AJP - Renal Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Renal Physiol 293: F1556-F1563, 2007. First published August 8, 2007; doi:10.1152/ajprenal.00010.2007
0363-6127/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/F1556    most recent
00010.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, F. Y.
Right arrow Articles by Nikolic-Paterson, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, F. Y.
Right arrow Articles by Nikolic-Paterson, D. J.

MKK3-p38 signaling promotes apoptosis and the early inflammatory response in the obstructed mouse kidney

Frank Y. Ma,1 Greg H. Tesch,1,2 Richard A. Flavell,3 Roger J. Davis,4 and David J. Nikolic-Paterson1,2

1Department of Nephrology and 2Monash University Department of Medicine, Monash Medical Centre, Clayton, Victoria, Australia; 3Section of Immunobiology, Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, Connecticut; and 4Howard Hughes Medical Institute, Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts

Submitted 5 January 2007 ; accepted in final form 3 August 2007


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Activation of the p38 mitogen-activated protein kinase (MAPK) pathway induces inflammation, apoptosis, and fibrosis. However, little is known of the contribution of the upstream kinases, MMK3 and MKK6, to activation of the p38 kinase in the kidney and consequent renal injury. This study investigated the contribution of MKK3 to p38 MAPK activation and renal injury in the obstructed kidney. Groups of eight wild-type (WT) or Mkk3–/– mice underwent unilateral ureteric obstruction (UUO) and were killed 3 or 7 days later. Western blotting showed a marked increase in phospho-p38 (p-p38) MAPK in UUO WT kidney. The same trend of increased p-p38 MAPK was seen in the UUO Mkk3–/– kidney, although the actual level of p-p38 MAPK was significantly reduced compared with WT, and this could not be entirely compensated for by the increase in MKK6 expression in the Mkk3–/– kidney. Apoptosis of tubular and interstitial cells in WT UUO mice was reduced by 50% in Mkk3–/– UUO mice. Furthermore, cultured Mkk3–/– tubular epithelial cells showed resistance to H2O2-induced apoptosis, suggesting a direct role for MKK3-p38 signaling in tubular apoptosis. Upregulation of MCP-1 mRNA levels and macrophage infiltration seen on day 3 in WT UUO mice was significantly reduced in Mkk3–/– mice, but this difference was not evident by day 7. The development of renal fibrosis in Mkk3–/– UUO mice was not different from that seen in WT UUO mice. In conclusion, these studies identify discrete roles for MKK3-p38 signaling in renal cell apoptosis and the early inflammatory response in the obstructed kidney.

MKK6; macrophage; MCP-1; fibrosis

THE p38 MITOGEN-ACTIVATED protein kinase (MAPK) is one of three major MAPK signaling pathways which is triggered by a wide range of extracellular ligands and stresses such as proinflammatory cytokines (IL-1, TNF-{alpha}), growth factors (TGF-beta1, PDGF), reactive oxygen species, stretch, osmotic stress, and UV irradiation (12). There are four isoforms of the p38 kinase, of which p38{alpha}, beta, and {delta} are expressed in the kidney. The p38 kinase is activated by phosphorylation of a conserved Thr-Gly-Tyr motif in the activation loop. The activated p38 is then able to phosphorylate a wide variety of targets in the cytoplasm and nucleus, resulting in cellular responses such as apoptosis, inflammation, and fibrosis (12). The activation loop of the p38 kinase is phosphorylated through the action of the upstream kinases MAPKK3 (MKK3) and MAPKK6 (MKK6), although other mechanisms of p38 activation have been described in response to specific stimuli (9). Components of the p38 signaling pathway are present in many cell types. However, activation of this pathway can lead to different outcomes depending on the nature of the activating signal and the cell type involved. For example, p38 signaling can either enhance or suppress apoptosis of cultured tubular epithelial cells depending on the nature of the stimulus (5, 7).

Studies in human biopsies have identified a correlation between increased p38 phosphorylation and the degree of renal dysfunction and pathological changes in human glomerulonephritis (24). Studies on the functional role of p38 kinase signaling in experimental kidney disease have been restricted to the use of p38 inhibitor drugs given that genetic deletion of the p38{alpha} isoform is fetally lethal (26). Administration of the p38{alpha}/beta inhibitor FR167653 has been shown to suppress proteinuria and histological damage in anti-glomerular basement membrane (GBM) glomerulonephritis and puromycin nephrosis in the rat (11, 28). Blockade of p38{alpha} with NPC31145 was shown to suppress acute rat anti-GBM disease, while treatment with another p38{alpha} inhibitor, NPC31169, suppressed renal fibrosis in the obstructed rat kidney (22, 23). However, not all studies have shown beneficial effects of p38 blockade in experimental models of renal injury (3, 20).

In most tissues, including the kidney, very little is known of the contribution of MKK3 or MKK6 to activation of the p38 MAPK pathway, and thus to induction of renal injury. In vitro, cultured mouse mesangial cells require MKK3 in TGF-beta1 activation of p38{alpha} and p38{delta} and collagen production (30). However, the contribution of MKK3-p38 signaling in the development of kidney disease is unknown. To address this important question, we used mice deficient for Mkk3 to investigate the contribution of MKK3-p38 signaling in the development of renal inflammation, apoptosis, and fibrosis in a mouse model of unilateral ureteric obstruction (UUO).


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reagents. Antibodies used in this study were rabbit anti-MKK3, rabbit anti-phospho-MKK3/6 (this antibody recognizes a phosphorylated activation loop conserved between MKK3 and MKK6), rabbit anti-phospho-p38 (Thr180/Tyr182), and rabbit anti-cleaved caspase-3 (Cell Signaling Technology, Beverly, MA); mouse anti-p38{alpha} and rabbit anti-MKK6 (Upstate Biotechnology, Lake Placid, NY); goat anti-collagen IV (Southern Biotechnology Associates, Birmingham, AL); mouse anti-{alpha}-smooth muscle actin ({alpha}-SMA; Sigma-Aldrich, Castle Hill, NSW, Australia), rabbit anti-tubulin (Abcam, Cambridge, UK), rabbit anti-TGF-beta1 (Santa Cruz Biotechnology, Santa Cruz, CA), and F4/80 (Serotec, Oxford, UK). Horseradish peroxidase-conjugated goat anti-mouse IgG and peroxidase-conjugated mouse anti-peroxidase complexes (PAP) were purchased from Dako (Glostrup, Denmark). Biotinylated goat anti-rabbit IgG was from Zymed-Invitrogen (Carlsbad, CA). The avidin-biotin complex (ABC) kit was from Vector Labs (Burlingame, CA). Goat anti-rabbit Alexa Fluor 680 and donkey anti mouse IRDye 800 were from Molecular Probes (Eugene, OR).

Mouse model of obstructed kidney. Wild-type C57BL/6J mice were obtained from Monash Animal Services (Clayton, Australia). Mkk3–/– mice, which have been described previously (31), were backcrossed for eight generations onto the C57BL/6J background and then bred in-house at Monash Medical Centre, Clayton. Mice were maintained on a normal diet under conventional animal house conditions.

Female mice (18–22 g) were anesthetized, a midline incision was made, and the left ureter was ligated. Groups of mice were killed on day 3 (n = 6) or day 7 (n = 8) after UUO. Bromodeoxyuridine (BrdU; 50 mg/kg) was given by intraperitoneal injection 3 h before mice were killed. All animal experimentation was approved by the Monash Medical Centre Animal Ethics Committee.

Western blotting. A quarter kidney was snap-frozen and stored at –80°C until use. Frozen samples were homogenized in 0.5 ml of lysis buffer (pH 7.2) containing 8.1 mM Na2HPO4, 1.5 mM KH2PO4, 135 mM NaCl, 2.7 mM KCl, 1 mM EDTA, 5 mM NaF, 6 M urea, 0.5% Triton X-100, 1 mM Na3VO4, 20 mM sodium pyrophosphate, 25 µg/ml leupeptin, 3 µg/ml aprotinin, 100 µM phenylmethylsulfonyl fluoride, and 1% phosphatase inhibitor cocktail (Sigma-Aldrich). Samples then were sonication for 5 s, left at room temperature for 1 h, centrifuged, and the supernatant was collected and stored frozen until use. Samples were separated using SDS-PAGE and then transferred to nitrocellulose membranes. Blots were blocked using Odyssey Blocking Buffer (LI-COR, Lincoln, NE) and incubated with primary antibodies in Odyssey Blocking Buffer with 0.05% Tween 20 overnight at 4°C. After washing, the blots were then incubated with goat anti-rabbit Alexa Fluor 680 or donkey anti-mouse IRDye 800 for 1 h and detected using the Odyssey Infrared Image Detecting System (LI-COR). Densitometric analysis was performed by the Gel Pro analyzer program (Media Cybernetics).

Histochemistry and immunostaining. Kidney tissues were fixed in 4% buffered formalin for 4 h, embedded in paraffin, and 2-µm sections were cut for periodic acid-Schiff (PAS) staining or 4-µm sections cut for immunostaining (cleaved caspase-3, {alpha}-SMA, TGF-beta1, and F4/80). Alternatively, tissue was fixed in 2% paraformaldehyde-lysine-periodate (PLP) for 3.5 h, snap-frozen and 4-µm cryostat sections were prepared for collagen IV immunostaining. Immunohistochemical staining was performed as described previously (23). Briefly, paraffin-embedded sections were dewaxed (or frozen sections were hydrated) and microwave oven heated in 0.1 M sodium citrate buffer for 12 min (for cleaved caspase 3, TGF-beta1 and F4/80). After the serum block, sections were incubated with primary antibodies in PBS with 3% BSA overnight at 4°C. Sections were washed, and the primary antibodies were detected using either the ABC (cleaved caspase-3, F4/80) or the PAP peroxidase method ({alpha}-SMA, TGF-beta1 and collagen IV) and developed with 3,3-diaminobenzidine to produce a brown color.

Quantification of histochemistry and immunostaining. All analyses were performed on blinded slides. Interstitial volume was assessed on PAS-stained sections at x250 magnification by counting the number of intersecting points that fall between tubules on a defined 100-point grid. Glomeruli and large vessels were excluded. A total of 20 cortical fields were counted per animal, and the results are expressed as a percentage of the total number of grid points counted. Tubular damage was also scored on PAS-stained sections. For each case, all of the tubular cross sections in 20 fields of the renal cortex (x250) were assessed for tubular dilatation and/or atrophy, and the number of damaged tubules is expressed as a percentage of the total number.

Tubular and interstitial cells stained for cleaved caspase-3 were counted in high-power fields (x400) covering the entire cortex. The interstitial area of F4/80, {alpha}-SMA, and collagen IV immunostaining was quantified in x250-power fields covering >90% of the cortex by image analysis using Image-Pro Plus software (Media Cybernetics), and the results are expressed as the percentage of the cortical area stained (large blood vessels were excluded from the analysis).

Real-time RT-PCR. Total RNA was extracted from quarter kidney samples using RiboPure Reagents (Ambion) according to the manufacturer's protocol. Reverse transcription was performed using a Superscript First-Strand Synthesis Kit with random primers (Invitrogen). Real-time PCR was performed on the Rotor-Gene 3000 System (Corbett Research, Sydney, NSW, Australia) with thermal cycling conditions of 37°C for 10 min, 95°C for 5 min, followed by 50 cycles of 95°C for 15 s, 60°C for 20 s, and 68°C for 20 s. The primer pairs and probes used were TGF-beta1 (forward: GGACACACAGTACAGCAA; reverse: GACCCACGTAGTAGACGA T; probe: ACAACCAACACAACCC); TNF-{alpha} (forward: GGCTGCCCCGACTACGT; reverse: TTTCTCCTGGTATGAGATAGCAAATC; probe: TCACCCACACCGTCAG); collagen IV (forward: GGCGGTACACAGTCAGACCAT; reverse: GGAATAGCCGATCCACAGTGA; probe: CAGTGCCCTAACGGT); and MCP-1 (forward: GACCCGTAAATCTGAAGCTAA; reverse: CACACTGGTCACTCCTACAGAA; probe: ACAACCACCTCAAGCAC). The relative amount of mRNA was calculated using the comparative Ct ({Delta}Ct) method. All specific amplicons were normalized against GAPDH mRNA or 18S ribosome RNA (Applied Biosystems, Scoresby, Victoria, Australia), whose expression was determined in the same reaction as an internal control.

In vitro studies of tubular cell apoptosis. Proximal tubular epithelial cells were prepared from diced wild-type (WT) or Mkk3–/– kidney tissue by digestion with 5 mg/ml collagenase class II in Hank's buffered salt solution for 30 min at 37°C. Tissue fragments then were isolated by sieving, checked for purity by microscopy, and cultured in K1 medium (DMEM/F12 supplemented with 5% FCS, ITS, 25 mM HEPES, 100 U/ml penicillin, 100 µg/ml streptomycin, 1 ng/ml prostaglandin, 5 x 10–11 M triiodothyronine, 5 x 10–8 M hydrocortisone, and 25 ng/ml mouse epidermal growth factor) at 37°C with 5% CO2. Culture medium was changed every 3 days.

In the apoptosis studies, cells were seeded into six-well plates and then starved in serum-free media for 24 h. Cells were treated with varying concentrations of H2O2 for 18 h in serum-free media, and then cell apoptosis was measured in cell lysates using a Cell Death Detection ELISA Kit according to the manufacturer's instructions (Roche, Mannheim, Germany). Apoptosis was normalized on the basis of DNA content of the cell lysates using a Quant-iT DNA Assay Kit (Molecular Probes) and expressed as the ratio of optical density to DNA content. In each experiment, two or three samples per condition were analyzed. Results are based on analyses of all five experiments performed.

Statistical analysis. Experimental data are presented as means ± SD. Immunohistochemical results were analyzed by one-way ANOVA with post -hoc analysis using Bonferroni's multiple comparison test. PCR results among multiple groups were analyzed by the Kruskal-Wallis test followed by Dunn's multiple comparison test. All analysis was performed with GraphPad Prism 3.0 software (GraphPad Software, San Diego, CA).


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
p38 phosphorylation in normal and obstructed kidney. Western blotting identified phosphorylated p38 (p-p38) in lysates of WT kidney, and this was significantly increased in the WT UUO kidney (Fig. 1, A and B). In WT mice, MKK3 is readily detected in the kidney and its expression is unaltered in the UUO kidney. In contrast, expression of MKK6 is markedly increased in WT UUO compared with normal kidney (Fig. 1A). Low levels of p-MKK3/6 were detected in the normal kidney, and this was dramatically elevated in the UUO kidney (Fig. 1, A and B). Unfortunately, we were unable to localize MKK3 or MKK6 to specific cell types within the kidney since the antibodies were not suitable for immunohistochemistry.


Figure 1
View larger version (44K):
[in this window]
[in a new window]

  		Fig. 1. MKK3/6 expression and activation in normal and obstructed mouse kidney. A: whole kidney lysates of normal and obstructed [day 7 unilateral ureteral obstruction (UUO)] kidneys from wild-type (WT) and Mkk3–/– mice were examined by Western blotting for phosphorylated p38 (p-p38), p38{alpha}, MKK3, MKK6 and phosphorylated MKK3/6 (p-MKK3/6), and reprobed for tubulin as a loading control. Graphs are shown of the ratio of p-p38 to tubulin (B) and the ratio of p-MKK3/6 to tubulin (C). Values are means ± SD; n = 8/group. *P < 0.001 vs. normal of the same genotype and #P < 0.001 for Mkk3–/– UUO vs. WT UUO by ANOVA with Bonferroni's multiple comparison test.

 
p38 phosphorylation in normal and obstructed Mkk3–/– kidney. Mkk3–/– mice show no distinct phenotype, and the kidney exhibits normal morphology (34). Western blotting showed a reduced level of p-p38 in the Mkk3–/– kidney compared with WT mice despite an apparent compensatory upregulation of MKK6 expression (Fig. 1, A and B). Similarly, p38 phosphorylation was significantly reduced in the Mkk3–/– UUO vs. WT UUO kidney. However, a marked increase in p38 phosphorylation was still evident in the Mkk3–/– kidney in response to UUO (Fig. 1).

MKK3-p38 signaling promotes early renal inflammation in the obstructed kidney. Inflammatory changes can be seen on days 3 and 7 in the obstructed kidney in terms of upregulation of MCP-1 and TNF-{alpha} mRNA and infiltration of F4/80+ macrophages (Fig. 2). A significant reduction in interstitial macrophage accumulation was evident on day 3 of UUO in Mkk3–/– mice, and this was associated with suppression of MCP-1 mRNA levels (Fig. 2). This suppression of renal inflammation was no longer evident at day 7 of UUO. In contrast to the reduction in MCP-1 mRNA at day 3, no change in TNF-{alpha} mRNA levels were evident on days 3 or 7 in Mkk3–/– UUO mice (Fig. 2G).


Figure 2
View larger version (129K):
[in this window]
[in a new window]

  		Fig. 2. Macrophage infiltration and MCP-1 mRNA expression in the obstructed kidney. A–D: immunostaining of F4/80+ macrophages on days 3 and 7 of UUO in WT and Mkk3–/– mice. Note the partial reduction in F4/80+ macrophages on day 3 in Mkk3–/– mice. E: area of immunostaining for interstitial F4/80+ macrophages on days 3 and 7 of UUO. Real-time RT-PCR analysis of whole kidney RNA samples shows the ratio of MCP-1 (F) and TNF-{alpha} (G) relative to control. Values are means ± SD; n = 6–8/group by ANOVA with Bonferroni's multiple comparison test (E) or Kruskal-Wallis test followed with Dunn's multiple comparison test (F and G).

 
MKK3-p38 signaling promotes renal cell apoptosis in the obstructed kidney. Apoptosis of tubular epithelial cells and, to a lesser extent, interstitial cells, is a feature of the UUO model (10). Apoptotic tubular and interstitial cells were identified in the renal cortex on day 7 of UUO by immunostaining for cleaved caspase-3 (Fig. 3). Despite marked tubular dilatation in the Mkk3–/– UUO kidney, there was an ~50% reduction in the number of apoptotic tubular and interstitial cells (Fig. 3). However, this reduction in apoptosis did not affect the percentage of tubules exhibiting dilatation and/or atrophy in the obstructed kidney (54.2 ± 5.5 vs. 48.1 ± 8.2% in WT and Mkk3–/– UUO mice, respectively, P = not significant). In addition, the marked proliferative response evident in tubular and interstitial cells in the WT UUO kidney was not altered in the Mkk3–/– UUO kidney (data not shown).


Figure 3
View larger version (72K):
[in this window]
[in a new window]

  		Fig. 3. Apoptosis on day 7 in the obstructed kidney. Apoptotic cells were identified by immunostaining for cleaved caspase-3 (arrows). Low- and high-power views are shown for cleaved caspase-3 staining in WT normal (A and B), WT UUO (C and D), and Mkk3–/– UUO (E and F) kidney. G and H: graphs quantifying the number of cleaved caspase-3-stained tubular cells and interstitial cells, respectively. Values are means ± SD; n = 8/ group by ANOVA with Bonferroni's multiple comparison test.

 
In vitro studies were performed to investigate whether the reduction in tubular cell apoptosis seen in the obstructed Mkk3–/– kidney may be due to resistance of Mkk3–/– cells to proapoptotic stimuli. Tubular injury in the UUO model is associated with oxidative stress, which is known to induce tubular apoptosis (7, 10). Therefore, we examined whether primary cultures of Mkk3–/– tubular epithelial cells would show resistance to oxidative stress-induced apoptosis compared with WT cells. As shown in Fig. 4, Mkk3–/– tubular cells were significantly protected from apoptosis at low concentrations of H2O2, but this protection was lost at high concentrations of H2O2.


Figure 4
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 4. Apoptosis in cultured Mkk3–/– tubular epithelial cells. Primary cultures of WT and Mkk3–/– tubular epithelial cells were treated with varying concentrations of H2O2 for 18 h, and cell apoptosis was then measured using a Cell Death Detection ELISA Kit and normalized on the basis of DNA content (expressed as arbitrary units [a.u.] for the ratio of optical density to DNA content). WT cells, {blacksquare}, solid line; Mkk3–/– cells, bullet, dashed line. Values are means ± SD combined from 5 individual experiments. *P < 0.05 for WT vs. Mkk3–/– by unpaired t-test.

 
MKK3-p38 signaling has little effect on renal fibrosis in the obstructed kidney. Ureteric ligation causes the development of interstitial fibrosis by day 7 in the obstructed kidney. The fibrotic changes are characterized by an increase in interstitial volume that is due, in part, to interstitial accumulation of {alpha}-SMA+ myofibroblasts and the deposition of extracellular matrix, such as collagen IV (Fig. 5). These fibrotic changes are associated with a progressive increase in collagen IV and TGF-beta1 mRNA levels on days 3 and 7 of UUO (Fig. 6). Minor, but significant, reductions in interstitial area and interstitial {alpha}-SMA staining were evident in Mkk3–/– UUO compared with WT UUO mice on day 7 (Fig. 5). However, no significant difference was seen in collagen IV deposition, in the upregulation of collagen IV and TGF-beta1 mRNA on day 3 or 7 of UUO, or in the pattern of TGF-beta1 immunostaining (Figs. 5 and 6).


Figure 5
View larger version (117K):
[in this window]
[in a new window]

  		Fig. 5. Fibrotic changes on day 7 in the obstructed kidney. Periodic acid-Schiff (PAS) staining of WT normal (A), WT UUO (B), and Mkk3–/– UUO (C). Immunostaining is also shown for {alpha}-smooth muscle actin ({alpha}-SMA) for WT normal (D), WT UUO (E), and Mkk3–/– UUO (F). G: graph of interstitial area assessed on PAS-stained sections. H: graph of area of {alpha}-SMA immunostaining. I: graph of area of collagen IV immunostaining. Values are means ± SD; n = 8/group. Original magnification x250 (A–F). *P < 0.01 vs. WT normal and #P < 0.01 vs. WT UUO by ANOVA with Bonferroni's multiple comparison test.

 

Figure 6
View larger version (122K):
[in this window]
[in a new window]

  		Fig. 6. Transforming growth factor-beta1 (TGF-beta1) and collagen IV expression in the obstructed kidney. A–D: immunostaining for TGF-beta1 in tissue sections. Weak expression of TGF-beta1 protein is seen in tubules in normal kidney in WT (A) and Mkk3–/– mice (B). C: induction of UUO causes a substantial increase in tubular TGF-beta1 immunostaining, particularly in damaged tubules, although glomeruli remain largely negative. D: a similar pattern of increased tubular TGF-beta1 immunostaining is seen in UUO Mkk3–/– mice. Real-time RT-PCR was used to analyze TGF-beta1 (E) and collagen IV (F) mRNA expression on days 3 and 7 of UUO in WT compared with Mkk3–/– kidney. Open bars, WT normal; filled bars, WT UUO; hatched bars, Mkk3–/– UUO. Values are means ± SD; n = 8/group. Expression in WT UUO and Mkk3–/– UUO groups at days 3 and 7 is significantly increased compared with WT normal (P < 0.01) by the Kruskal-Wallis test followed with Dunn's multiple comparison test.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
This study has identified a discrete role for MKK3-p38 signaling in renal cell apoptosis and in the early inflammatory response in the obstructed kidney, whereas MKK3-p38 signaling was found to be redundant in the fibrotic response.

There was a marked increase in MKK6 levels in the absence of MKK3. This compensatory upregulation of MKK6 expression in the Mkk3–/– kidney is consistent with a previous in vitro study showing that inhibition of p38{alpha} results in upregulation of MKK6 expression (2). Similar to WT mice, Mkk3–/– mice showed a marked increase in p-p38 MAPK in the obstructed kidney. However, the actual levels of p38 phosphorylation in normal and obstructed kidney were significantly reduced in Mkk3–/– mice, and this could not be entirely compensated for by the increase in MKK6 expression. The question arises of whether this reduction in p38 MAPK signaling in the Mkk3–/– kidney has functional significance? Based on the lack of effect of Mkk3 gene deletion on the upregulation of TNF-{alpha} mRNA and the development of renal fibrosis in the obstructed kidney, it would appear that, for these responses at least, this reduction in p38 MAPK signaling has no functional significance.

A number of in vitro studies have shown that p38 signaling plays an important role in the induction of tubular epithelial cell apoptosis (4, 7). Our studies show that apoptosis of tubular epithelial cells and interstitial cells in the obstructed kidney is dependent on MKK3-p38 signaling, and this could not be compensated for by MKK6-p38 signaling or other potential MKK3/6-independent mechanisms of p38 activation, such as MKK4-dependent p38 phosphorylation or TAB1-associated p38 autophosphorylation (6, 9, 27). A number of different stimuli in the obstructed kidney may contribute to apoptosis, including mechanical stretch of tubular cells (19), oxidative stress (25), as well as production of proapoptotic factors such as TGF-beta1 (18), and TNF-{alpha} (17). The protection of Mkk3–/– mice from UUO-induced apoptosis could be due to reduced levels of proapoptotic stimuli or an increased resistance to apoptosis. No difference in mRNA levels for the proapoptotic factors TGF-beta1 or TNF-{alpha} was evident in WT and Mkk3–/– UUO mice, although a role for MKK3-p38 signaling downstream of these factors cannot be ruled out. However, studies of primary cell cultures provide direct evidence that Mkk3–/– tubular epithelial cells are resistant to oxidant-induced apoptosis. This conclusion is supported by in vitro studies indicating that p38 signaling contributes to oxidative stress-induced apoptosis in cultured tubular epithelial cells (7, 25). Furthermore, our recent studies in the db/db mouse model of diabetic nephropathy have found that diabetic Mkk3–/– db/db mice are substantially protected from tubular cell apoptosis (G. H. Tesch, F. Y. Ma, D. J. Nikolic-Paterson, unpublished observations), providing confirmation that MKK3-p38 signaling is of general importance in tubular apoptosis in kidney disease.

Signaling via the p38 MAPK plays an important role in the inflammatory response (12). p38 blockade has been shown to provide protection from inflammatory renal injury in rat models of anti-GBM glomerulonephritis, which has been attributed to a reduction in neutrophil and macrophage infiltration and reduced production of proinflammatory cytokines (22, 28). In the present study, we found that the early interstitial macrophage accumulation and up-regulation of MCP-1 mRNA was suppressed in Mkk3–/– UUO mice, although this protection was lost by day 7. Previous studies have shown that blockade of MCP-1 results in a small, but significant, reduction in the accumulation of F4/80+ macrophages in the early stages (day 4) of the UUO model (29). Therefore, it is likely that the suppression of MCP-1 mRNA at day 3 in Mkk3–/– UUO mice is responsible for the reduction in macrophage accumulation seen at this time.

In vitro studies have implicated the p38 signaling pathway in TGF-beta1-induced matrix production by fibroblasts (1, 21). Furthermore, administration of a p38 inhibitor drug suppressed myofibroblast accumulation and deposition of collagen IV in the rat UUO model (23). The current study found that renal fibrosis was unaltered in Mkk3–/– UUO compared with WT UUO mice on the basis of upregulation of collagen IV and TGF-beta1 mRNA and immunostaining for collagen IV and TGF-beta1, indicating redundancy of MKK3 and MKK6 in the fibrotic response to ureteric obstruction. However, a small, but significant, reduction in the area of {alpha}-SMA staining was evident in Mkk3–/– UUO mice. The apparent discrepancy between unaltered renal fibrosis and reduced {alpha}-SMA myofibroblast accumulation in the Mkk3–/– UUO group may be explained by studies showing that the TGF-beta1-induced transition of {alpha}-SMA– fibroblasts to {alpha}-SMA+ myofibroblasts operates, in part, through a p38 MAPK-dependent mechanism (14, 15).

The current study has shown that specific targeting of MKK3-p38 signaling can suppress tubular and interstitial cell apoptosis and reduce the early inflammatory response in the obstructed kidney. The inhibition of these responses, despite a significant increase in MKK6-p38 signaling in the obstructed kidney, suggests that this inhibition specifically relates to blockade of MKK3-p38 rather than an overall reduction in p38 signaling. These findings are consistent with a recent study in which MKK3-p38 signaling was shown to be critical for the induction of knee-joint inflammation in a mouse model of passive arthritis (8). Interestingly, regulation of TNF-{alpha} production by MKK3-p38 signaling is cell type and stimulus specific. TNF-{alpha}-induced upregulation of TNF-{alpha} mRNA is blunted in Mkk3–/– murine embryonic fibroblasts, whereas LPS-induced TNF-{alpha} secretion is unaltered in Mkk3–/– peritoneal macrophages (13, 31). In the current study, we found that upregulation of TNF-{alpha} mRNA in the UUO kidney was not affected by Mkk3 gene deletion. This may be due, in part, to tubular cells rather than macrophages being a major site of TNF-{alpha} production in the obstructed kidney (16).

In conclusion, this study has identified a discrete role for MKK3-p38 signaling in renal cell apoptosis and in the early inflammatory response in the obstructed kidney despite a compensatory increase in MKK6 expression in the Mkk3–/– kidney. In contrast, MKK3-p38 signaling was redundant in the renal fibrotic response in ureteric obstruction.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This study was funded by the National Health and Medical Research Council of Australia.


   FOOTNOTES
 

Address for reprint requests and other correspondence: D. J. Nikolic-Paterson, Dept. of Nephrology, Monash Medical Centre, 246 Clayton Rd., Clayton, Victoria 3168, Australia (e-mail: david.nikolic-paterson{at}med.monash.edu.au)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Akiyama-Uchida Y, Ashizawa N, Ohtsuru A, Seto S, Tsukazaki T, Kikuchi H, Yamashita S, Yano K. Norepinephrine enhances fibrosis mediated by TGF-beta in cardiac fibroblasts. Hypertension 40: 148–154, 2002.[Abstract/Free Full Text]
  2. Ambrosino C, Mace G, Galban S, Fritsch C, Vintersten K, Black E, Gorospe M, Nebreda AR. Negative feedback regulation of MKK6 mRNA stability by p38alpha mitogen-activated protein kinase. Mol Cell Biol 23: 370–381, 2003.[Abstract/Free Full Text]
  3. Aoudjit L, Stanciu M, Li H, Lemay S, Takano T. p38 mitogen-activated protein kinase protects glomerular epithelial cells from complement-mediated cell injury. Am J Physiol Renal Physiol 285: F765–F774, 2003.[Abstract/Free Full Text]
  4. Dai C, Yang J, Liu Y. Transforming growth factor-beta1 potentiates renal tubular epithelial cell death by a mechanism independent of Smad signaling. J Biol Chem 278: 12537–12545, 2003.[Abstract/Free Full Text]
  5. de Graauw M, Tijdens I, Cramer R, Corless S, Timms JF, van de Water B. Heat shock protein 27 is the major differentially phosphorylated protein involved in renal epithelial cellular stress response and controls focal adhesion organization and apoptosis. J Biol Chem 280: 29885–29898, 2005.[Abstract/Free Full Text]
  6. Derijard B, Raingeaud J, Barrett T, Wu IH, Han J, Ulevitch RJ, Davis RJ. Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms. Science 267: 682–685, 1995.[Abstract/Free Full Text]
  7. Dong J, Ramachandiran S, Tikoo K, Jia Z, Lau SS, Monks TJ. EGFR-independent activation of p38 MAPK and EGFR-dependent activation of ERK1/2 are required for ROS-induced renal cell death. Am J Physiol Renal Physiol 287: F1049–F1058, 2004.[Abstract/Free Full Text]
  8. Inoue T, Boyle DL, Corr M, Hammaker D, Davis RJ, Flavell RA, Firestein GS. Mitogen-activated protein kinase kinase 3 is a pivotal pathway regulating p38 activation in inflammatory arthritis. Proc Natl Acad Sci USA 103: 5484–5489, 2006.[Abstract/Free Full Text]
  9. Kang YJ, Seit-Nebi A, Davis RJ, Han J. Multiple activation mechanisms of p38alpha mitogen-activated protein kinase. J Biol Chem 281: 26225–26234, 2006.[Abstract/Free Full Text]
  10. Kipari T, Cailhier JF, Ferenbach D, Watson S, Houlberg K, Walbaum D, Clay S, Savill J, Hughes J. Nitric oxide is an important mediator of renal tubular epithelial cell death in vitro and in murine experimental hydronephrosis. Am J Pathol 169: 388–399, 2006.[Abstract/Free Full Text]
  11. Koshikawa M, Mukoyama M, Mori K, Suganami T, Sawai K, Yoshioka T, Nagae T, Yokoi H, Kawachi H, Shimizu F, Sugawara A, Nakao K. Role of p38 mitogen-activated protein kinase activation in podocyte injury and proteinuria in experimental nephrotic syndrome. J Am Soc Nephrol 16: 2690–2701, 2005.[Abstract/Free Full Text]
  12. Kyriakis JM, Avruch J. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 81: 807–869, 2001.[Abstract/Free Full Text]
  13. Lu HT, Yang DD, Wysk M, Gatti E, Mellman I, Davis RJ, Flavell RA. Defective IL-12 production in mitogen-activated protein (MAP) kinase kinase 3 (Mkk3)-deficient mice. EMBO J 18: 1845–1857, 1999.[CrossRef][Web of Science][Medline]
  14. Masamune A, Satoh M, Kikuta K, Sakai Y, Satoh A, Shimosegawa T. Inhibition of p38 mitogen-activated protein kinase blocks activation of rat pancreatic stellate cells. J Pharmacol Exp Ther 304: 8–14, 2003.[Abstract/Free Full Text]
  15. Meyer-Ter-Vehn T, Gebhardt S, Sebald W, Buttmann M, Grehn F, Schlunck G, Knaus P. p38 inhibitors prevent TGF-beta-induced myofibroblast transdifferentiation in human tenon fibroblasts. Invest Ophthalmol Vis Sci 47: 1500–1509, 2006.[Abstract/Free Full Text]
  16. Misseri R, Meldrum DR, Dagher P, Hile K, Rink RC, Meldrum KK. Unilateral ureteral obstruction induces renal tubular cell production of tumor necrosis factor-alpha independent of inflammatory cell infiltration. J Urol 172: 1595–1599, 2004.[CrossRef][Web of Science][Medline]
  17. Misseri R, Meldrum DR, Dinarello CA, Dagher P, Hile KL, Rink RC, Meldrum KK. TNF-{alpha} mediates obstruction-induced renal tubular cell apoptosis and proapoptotic signaling. Am J Physiol Renal Physiol 288: F406–F411, 2005.[Abstract/Free Full Text]
  18. Miyajima A, Chen J, Lawrence C, Ledbetter S, Soslow RA, Stern J, Jha S, Pigato J, Lemer ML, Poppas DP, Vaughan ED, Felsen D. Antibody to transforming growth factor-beta ameliorates tubular apoptosis in unilateral ureteral obstruction. Kidney Int 58: 2301–2313, 2000.[CrossRef][Web of Science][Medline]
  19. Nguyen HT, Hsieh MH, Gaborro A, Tinloy B, Phillips C, Adam RM. JNK/SAPK and p38 SAPK-2 mediate mechanical stretch-induced apoptosis via caspase-3 and -9 in NRK-52E renal epithelial cells. Nephron Exp Nephrol 102: e49–61, 2006.[CrossRef][Medline]
  20. Ohashi R, Nakagawa T, Watanabe S, Kanellis J, Almirez RG, Schreiner GF, Johnson RJ. Inhibition of p38 mitogen-activated protein kinase augments progression of remnant kidney model by activating the ERK pathway. Am J Pathol 164: 477–485, 2004.[Abstract/Free Full Text]
  21. Rodriguez-Barbero A, Obreo J, Yuste L, Montero JC, Rodriguez-Pena A, Pandiella A, Bernabeu C, Lopez-Novoa JM. Transforming growth factor-beta1 induces collagen synthesis and accumulation via p38 mitogen-activated protein kinase (MAPK) pathway in cultured L(6)E(9) myoblasts. FEBS Lett 513: 282–288, 2002.[CrossRef][Web of Science][Medline]
  22. Stambe C, Atkins RC, Tesch GH, Kapoun AM, Hill PA, Schreiner GF, Nikolic-Paterson DJ. Blockade of p38alpha MAPK ameliorates acute inflammatory renal injury in rat anti-GBM glomerulonephritis. J Am Soc Nephrol 14: 338–351, 2003.[Abstract/Free Full Text]
  23. Stambe C, Atkins RC, Tesch GH, Masaki T, Schreiner GF, Nikolic-Paterson DJ. The role of p38alpha mitogen-activated protein kinase activation in renal fibrosis. J Am Soc Nephrol 15: 370–379, 2004.[Abstract/Free Full Text]
  24. Stambe C, Nikolic-Paterson DJ, Hill PA, Dowling J, Atkins RC. p38 Mitogen-activated protein kinase activation and cell localization in human glomerulonephritis: correlation with renal injury. J Am Soc Nephrol 15: 326–336, 2004.[Abstract/Free Full Text]
  25. Sunami R, Sugiyama H, Wang DH, Kobayashi M, Maeshima Y, Yamasaki Y, Masuoka N, Ogawa N, Kira S, Makino H. Acatalasemia sensitizes renal tubular epithelial cells to apoptosis and exacerbates renal fibrosis after unilateral ureteral obstruction. Am J Physiol Renal Physiol 286: F1030–F1038, 2004.[Abstract/Free Full Text]
  26. Tamura K, Sudo T, Senftleben U, Dadak AM, Johnson R, Karin M. Requirement for p38alpha in erythropoietin expression: a role for stress kinases in erythropoiesis. Cell 102: 221–231, 2000.[CrossRef][Web of Science][Medline]
  27. Tanno M, Bassi R, Gorog DA, Saurin AT, Jiang J, Heads RJ, Martin JL, Davis RJ, Flavell RA, Marber MS. Diverse mechanisms of myocardial p38 mitogen-activated protein kinase activation: evidence for MKK-independent activation by a TAB1-associated mechanism contributing to injury during myocardial ischemia. Circ Res 93: 254–261, 2003.[Abstract/Free Full Text]
  28. Wada T, Furuichi K, Sakai N, Hisada Y, Kobayashi K, Mukaida N, Tomosugi N, Matsushima K, Yokoyama H. Involvement of p38 mitogen-activated protein kinase followed by chemokine expression in crescentic glomerulonephritis. Am J Kidney Dis 38: 1169–1177, 2001.[Web of Science][Medline]
  29. Wada T, Furuichi K, Sakai N, Iwata Y, Kitagawa K, Ishida Y, Kondo T, Hashimoto H, Ishiwata Y, Mukaida N, Tomosugi N, Matsushima K, Egashira K, Yokoyama H. Gene therapy via blockade of monocyte chemoattractant protein-1 for renal fibrosis. J Am Soc Nephrol 15: 940–948, 2004.[Abstract/Free Full Text]
  30. Wang L, Ma R, Flavell RA, Choi ME. Requirement of mitogen-activated protein kinase kinase 3 (MKK3) for activation of p38alpha and p38delta MAPK isoforms by TGF-beta 1 in murine mesangial cells. J Biol Chem 277: 47257–47262, 2002.[Abstract/Free Full Text]
  31. Wysk M, Yang DD, Lu HT, Flavell RA, Davis RJ. Requirement of mitogen-activated protein kinase kinase 3 (MKK3) for tumor necrosis factor-induced cytokine expression. Proc Natl Acad Sci USA 96: 3763–3768, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Nephrol Dial TransplantHome page
M. Nishida, Y. Okumura, H. Sato, and K. Hamaoka
Delayed inhibition of p38 mitogen-activated protein kinase ameliorates renal fibrosis in obstructive nephropathy
Nephrol. Dial. Transplant., August 1, 2008; 23(8): 2520 - 2524.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/F1556    most recent
00010.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, F. Y.
Right arrow Articles by Nikolic-Paterson, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, F. Y.
Right arrow Articles by Nikolic-Paterson, D. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.