonselective AR antagonist, or dipyridamole, an adenosine reuptake inhibitor (11). Notably, and in accordance with our current findings, Ozuyaman et al. (37) very recently demonstrated that the EPO secretory response to hypoxia is unaffected in cd73–/– mice compared with their controls, despite the fact that these mice have another genetic background compared with the mice used in this study. The finding in our three models of systemic hypoxia that adenosine tissue content did not change compared with normoxic conditions emphasizes the difference between systemic hypoxia and complete renal ischemia by clamping the renal artery in which adenosine tissue levels increases at least fivefold (36). Interestingly, mice lacking CD73 activity exhibit significantly lower adenosine levels in the kidney even under systemic hypoxia than under normoxia (Fig. 4), indicating the importance of extracellular adenosine generation. Ozuyaman et al. (37) also reported unchanged adenosine tissue content (20 nmol/g) under hypoxic conditions (1,000 ppm CO, 8% O2). However, the renal adenosine tissue content in our study was between 3 and 4 nmol/g wet wt, which agrees well with data reported in the literature for rats (21, 36) and mice (15, 16). The differences between absolute adenosine tissue content reported by Ozuyaman et al. and those of the literature are unexplained at present. In addition, concentrations of renal extracellular adenosine (50–200 nmol/l) do not correspond to the whole tissue content of adenosine (2–5 µmol/kg wet wt) (52).

The doses of all substances that we have tested were based on earlier reports in which clear antagonistic effects were demonstrated on different organ functions in experimental animals. Thus the dose of DPCPX showed a protective effect in glycerol-induced acute renal failure (20, 44), the dose of DMPX had a maximal effect on NECA-induced hypothermia and locomotor activity depression (42), and the dose of MRS 1119 was protective in ischemia-reperfusion and myoglobinuria-mediated renal injury (25). Furthermore, we could show that the dose of theophylline was protective following renal transplantation (14) and that the dose of APCP or PSB 1115 abolished the renal or cardioprotective effects of ischemic preconditioning, respectively (7, 15). To provide confidence that the results of this study do not reflect in our hands a lack of sensitivity and/or specificity for the detection of EPO, we refer to our previous investigations showing an increase or decrease of the EPO secretory response in rats following renal denervation or in rats on a high-salt diet, respectively, following 4 h of exposure to 600 ppm CO compared with controls.

In conclusion, considering the entirety of our findings obtained with knockout mice and adenosine receptor-inhibiting substances, it appears unlikely that an increase of adenosine concentration in the peritubular renal interstitium modulates a hypoxia-induced increase in the production or release of EPO. Together, the present experiments demonstrate that neither adenosine generation by ecto-5'-nucleotidase nor signaling through individual ARs is required for stimulation of EPO secretion in response to hypoxic stimuli.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This investigation was supported by the Federal Ministry of Education, Science, Research and Technology (BMBF 01EC0001).


    ACKNOWLEDGMENTS
 
We acknowledge Rosemarie Maier and Renate Riehle for technical assistance and Cathérine Ledent and Marlene Jacobson for kindly providing gene-targeted mice for A2AAR and A3AR, respectively.


    FOOTNOTES
 

Address for reprint requests and other correspondence: H. K. Eltzschig, Mucosal Inflammation Program, Dept. of Anesthesiology and Perioperative Medicine, Univ. of Colorado Health Sciences Center, 4200 E. Ninth Ave., Campus Box B113, Denver, CO 80262 (e-mail: holger.eltzschig{at}uchsc.edu) or H. Osswald, Dept. of Pharmacology and Toxicology, Tübingen Univ. Hospital, Wilhelmstr. 56, D-72074 Tübingen, Germany (e-mail: hartmut.osswald{at}uni-tuebingen.de)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Adamson JW, Eschbach JW. Treatment of the anemia of chronic renal failure with recombinant human erythropoietin. Annu Rev Med 41: 349–360, 1990.[CrossRef][Web of Science][Medline]
  2. Bachmann S, Le HM, Eckardt KU. Co-localization of erythropoietin mRNA and ecto-5'-nucleotidase immunoreactivity in peritubular cells of rat renal cortex indicates that fibroblasts produce erythropoietin. J Histochem Cytochem 41: 335–341, 1993.[Abstract]
  3. Bakris GL, Sauter ER, Hussey JL, Fisher JW, Gaber AO, Winsett R. Effects of theophylline on erythropoietin production in normal subjects and in patients with erythrocytosis after renal transplantation. N Engl J Med 323: 86–90, 1990.[Abstract]
  4. Blanchard KL, Acquaviva AM, Galson DL, Bunn HF. Hypoxic induction of the human erythropoietin gene: cooperation between the promoter and enhancer, each of which contains steroid receptor response elements. Mol Cell Biol 12: 5373–5385, 1992.[Abstract/Free Full Text]
  5. Castrop H, Huang Y, Hashimoto S, Mizel D, Hansen P, Theilig F, Bachmann S, Deng C, Briggs J, Schnermann J. Impairment of tubuloglomerular feedback regulation of GFR in ecto-5'-nucleotidase/CD73-deficient mice. J Clin Invest 114: 634–642, 2004.[CrossRef][Web of Science][Medline]
  6. Cosio BG, Tsaprouni L, Ito K, Jazrawi E, Adcock IM, Barnes PJ. Theophylline restores histone deacetylase activity and steroid responses in COPD macrophages. J Exp Med 200: 689–695, 2004.[Abstract/Free Full Text]
  7. Eckle T, Krahn T, Grenz A, Kohler D, Mittelbronn M, Ledent C, Jacobson MA, Osswald H, Thompson LF, Unertl K, Eltzschig HK. Cardioprotection by ecto-5'-nucleotidase (CD73) and A2B adenosine receptors. Circulation 115: 1581–1590, 2007.[Abstract/Free Full Text]
  8. Fisher JW, Brookins J. Adenosine A2A and A2B receptor activation of erythropoietin production. Am J Physiol Renal Physiol 281: F826–F832, 2001.[Abstract/Free Full Text]
  9. Gebhard C, Petroktistis F, Zhang H, Kammerer D, Kohle C, Klingel K, Albinus M, Gleiter CH, Osswald H, Grenz A. Role of renal nerves and salt intake on erythropoietin secretion in rats following carbon monoxide exposure. J Pharmacol Exp Ther 319: 111–116, 2006.[Abstract/Free Full Text]
  10. Gleiter CH. Posttransplant erythrocytosis: a model for the investigation of the pharmacological control of renal erythropoietin production? Int J Clin Pharmacol Ther 34: 489–492, 1996.[Web of Science][Medline]
  11. Gleiter CH, Becker T, Wenzel J. Erythropoietin production in healthy volunteers subjected to controlled hypobaric hypoxia: further evidence against a role for adenosine. Br J Clin Pharmacol 44: 203–205, 1997.[CrossRef][Web of Science][Medline]
  12. Gleiter CH, Brause M, Delabar U, Zebski H, Eckardt KU. Evidence against a major role of adenosine in oxygen-dependent regulation of erythropoietin in rats. Kidney Int 52: 338–344, 1997.[CrossRef][Web of Science][Medline]
  13. Gleiter CH, Freudenthaler S, Delabar U, Eckardt KU, Muhlbauer B, Gundert-Remy U, Osswald H. Erythropoietin production in healthy volunteers subjected to controlled haemorrhage: evidence against a major role for adenosine. Br J Clin Pharmacol 42: 729–735, 1996.[CrossRef][Web of Science][Medline]
  14. Grenz A, Baier D, Petroktistis F, Wehrmann M, Kohle C, Schenk M, Sessler M, Gleiter CH, Fandrich F, Osswald H. Theophylline improves early allograft function in rat kidney transplantation. J Pharmacol Exp Ther 317: 473–479, 2006.[Abstract/Free Full Text]
  15. Grenz A, Zhang H, Eckle T, Mittelbronn M, Wehrmann M, Kohle C, Kloor D, Thompson LF, Osswald H, Eltzschig HK. Protective role of ecto-5'-nucleotidase (CD73) in renal ischemia. J Am Soc Nephrol 18: 833–845, 2007.[Abstract/Free Full Text]
  16. Grenz A, Zhang H, Hermes M, Eckle T, Klingel K, Huang DY, Muller CE, Robson SC, Osswald H, Eltzschig HK. Contribution of E-NTPDase1 (CD39) to renal protection from ischemia-reperfusion injury. FASEB J 2007.
  17. Ilan Y, Dranitzki-Elhallel M, Rubinger D, Silver J, Popovtzer MM. Erythrocytosis after renal transplantation. The response to theophylline treatment. Transplantation 57: 661–664, 1994.[Web of Science][Medline]
  18. Jelkmann W. Erythropoietin: structure, control of production, and function. Physiol Rev 72: 449–489, 1992.[Free Full Text]
  19. Jelkmann W, Metzen E. Erythropoietin in the control of red cell production. Ann Anat 178: 391–403, 1996.[Web of Science][Medline]
  20. Kellett R, Bowmer CJ, Collis MG, Yates MS. Amelioration of glycerol-induced acute renal failure in the rat with 8-cyclopentyl-1,3-dipropylxanthine. Br J Pharmacol 98: 1066–1074, 1989.[Web of Science][Medline]
  21. Kloor D, Delabar U, Muhlbauer B, Luippold G, Osswald H. Tissue levels of S-adenosylhomocysteine in the rat kidney: effects of ischemia and homocysteine. Biochem Pharmacol 63: 809–815, 2002.[CrossRef][Web of Science][Medline]
  22. Kloor D, Hermes M, Fink K, Schmid H, Klingel K, Mack A, Grenz A, Osswald H. Expression and localization of S-adenosylhomocysteine-hydrolase in the rat kidney following carbon monoxide induced hypoxia. Cell Physiol Biochem 19: 57–66, 2007.[CrossRef][Web of Science][Medline]
  23. La FK, Reimann C, Jelkmann W, Hellwig-Burgel T. Inhibition of erythropoietin gene expression signaling involves the transcription factors GATA-2 and NF-{kappa}B. FASEB J 16: 1811–1813, 2002.[Abstract/Free Full Text]
  24. Ledent C, Vaugeois JM, Schiffmann SN, Pedrazzini T, El YM, Vanderhaeghen JJ, Costentin J, Heath JK, Vassart G, Parmentier M. Aggressiveness, hypoalgesia and high blood pressure in mice lacking the adenosine A2a receptor. Nature 388: 674–678, 1997.[CrossRef][Medline]
  25. Lee HT, Ota-Setlik A, Xu H, D'Agati VD, Jacobson MA, Emala CW. A3 adenosine receptor knockout mice are protected against ischemia- and myoglobinuria-induced renal failure. Am J Physiol Renal Physiol 284: F267–F273, 2003.[Abstract/Free Full Text]
  26. Means RTJr, Krantz SB. Progress in understanding the pathogenesis of the anemia of chronic disease. Blood 80: 1639–1647, 1992.[Abstract/Free Full Text]
  27. Miller WL, Thomas RA, Berne RM, Rubio R. Adenosine production in the ischemic kidney. Circ Res 43: 390–397, 1978.[Abstract/Free Full Text]
  28. Nakashima J, Brookins J, Beckman B, Fisher JW. Increased erythropoietin secretion in human hepatoma cells by N6-cyclohexyladenosine. Am J Physiol Cell Physiol 261: C455–C460, 1991.[Abstract/Free Full Text]
  29. Nakashima J, Brookins J, Ohigashi T, Fisher JW. Adenosine A2 receptor modulation of erythropoietin secretion in hepatocellular carcinoma cells. Life Sci 54: 109–117, 1994.[CrossRef][Web of Science][Medline]
  30. Nakashima J, Ohigashi T, Brookins JW, Beckman BS, Agrawal KC, Fisher JW. Effects of 5'-N-ethylcarboxamideadenosine (NECA) on erythropoietin production. Kidney Int 44: 734–740, 1993.[Web of Science][Medline]
  31. Nakashima J, Tazaki H, Fisher JW. Increase in erythropoietin secretion mediated by adenosine A2 receptors [in Japanese]. Hum Cell 6: 36–41, 1993.[Medline]
  32. Ohigashi T, Brookins J, Fisher JW. Adenosine A1 receptors and erythropoietin production. Am J Physiol Cell Physiol 265: C934–C938, 1993.[Abstract/Free Full Text]
  33. Ohigashi T, Nakashima J, Aggarwal S, Brookins J, Agrawal K, Fisher JW. Enhancement of erythropoietin production by selective adenosine A2 receptor agonists in response to hypoxia. J Lab Clin Med 126: 299–306, 1995.[Web of Science][Medline]
  34. Okusa MD, Linden J, Huang L, Rieger JM, Macdonald TL, Huynh LP. A2A adenosine receptor-mediated inhibition of renal injury and neutrophil adhesion. Am J Physiol Renal Physiol 279: F809–F818, 2000.[Abstract/Free Full Text]
  35. Osswald H, Nabakowski G, Hermes H. Adenosine as a possible mediator of metabolic control of glomerular filtration rate. Int J Biochem 12: 263–267, 1980.[CrossRef][Web of Science][Medline]
  36. Osswald H, Schmitz HJ, Kemper R. Tissue content of adenosine, inosine and hypoxanthine in the rat kidney after ischemia and postischemic recirculation. Pflügers Arch 371: 45–49, 1977.[CrossRef][Web of Science][Medline]
  37. Ozuyaman B, Ding Z, Buchheiser A, Koszalka P, Braun N, Godecke A, Decking UK, Zimmermann H, Schrader J. Adenosine produced via the CD73/ecto-5'-nucleotidase pathway has no impact on erythropoietin production but is associated with reduced kidney weight. Pflügers Arch 452: 324–331, 2006.[CrossRef][Web of Science][Medline]
  38. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45, 2001.
  39. Rall TW. Drugs used in the treatment of asthma. In: Goodman and Gilman's The Pharmacological Basis of Therapeutics, edited by Rall TW, Nies AS, and Taylor P. New York: McGraw-Hill, 1990, p. 618–637.
  40. Salvatore CA, Tilley SL, Latour AM, Fletcher DS, Koller BH, Jacobson MA. Disruption of the A3 adenosine receptor gene in mice and its effect on stimulated inflammatory cells. J Biol Chem 275: 4429–4434, 2000.[Abstract/Free Full Text]
  41. Scholz H, Schurek HJ, Eckardt KU, Kurtz A, Bauer C. Oxygen-dependent erythropoietin production by the isolated perfused rat kidney. Pflügers Arch 418: 228–233, 1991.[CrossRef][Web of Science][Medline]
  42. Seale TW, Abla KA, Shamim MT, Carney JM, Daly JW. 3,7-Dimethyl-1-propargylxanthine: a potent and selective in vivo antagonist of adenosine analogs. Life Sci 43: 1671–1684, 1988.[CrossRef][Web of Science][Medline]
  43. Semenza GL, Nejfelt MK, Chi SM, Antonarakis SE. Hypoxia-inducible nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene. Proc Natl Acad Sci USA 88: 5680–5684, 1991.[Abstract/Free Full Text]
  44. Shimada J, Suzuki F, Nonaka H, Karasawa A, Mizumoto H, Ohno T, Kubo K, Ishii A. 8-(Dicyclopropylmethyl)-1,3-dipropylxanthine: a potent and selective adenosine A1 antagonist with renal protective and diuretic activities. J Med Chem 34: 466–469, 1991.[CrossRef][Web of Science][Medline]
  45. Sitkovsky MV, Lukashev D, Apasov S, Kojima H, Koshiba M, Caldwell C, Ohta A, Thiel M. Physiological control of immune response and inflammatory tissue damage by hypoxia-inducible factors and adenosine A2A receptors. Annu Rev Immunol 22: 657–682, 2004.[CrossRef][Web of Science][Medline]
  46. Stockmann C, Fandrey J. Hypoxia-induced erythropoietin production: a paradigm for oxygen-regulated gene expression. Clin Exp Pharmacol Physiol 33: 968–979, 2006.[CrossRef][Web of Science][Medline]
  47. Sun D, Samuelson LC, Yang T, Huang Y, Paliege A, Saunders T, Briggs J, Schnermann J. Mediation of tubuloglomerular feedback by adenosine: evidence from mice lacking adenosine 1 receptors. Proc Natl Acad Sci USA 98: 9983–9988, 2001.[Abstract/Free Full Text]
  48. Synnestvedt K, Furuta GT, Comerford KM, Louis N, Karhausen J, Eltzschig HK, Hansen KR, Thompson LF, Colgan SP. Ecto-5'-nucleotidase (CD73) regulation by hypoxia-inducible factor-1 mediates permeability changes in intestinal epithelia. J Clin Invest 110: 993–1002, 2002.[CrossRef][Web of Science][Medline]
  49. Thompson LF, Eltzschig HK, Ibla JC, Van De Wiele CJ, Resta R, Morote-Garcia JC, Colgan SP. Crucial role for ecto-5'-nucleotidase (CD73) in vascular leakage during hypoxia. J Exp Med 200: 1395–1405, 2004.[Abstract/Free Full Text]
  50. Thomson S, Bao D, Deng A, Vallon V. Adenosine formed by 5'-nucleotidase mediates tubuloglomerular feedback. J Clin Invest 106: 289–298, 2000.[Web of Science][Medline]
  51. Ueno M, Brookins J, Beckman B, Fisher JW. A1 and A2 adenosine receptor regulation of erythropoietin production. Life Sci 43: 229–237, 1988.[CrossRef][Web of Science][Medline]
  52. Vallon V, Muhlbauer B, Osswald H. Adenosine and kidney function. Physiol Rev 86: 901–940, 2006.[Abstract/Free Full Text]
  53. Wang GL, Jiang BH, Rue EA, Semenza GL. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci USA 92: 5510–5514, 1995.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
PhysiologyHome page
T. Eckle, M. Koeppen, and H. K. Eltzschig
Role of Extracellular Adenosine in Acute Lung Injury
Physiology, October 1, 2009; 24(5): 298 - 306.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
293/5/F1501    most recent
00243.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grenz, A.
Right arrow Articles by Osswald, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grenz, A.
Right arrow Articles by Osswald, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.