AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 294: F130-F138, 2008. First published October 24, 2007; doi:10.1152/ajprenal.00406.2007
0363-6127/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/1/F130    most recent
00406.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paunescu, T. G.
Right arrow Articles by Brown, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paunescu, T. G.
Right arrow Articles by Brown, D.

Association of soluble adenylyl cyclase with the V-ATPase in renal epithelial cells

Teodor G. Paunescu, Nicolas Da Silva, Leileata M. Russo, Mary McKee, Hua A. J. Lu, Sylvie Breton, and Dennis Brown

Center for Systems Biology, Program in Membrane Biology and Division of Nephrology, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts

Submitted 31 August 2007 ; accepted in final form 23 October 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Activation of soluble adenylyl cyclase (sAC) by bicarbonate causes local cAMP generation, indicating that sAC might act as a pH and/or bicarbonate sensor in kidney cells involved in acid-base homeostasis. Therefore, we examined the expression of sAC in renal acid-base transporting intercalated cells (IC) and compared its distribution to that of the vacuolar proton pumping ATPase (V-ATPase) under different conditions. In all IC, sAC and V-ATPase showed considerable overlap under basal conditions, but sAC staining was also found in other cellular locations in the absence of V-ATPase. In type A-IC, both sAC and V-ATPase were apically and subapically located, whereas in type B-IC, significant basolateral colocalization of sAC and the V-ATPase was seen. When apical membrane insertion of the V-ATPase was stimulated by treatment of rats with acetazolamide, sAC was also concentrated in the apical membrane of A-IC. In mice that lack a functional B1 subunit of the V-ATPase, sAC was colocalized apically in A-IC along with V-ATPase containing the alternative B2 subunit isoform. The close association between these two enzymes was confirmed by coimmunoprecipitation of sAC from kidney homogenates using anti-V-ATPase antibodies. Our data show that sAC and the V-ATPase colocalize in IC, that they are concentrated in the IC plasma membrane under conditions that "activate" these proton secretory cells, and that they are both present in an immunoprecipitated complex. This suggests that these enzymes have a close association and could be part of a protein complex that is involved in regulating renal distal proton secretion.

proton pump; kidney; intercalated cells; acid-base homeostasis


A MAJOR UNRESOLVED ISSUE in renal physiology is how extracellular acid-base status is sensed by renal epithelial cells to initiate their homeostatic response to such stimuli. Among the factors that have been suggested are, not surprisingly, pH, CO2, and bicarbonate as well as a number of potential hormonal stimuli (48). Early elegant studies showed that basolateral CO2 elevation, together with an initial increase in calcium, is an important stimulus for inducing proton secretion by the proximal tubule and collecting ducts (42, 47). This occurs at least in part by inducing the apical accumulation of the vacuolar proton pumping ATPase (V-ATPase) in these cell types. Our previous work using epididymal proton-secreting cells as a model system provided strong evidence that bicarbonate plays a central role in this process via its stimulatory effect on the generation of cAMP by the soluble adenylyl cyclase (sAC) (35).

Intracellular cAMP levels are modulated by enzymes that synthesize cAMP [adenylyl cyclases (ACs)] and those that degrade it (cAMP phosphodiesterases). Mammalian cells express two distinct classes of ACs: the well-known transmembrane ACs (tmACs) (46) and the so-called sAC (6, 18, 53). sAC has no predicted transmembrane domains but, despite its name, is mostly found associated with particulate fractions in cell homogenates. sAC is insensitive to tmAC regulators such as forskolin and heterotrimeric G proteins but is, instead, activated directly by bicarbonate ions, although calcium can further modify its bicarbonate-stimulated activity (18, 23, 26, 30). sAC is, therefore, a potential sensor for monitoring acid-base status by responding to intracellular bicarbonate concentration, a hypothesis that is strongly supported by our own published data (35). In proton-secreting clear cells of the epididymis, V-ATPase recycling was found to be highly dependent on luminal bicarbonate; sAC-mediated increases in intracellular cAMP levels produced an accumulation of apical membrane V-ATPase (35). Furthermore, sAC could also potentially act as a CO2 sensor, because an increase in CO2 levels entering the cell would produce bicarbonate via the action of cytosolic carbonic anhydrases (53). Indeed, sAC has recently been associated with CO2 sensing in fungi and bacteria (27, 33). Whether sAC is a sensor that is involved in the response of renal epithelial cells to systemic acid-base status remains unknown.

We previously provided preliminary evidence that sAC is expressed in many segments of the kidney tubule, including thick ascending limbs of Henle and collecting ducts (35). These findings are consistent with the bicarbonate-stimulated AC activity previously described in rat kidney (32). Importantly, high levels of V-ATPase are also found in most of these cell types, both on intracellular vesicles and associated with the plasma membrane (13, 36, 48). Our prior findings relating sAC activity to epididymal proton secretion prompted us to evaluate the potential relationship between these enzymes in the kidney, with the hypothesis that the sAC-regulated cAMP signaling pathway may constitute a general sensing mechanism for regulating V-ATPase-mediated proton transport. Indeed, sAC is also present in the choroid plexus, another tissue involved in acid-base regulation (18). Our present results showing that sAC and the V-ATPase are colocalized in renal epithelial cells, are both concentrated at the plasma membrane of intercalated cells (IC) under conditions that are believed to stimulate proton secretion, and are present in an immunoprecipitated complex are consistent with the idea that they may closely interact to regulate proton secretion by renal collecting duct IC.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Antibodies

To determine sAC expression and localization in the rodent kidney, we used a previously described monoclonal antibody raised against the NH2-terminal catalytic regions of the enzyme (35, 53), kindly provided by Drs. L. Levin and J. Buck (Cornell Univ. Medical School, New York). Several antibodies against various V-ATPase subunits were used to assess coexpression of sAC with V-ATPase: affinity-purified rabbit polyclonal antibodies, each raised against a synthetic peptide corresponding to the COOH-terminal region of mouse ATP6V1A (the V-ATPase 70-kDa "A" subunit), ATP6V1B1 (the V-ATPase 56-kDa "B1" subunit isoform), and ATP6V1B2 (the "B2" isoform), as previously described (2, 10, 22, 36, 38). Affinity-purified chicken antibodies were raised against synthetic peptides corresponding to the COOH-terminal region of ATP6V1E1 (the revised nomenclature for the ubiquitous V-ATPase 31-kDa "E" isoform) (10, 44) and ATP6V1B2 using the same peptide as for the rabbit anti-B2 antibody (19, 36).

To identify collecting duct A (A-IC)- and B-type IC (B-IC), an anti-AE1 anion exchanger affinity-purified rabbit polyclonal antibody was used (1, 7), kindly provided by Dr. S. Alper (Beth Israel Deaconess Medical Center, Boston) and an affinity-purified anti-pendrin rabbit polyclonal antibody (40) generously provided by Dr. I. E. Royaux (National Human Genome Research Institute, National Institutes of Health).

The following affinity-purified secondary antibodies were used: Alexa Fluor 488 goat anti-mouse IgG (H+L; Invitrogen, Carlsbad, CA) at a final concentration of 20 µg/ml, Alexa Fluor 594 goat anti-rabbit IgG (H+L; Invitrogen) at 2.5 µg/ml, indocarbocyanine (Cy3)-conjugated donkey anti-mouse IgG (H+L) at 1.75 µg/ml (Jackson ImmunoResearch Laboratories, West Grove, PA), fluorescein isothiocyanate (FITC)-conjugated donkey anti-rabbit IgG (H+L) at 1.75 µg/ml (Jackson ImmunoResearch Laboratories), and Cy3-conjugated donkey anti-chicken IgY (H+L) at 1.5 µg/ml (Jackson ImmunoResearch Laboratories).

Tissue Preparation

Adult male Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) and adult male mice, wild-type (Atp6v1b1+/+; C57BL6, Jackson Laboratory, Bar Harbor, ME) and B1 V-ATPase-deficient (Atp6v1b1–/–), were housed under standard conditions and maintained on a standard rodent diet. Generation and breeding of Atp6v1b1–/– mice have been described elsewhere; mice were genotyped by PCR as described previously (20). Some kidney tissue from rats treated for 28 days with the carbonic anhydrase inhibitor acetazolamide (15 mg·kg–1·day–1) was also processed for immunostaining. These tissues were from rats used in our prior study, in which acetazolamide was delivered by osmotic minipump infusion (2). All animal studies were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care, in accordance with National Institutes of Health, Department of Agriculture, and American Association for Accreditation of Laboratory Animal Care requirements.

For immunofluorescence experiments, animals were anesthetized using pentobarbital sodium (50 mg/kg body wt ip; Nembutal, Abbott Laboratories, North Chicago, IL) and perfused through the left cardiac ventricle with PBS (0.9% NaCl in 10 mM phosphate buffer, pH 7.4), followed by paraformaldehyde-lysine-periodate fixative (PLP) as described previously (36). Both kidneys were dissected, sliced, and further fixed by immersion in PLP for 4 h at room temperature and subsequently overnight at 4°C, and then rinsed extensively in PBS, and stored at 4°C in PBS containing 0.02% sodium azide until use.

Immunofluorescence and Confocal Microscopy

PLP-fixed kidney slices prepared as described above were cryoprotected in PBS containing 0.9 M sucrose overnight at 4°C and then embedded in Tissue-Tek OCT compound 4583 (Sakura Finetek USA, Torrance, CA), mounted on a specimen disk, and frozen at –20°C. Four-micrometer sections were cut on a Leica CM3050 S cryostat (Leica Microsystems, Bannockburn, IL), collected onto Superfrost Plus precleaned, charged microscope slides (Fisher Scientific, Pittsburgh, PA), air-dried, and stored at 4°C until use.

Sections were rehydrated in PBS and treated with 1% (wt/vol) SDS for 4 min for retrieval of antigenic sites, as previously described (14). After being washed 3 x 5 min in PBS and incubated for 10 min in 1% (wt/vol) bovine serum albumin in PBS with 0.02% sodium azide to minimize nonspecific staining, the sections were incubated for 90 min with the primary antibody diluted in Dako antibody diluent (Dako, Carpinteria, CA) and then with the secondary antibody for 1 h at room temperature. Slides were rinsed in high-salt (2.7% NaCl) PBS for 5 min and 2 x 5 min in regular PBS (0.9% NaCl) after each antibody incubation. For dual immunostaining, this protocol was repeated for the second primary antibody, followed by the appropriate secondary antibody. Slides were mounted in Vectashield medium (Vector Laboratories, Burlingame, CA) for microscopy and image acquisition. Control incubations confirmed that the secondary anti-mouse IgG reagents did not cross-react with rabbit anti-V-ATPase primary antibodies and, conversely, that the anti-rabbit IgG secondary antibodies did not cross-react with monoclonal mouse primary antibodies.

Digital images were acquired as described previously (36), using a Nikon Eclipse 800 epifluorescence microscope (Nikon Instruments, Melville, NY) equipped with an Orca 100 CCD camera (Hamamatsu, Bridgewater, NJ). Confocal laser-scanning microscopy imaging was performed on a Zeiss (formerly BioRad) Radiance 2000 confocal microscopy system (Carl Zeiss Microimaging, Thornwood, NY) using LaserSharp 2000 version 4.1 software. Epifluorescence and confocal images were analyzed using IPLab version 3.2.4 image processing software (Scanalytics, Fairfax, VA) and imported into Adobe Photoshop version CS2 image-editing software (Adobe Systems, San Jose, CA) for production of the final figures.

Immunogold Electron Microscopy

Sections of PLP-fixed mouse or rat kidney were prepared and immunostained either after embedding at low temperature in Lowicryl HM20 resin (Electron Microscopy Sciences, Hatfield, PA) or after ultrathin cryosectioning of frozen sections, as previously described (11). Sections were incubated on drops of primary anti-sAC monoclonal antibody diluted in Dako antibody diluent for 2 h at room temperature. After being rinsed on PBS drops, the grids were incubated on drops of goat anti-mouse IgG coupled to 10- or 15-nm gold particles (Ted Pella, Redding, CA) for 1 h at room temperature. For double immunostaining, grids were washed on drops of distilled water and then transferred to PBS and subsequently incubated as above on drops of chicken anti-B2 V-ATPase followed by rabbit anti-chicken IgG secondary antibody coupled to 10- or 15-nm gold particles or rabbit anti-V-ATPase A subunit followed by anti-rabbit IgG coupled to 15-nm gold (Ted Pella). Sections were examined in a JEM-1011 transmission electron microscope (JEOL, Tokyo, Japan) at 80 kV, and images acquired using an AMT XR60 digital imaging system (Advanced Microscopy Techniques, Danvers, MA) were subsequently imported into Adobe Photoshop CS2.

Protein Extraction from Kidneys

Freshly isolated rat kidneys were cut into smaller pieces and disrupted with a Tenbroeck tissue grinder in homogenization buffer (320 mM sucrose, 10 mM HEPES, pH 7.5, 1 mM EGTA, 0.1 mM EDTA, and complete protease inhibitors from Roche Applied Science, Indianapolis, IN). Homogenates were centrifuged for 10 min at 1,000 g at 4°C. Triton X-100 was added to the supernatants to a final concentration of 1%. After a second homogenization, DTT was added to a final concentration of 1 mM. Homogenates were centrifuged for 30 min at 16,000 g at 4°C and supernatants were collected. The protein concentration was determined with the bicinchoninic acid protein assay (Pierce Biotechnology, Rockford, IL) using albumin as standard. Protein extracts were aliquoted and stored at –80°C. For direct Western blotting, 50 µg of protein were diluted in Laemmli reducing sample buffer, boiled for 5 min, and loaded onto Tris-glycine polyacrylamide 4–20% gradient gels (Lonza, Rockland, ME).

Immunoprecipitation of sAC and V-ATPase from Kidney

One milligram of kidney extract prepared as above was incubated overnight at 4°C with 5 µg of rabbit antibody raised against the B1 subunit of the V-ATPase, in a buffer containing 10 mM HEPES, pH 7.5, 100 mM KCl, 2 mM MgCl2, 2 mM CaCl2, and complete protease inhibitors. Fifty microliters of Dynabeads Protein A (Invitrogen) were added. After 2 h of incubation at 4°C, proteins bound to the beads were recovered using a magnetic particle concentrator. Beads were washed four times in the immunoprecipitation buffer containing 0.5% Triton X-100, resuspended in 45 µl of Laemmli reducing sample buffer, and boiled for 5 min. After a brief centrifugation, supernatants were loaded onto a Tris-glycine polyacrylamide 4–20% gradient gel (Lonza), and separated proteins were transferred onto an Immun-Blot PVDF membrane (Bio-Rad, Hercules, CA). Membranes were blocked in Tris-buffered saline (TBS) with 5% nonfat dry milk and then incubated overnight at 4°C with the mouse anti-sAC antibody or a rabbit anti-V-ATPase A subunit antibody diluted in TBS with 2.5% milk. After four washes in TBS with 0.1% Tween 20, membranes were incubated with a donkey anti-mouse or anti-rabbit antibody conjugated to horseradish peroxidase (Jackson) for 1 h at room temperature. After four further washes, antibody binding was detected with the Western Lightning chemiluminescence reagent (Perkin Elmer Life Sciences, Boston, MA).

Total RNA Extraction, Reverse-Transcription, and Polymerase Chain Reaction

Kidneys from three wild-type and three B1-deficient (Atp6v1b1–/–) mice were dissected and disrupted immediately in RLT lysis buffer (Qiagen, Valencia, CA) with 10 µl/ml β-mercaptoethanol. Total RNA was isolated using the Qiagen RNeasy Mini kit, and genomic DNA contamination was removed by on-column incubation with 25 units DNase I for 30 min at room temperature. DNA-free RNA was reverse transcribed (RT) and polymerase chain reaction (PCR) was performed with 2 µl of RT products as templates. The sequences of the oligonucleotide primers flanking exon 11 were: MSAC-F2: cagatcctggacccgtgtat; MSAC-R2: gctgcagttcgtcatcaaaa. The amplicon sizes are 167 bp (full-length sAC) and 111 bp (truncated sAC) (18, 23, 53). See GoGoGoGoGoGoGoGoGoFig. 10 for an explanation of how two different amplicon sizes are generated using these primers. PCR products were analyzed by electrophoresis on a 2.5% agarose gel containing GelStar stain (Lonza). No template controls (NTC) were performed by omitting cDNA template from the PCR amplification. Primers were synthesized by Sigma-Genosys (The Woodlands, TX).


Figure 1
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 1. Colocalization of soluble adenylyl cyclase (sAC) with the vacuolar proton pumping ATPase (V-ATPase; B1 subunit) in cryostat section of normal rat kidney cortex. In A-intercalated cells (IC; arrowheads), sAC staining (A) is concentrated at the apical pole, and basolateral staining is considerably weaker. In B-IC (arrows), both the apical and basolateral poles show a similar, high level of staining. B: staining for the B1 V-ATPase subunit. In intercalated cells, B1 staining shows considerable overlap with sAC staining in both A-IC (arrowheads) and B-IC (arrows). C: merged image. sAC also shows a variable level of expression in other cell types including principal cells of the collecting duct which are B1 negative, and adjacent proximal tubules which are also B1 negative. Bar = 10 µm.

 

Figure 2
View larger version (106K):
[in this window]
[in a new window]

 
Fig. 2. Distribution of sAC in A- and B-IC in rat kidney cortex. sAC is concentrated apically in an A-IC (*; A), identified in B by strong basolateral AE1 staining (*). C: merged image of A and B clearly illustrating the opposite polarities of sAC (apical) and AE1 (basolateral) in A-ICs. In the adjacent AE1-negative B-IC (arrow) in AC, sAC has a bipolar distribution. DF: B-IC (arrow) with bipolar sAC staining (D) is positively identified by strong apical pendrin staining (E). In this pendrin-positive cell, the sAC staining overlaps with pendrin at the apical pole (merged image; F). Bar = 5 µm.

 

Figure 3
View larger version (141K):
[in this window]
[in a new window]

 
Fig. 3. Immunogold electron microscopy on Lowicryl HM20-embedded tissue showing apical localization of sAC in A-IC from rat (A) and mouse (B) cortical collecting ducts. sAC is located in the apical microvilli of these cells (arrows), as well as in the subapical cytoplasm. Bar = 0.25 µm.

 

Figure 4
View larger version (154K):
[in this window]
[in a new window]

 
Fig. 4. Immunogold electron microscopy on Lowicryl HM20-embedded tissue showing a B-IC from a mouse cortical collecting duct stained for sAC. In this cell type, sAC is located both in the apical pole and the basolateral pole of the cell, confirming the bipolar localization in B-IC shown by immunofluorescence in Figs. 1 and 2. Insets: taken from the regions indicated with double arrows show apical and basolateral localization of gold particles in more detail. Top inset, right: note that the adjacent principal cell (PC) shows less apical gold particle labeling than the B-IC. Arrow in top inset indicates position of tight junction between IC and PC. Bar = 1 µm (insets: bar = 0.5 µm).

 

Figure 5
View larger version (132K):
[in this window]
[in a new window]

 
Fig. 5. Immunogold electron microscopy (HM20-embedded tissue) showing distribution of sAC and the V-ATPase A subunit in apical domain of A-IC from rat cortical collecting duct (A) and the basolateral domain of a B-IC (B). The A subunit of the V-ATPase is labeled with the larger gold particles (15 nm) and sAC is labeled with smaller gold particles (10 nm). Both sAC and the V-ATPase are associated with apical microvilli and the subapical cytoplasm in A and with basolateral membrane infoldings in B. sAC immunogold labeling is consistently weaker (less efficient) than the V-ATPase staining, but despite this, some close association of both small and large gold particles is detectable. Bar = 0.25 µm.

 

Figure 6
View larger version (79K):
[in this window]
[in a new window]

 
Fig. 6. Apical localization of sAC in collecting duct A-IC from an acetazolamide-treated rat kidney (outer stripe of outer medulla). sAC (A; red) is concentrated in the apical domain of A-IC, where the E subunit of the V-ATPase (B; green) is also located (arrows). The apical sAC staining appears more diffuse in some cells than the narrower apical band of V-ATPase staining, indicating that, as expected, not all sAC colocalizes tightly with the V-ATPase. Bar = 5 µm.

 

Figure 7
View larger version (57K):
[in this window]
[in a new window]

 
Fig. 7. Section of a collecting duct from the outer medulla of a B1-deficient mouse kidney showing tight apical colocalization of sAC (A) and the V-ATPase (B; B2 subunit isoform) in IC from these animals (arrows). These data show that the B1 subunit of the V-ATPase is not required for sAC and the V-ATPase to colocalize at the apical pole of A-IC. Bar = 5 µm.

 

Figure 8
View larger version (111K):
[in this window]
[in a new window]

 
Fig. 8. Immunogold electron microscopy on ultrathin frozen section showing the apical region of an A-IC from a V-ATPase-B1-deficient mouse. The section was double stained to detect the V-ATPase B2 subunit (10-nm gold particles) and sAC (15-nm particles). Both proteins are concentrated in the apical domain of this cell and are often closely associated in apical microvilli. Inset: area of the apical domain in which small and large gold particles form a tight cluster, illustrating the location of both sAC and the B2-V-ATPase subunit in the same membrane microdomains. Bar = 0.25 µm.

 

Figure 9
View larger version (49K):
[in this window]
[in a new window]

 
Fig. 9. A: Western blot showing coimmunoprecipitation of the 50-kDa sAC variant with the V-ATPase using antibodies against the B1 subunit isoform as the immunoprecipitation (IP) antibody from rat kidney homogenate (B1 IP). The sAC 50-kDa variant is not detectable in the control lane (Con IP) from which the primary B1 antibody was omitted during the IP step but is present in the whole kidney supernatant (Kid Sup) before the IP procedure. A higher molecular weight nonspecific band of unknown nature is also present in both IP samples but is absent from the kidney supernatant lane. B: another Western blot of the immunoprecipitated material probed with an antibody against the 70-kDa "A" subunit of the V-ATPase, confirming that the V-ATPase is present in the IP.

 

Figure 10
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 10. PCR from whole kidney homogenates showing the presence of sAC in samples from both normal (WT) and B1-deficient (B1-KO) mice. The PCR products of 167 and 111 bp are as predicted from the design of the primers (arrows) spanning exon 11 (shaded box) of the mouse sAC sequence (GenBank NM_173029). The 111-bp PCR corresponds to the transcript that lacks the 56-bp exon and encodes the 50-kDa sAC isoform, which was detected by Western blotting in the kidney. The exon 11 deletion results in a frameshift that generates a premature TAG stop codon (underlined and indicated by a small arrow), that is responsible for the production of the 50-kDa sAC isoform.

 

    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
sAC Colocalizes with the V-ATPase in IC

As previously described, sAC was detectable in several epithelial cell types in the kidney (35). It was strongly expressed in collecting duct IC, as identified by their abundant V-ATPase expression detected using an antibody against the B1 subunit (Fig. 1). sAC is also variably expressed in B1-negative principal cells, in which both intracellular and apparent plasma membrane staining was detectable. Partial colocalization of sAC and the V-ATPase was seen in all IC, but distinct patterns of overlapping staining were obvious in different IC subpopulations. In some IC, sAC and B1 staining were concentrated toward the apical pole of the cell, whereas other IC showed marked apical and basolateral staining for both proteins. A-IC and B-IC were positively identified using antibodies against AE1 (an A-IC marker) and pendrin (a B-IC marker). sAC was concentrated in the apical pole of AE1-positive A-IC (Fig. 2, AC), whereas it had a bipolar distribution in pendrin-positive B-IC (Fig. 2, DF). Both pendrin and sAC were colocalized at the apical pole of these B-IC.

By immunogold electron microscopy, sAC was localized in the apical domain of A-IC, both in apical microvilli and in the apical cytoplasmic region in rat (Fig. 3A) and mouse (Fig. 3B) collecting ducts. The basolateral domain of A-IC, identified by staining with anti-AE1 antibodies, showed only very weak or no staining for sAC (data not shown), consistent with the low level of immunofluorescence staining for sAC seen in this cell type. In B-IC from cortical collecting ducts, sAC was present in both the apical and basolateral pole of the cell (Fig. 4), as also seen by immunofluorescence microscopy. In tissues from control rats, sAC was partially colocalized with the V-ATPase (A subunit) at the apical plasma membrane of A-IC (Fig. 5A) and in the basolateral membrane of B-IC (Fig. 5B). Using the immunogold technique, staining for sAC was consistently weaker than the very strong V-ATPase labeling.

Distribution of sAC Upon "Stimulation" of A-type IC

The distribution of sAC was next examined under conditions in which A-IC have been reported previously to have a tight apical band of V-ATPase immunostaining, presumably reflecting an activated state of proton secretion.

Acetazolamide-treated rats. Acetazolamide treatment results in a transient metabolic acidosis by inhibiting proximal bicarbonate reabsorption. In these rats, bicarbonate delivery to the apical pole of collecting duct epithelial cells is increased. We previously showed that in acetazolamide-treated rats, the number of A-IC with tight apical V-ATPase staining is significantly increased in the collecting duct and that the number of B-IC is greatly reduced (2). After 4 wk of acetazolamide treatment, B-IC were rarely found in the cortical collecting duct. In acetazolamide-treated rats, sAC is concentrated at the apical pole of many IC, along with the E subunit of the V-ATPase (Fig. 6). However, while apical colocalization was apparent, the sAC staining in some IC had a more diffuse distribution that extended deeper into the cytoplasm than the tight apical V-ATPase staining. Identical images were obtained with anti-B1 and B2 subunit antibodies (not shown). sAC is also present in adjacent principal cells, which are poorly stained with the anti-E subunit antibody, but expression was lower than in the V-ATPase-positive IC.

Mice that lack the V-ATPase B1 subunit isoform (Atp6vb1–/– mice). We previously reported that B1-deficient mice compensate for the loss of the V-ATPase B1 subunit by inserting V-ATPase containing the alternative B2 subunit into the apical plasma membrane of A-IC in medullary collecting ducts and in epididymal clear cells (19, 20, 37). This allows them to partially compensate for the loss of B1 by maintaining proton secretion in some A-IC. In these mice, sAC is apically colocalized with the V-ATPase in medullary A-IC, as illustrated in sections that were double stained with sAC and the B2 subunit of the V-ATPase (Fig. 7). The tight relationship between sAC and the V-ATPase was confirmed by immunogold electron microscopy in ultrathin cryostat sections in IC from Atp6v1b1–/– mice where both proteins were colocalized on or close to the apical plasma membrane (Fig. 8). These data show that colocalization of sAC with the V-ATPase does not require the B1 isoform, since sAC is apically located also in mice that lack this B1 subunit.

sAC Coimmunoprecipitates With the V-ATPase

The partial overlap between sAC and V-ATPase localization in renal IC suggested a close association between the two enzymes. Whole rat kidney tissue homogenates were, therefore, subjected to coimmunoprecipitation using a polyclonal antibody against the B1 subunit of the V-ATPase. The immunoprecipitated complex contained abundant sAC (Fig. 9A), as well as the A subunit of the V-ATPase (Fig. 9B), which closely interacts with the B subunit in the native enzyme. The sAC that was identified in the kidney was a 50-kDa splice variant of the protein, which is the major functional sAC variant in many tissues (16, 26). RT-PCR using primers spanning exon 11 (whose deletion results in a frameshift that generates a premature TAG stop codon to produce a 50-kDa sAC protein) generated a predicted product of ~111 bp from the wild-type and B1-deficient mouse kidney, corresponding to a sequence from the 50-kDa sAC isoform. However, a 167-bp product was also produced, indicating that mRNA coding for full-length sAC is also expressed in the kidney (Fig. 10).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
sAC is a bicarbonate-stimulated enzyme that is expressed in many cell types, where it participates in signal transduction events that are proposed to result in the localized generation of cAMP (26, 53). Full-length sAC is a predicted 187-kDa protein, but a 50-kDa protein containing the NH2-terminal catalytic domain of sAC is also highly expressed in many tissues, including the kidney, and retains catalytic activity (18, 26, 35). A similar truncated functional splice variant has also been described in the testis (16, 24). Furthermore, additional splice variants have been reported in human kidney and other tissues (21). In this study, we detected only the 50-kDa form of sAC protein in the kidney but, interestingly, mRNAs encoding both full-length and the short sAC isoforms are present. Understanding the regulation of sAC isoform expression in the kidney and other tissues is the subject of ongoing work. In renal IC, which are involved in distal acid-base regulation by the kidney, the intracellular localization of sAC shows considerable (but not complete) overlap with that of the V-ATPase both under baseline conditions, and under conditions in which an increase in V-ATPase cell surface expression is induced in IC. The presence of sAC in a protein complex that is immunoprecipitated using an anti-V-ATPase antibody provides further evidence in favor of a close association between these two enzymes.

Various experimental conditions stimulate distal proton secretion by the kidney, and this results primarily from increased V-ATPase levels in the apical plasma membrane of A-IC. It has been clearly shown that under conditions such as systemic metabolic acidosis (4, 31, 41), increased basolateral CO2 in vitro (42), and acetazolamide treatment (2), the V-ATPase accumulates in the apical pole of these cells (12, 48). This response is also calcium dependent (47), involves SNARE proteins (3, 8, 34), microtubules (15), and the actin cytoskeleton (5, 17). However, the intracellular signaling mechanism that triggers the membrane accumulation of the V-ATPase remains unknown. In the kidney proximal tubule, apical proton secretion and reabsorption of bicarbonate appear to be regulated by basolateral CO2 and bicarbonate (42, 52), possibly via activation of a receptor tyrosine kinase (51). Interestingly, the tyrosine kinase pyk2 can activate Na+/H+ exchange in cultured cells in response to acidification of the medium (29). Our recent work using proton-secreting cells of the epididymis, known as clear cells, showed that the apical accumulation of V-ATPase in response to luminal bicarbonate and/or an increase in luminal pH is dependent on sAC activity (35). Furthermore, this apical accumulation can be induced by elevating intracellular cAMP, even when the luminal pH is acidic, which normally reduces apical V-ATPase activity. Basolateral CO2 also stimulates apical proton secretion by IC (42) and, as mentioned earlier, sAC could be indirectly activated by elevated CO2 as a result of bicarbonate generation via cytosolic carbonic anhydrase type II, which is highly expressed in IC (12).

In the kidney, apical insertion of the V-ATPase is usually considered to be a physiological response to metabolic or respiratory acidosis (48), but the mechanism by which the acid-base disturbance is sensed by IC is not known. We suggest here that sAC might be one component of the sensing apparatus. In metabolic acidosis that results from a diminished bicarbonate reabsorption by the proximal tubule, increased distal delivery of bicarbonate could result in a stimulation of intercalated cell proton secretion via activation of sAC, and apical mobilization of V-ATPase. Indeed, after inhibition of carbonic anhydrase by acetazolamide, a dramatic increase in apical V-ATPase is seen in IC (2). This is analogous to the situation we previously described in the epididymis, in which an elevation in luminal bicarbonate stimulates apical membrane V-ATPase accumulation (35). IC express the electroneutral sodium bicarbonate cotransporter NBC3 on their apical membrane, through which luminal bicarbonate could enter the cell to activate sAC (28). Apical expression of holoenzymes containing B1 and B2 subunit isoforms occurs in IC after acetazolamide treatment (36), possibly to maximize proton secretion by these cells in the face of inhibition of the proximal bicarbonate reabsorptive mechanism and the resulting increased distal delivery of bicarbonate.

In B1-deficient mice, under normal conditions of ad libitum food and water uptake, acidemia is not detectable, but the urine of these mice is significantly more alkaline than normal controls (20). The medullary A-type IC of these mice show characteristic features of "stimulated" cells, with tight and intense apical membrane expression of V-ATPase holoenzymes that contain the B2 subunit isoform (20, 36, 37). We show here that sAC also has a similar strong apical expression in these animals, indicating that its colocalization with the V-ATPase does not depend on the presence of the B1 isoform that is normally highly expressed in these proton-secreting cells. We proposed that the apical expression of B2-containing holoenzymes in these mice is an "isoform replacement" regulatory response to the lack of the usual B1 subunit. While the activity of the B2-containing enzyme at the plasma membrane is sufficient to maintain systemic pH within the normal range, the alkaline urine pH suggests that this homeostasis is borderline effective, and indeed when challenged with an acid load, B1-deficient mice become severely acidotic (20, 37). However, in B1-deficient mice, the increased accumulation of V-ATPase complexes containing the B2 subunit at the apical plasma membrane of epididymal clear cells is sufficient to allow an acidic luminal pH to be generated in this organ, which is critical for the maintenance of male fertility (9, 19).

It is becoming increasingly understood that local complexes of proteins within cells play an important role in restricting and compartmentalizing a variety of signaling events that lead to physiological responses of cells to various stimuli. These complexes can include sensors and signaling proteins, as well as channels, transporters, or enzymes that elicit the final cellular actions to the stimulus. In the case of sAC, it has been proposed that its association with defined intracellular structures or compartments such as the nucleus and mitochondria allows a more localized cAMP elevation to occur, without affecting the rest of the cell (53). The activity of sAC could also be restricted by phosphodiesterase "barriers" that further limit cAMP diffusion within cells (25, 50, 53). Similar complexes have also been proposed in the case of the aquaporin-2 (AQP2) water channel for example, where PKA, AKAPs, and phosphodiesterases are associated with AQP2-containing vesicles (45). Thus the close association of sAC with the V-ATPase is consistent with the presence of a signaling complex that responds to an increase in bicarbonate to generate cAMP, and ultimately cause membrane accumulation of the enzyme. Intriguingly, NBC3 has also been colocalized at the apical membrane of IC with the V-ATPase in a complex that also contains the PDZ binding protein NHERF (39). However, the association of the V-ATPase with sAC does not seem to depend on a similar PDZ-protein-dependent interaction, because only the B1 subunit isoform contains a COOH-terminal PDZ binding motif (10) and colocalization was seen even in B1-deficient mice. Nevertheless, entry of bicarbonate through NBC3 (or another bicarbonate transporter) would stimulate sAC. The subsequent elevation of cAMP could be associated with protein phosphorylation via PKA, for example, but it remains to be determined whether any V-ATPase subunits can be phosphorylated by PKA. Alternatively, increased cAMP could directly activate exchange proteins known as EPACs, which in turn could regulate the cytoskeleton, a process that we and others showed to be important for V-ATPase trafficking (5, 17). More work will be required to determine whether sAC associates directly or indirectly with the V-ATPase, and how sAC activation results in the plasma membrane accumulation of the enzyme and an increase in apical proton secretion.

Finally, while we propose that sAC might be a bicarbonate sensor that allows IC to respond to acid-base cues via V-ATPase mobilization and/or activation, other pH sensing proteins have been identified that might play complementary roles in the regulation of systemic acid-base balance. For example, the pH-sensitive G protein-coupled receptors known as OGR1 and GPR4 have been identified in the kidney and are poised to respond directly to pH by activating the cAMP/PKA pathway (43, 49). Thus sAC might be one player in a complex but integrated network of protein sensors that together allow IC, in collaboration with other renal tubular segments, to modulate proton secretion and bicarbonate reabsorption by the kidney.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institutes of Health (NIH) Grants DK-42956 (to D. Brown), DK-38452 (to S. Breton and D. Brown), and HD-40793 (to S. Breton), an NIH KO1 award DK-73266 (to T. G. Paunescu), a KO8 award DK-75940 (to H. A. J. Lu), and a grant from the Juvenile Diabetes Foundation (to L. M. Russo). The Microscopy Core Facility of the Program in Membrane Biology received additional support from the Boston Area Diabetes and Endocrinology Research Center (NIH DK-57521) and from the Center for the Study of Inflammatory Bowel Disease (NIH DK-43341).


    ACKNOWLEDGMENTS
 
We thank L. Levin and J. Buck (Cornell University Medical School, NY) for the support of this work by providing the anti-sAC monoclonal antibody and for stimulating discussions.


    FOOTNOTES
 

Address for reprint requests and other correspondence: D. Brown, Program in Membrane Biology/Division of Nephrology, Massachusetts General Hospital, Simches Research Center, Rm. 8202, 185 Cambridge St., Boston, MA 02114 (e-mail: brown{at}receptor.mgh.harvard.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alper SL, Natale J, Gluck S, Lodish HF, Brown D. Subtypes of intercalated cells in rat kidney collecting duct defined by antibodies against erythroid band 3 and renal vacuolar H+-ATPase. Proc Natl Acad Sci USA 86: 5429–5433, 1989.[Abstract/Free Full Text]
  2. Bagnis C, Marshansky V, Breton S, Brown D. Remodeling the cellular profile of collecting ducts by chronic carbonic anhydrase inhibition. Am J Physiol Renal Physiol 280: F437–F448, 2001.[Abstract/Free Full Text]
  3. Banerjee A, Shih T, Alexander EA, Schwartz JH. SNARE proteins regulate H+-ATPase redistribution to the apical membrane in rat renal inner medullary collecting duct cells. J Biol Chem 274: 26518–26522, 1999.[Abstract/Free Full Text]
  4. Bastani B, Purcell H, Hemken P, Trigg D, Gluck S. Expression and distribution of renal vacuolar proton-translocating adenosine triphosphatase in response to chronic acid and alkali loads in the rat. J Clin Invest 88: 126–136, 1991.[Web of Science][Medline]
  5. Beaulieu V, Da Silva N, Pastor-Soler N, Brown CR, Smith PJ, Brown D, Breton S. Modulation of the actin cytoskeleton via gelsolin regulates vacuolar H+-ATPase recycling. J Biol Chem 280: 8452–8463, 2005.[Abstract/Free Full Text]
  6. Braun T, Dods RF. Development of a Mn2+-sensitive, "soluble" adenylate cyclase in rat testis. Proc Natl Acad Sci USA 72: 1097–1101, 1975.[Abstract/Free Full Text]
  7. Breton S, Alper SL, Gluck SL, Sly WS, Barker JE, Brown D. Depletion of intercalated cells from collecting ducts of carbonic anhydrase II-deficient (CAR2 null) mice. Am J Physiol Renal Fluid Electrolyte Physiol 269: F761–F774, 1995.[Abstract/Free Full Text]
  8. Breton S, Nsumu NN, Galli T, Sabolic I, Smith PJ, Brown D. Tetanus toxin-mediated cleavage of cellubrevin inhibits proton secretion in the male reproductive tract. Am J Physiol Renal Physiol 278: F717–F725, 2000.[Abstract/Free Full Text]
  9. Breton S, Smith PJ, Lui B, Brown D. Acidification of the male reproductive tract by a proton pumping H+-ATPase. Nat Med 2: 470–472, 1996.[CrossRef][Web of Science][Medline]
  10. Breton S, Wiederhold T, Marshansky V, Nsumu NN, Ramesh V, Brown D. The B1 subunit of the H+ATPase is a PDZ domain-binding protein. Colocalization with NHE-RF in renal B-intercalated cells. J Biol Chem 275: 18219–18224, 2000.[Abstract/Free Full Text]
  11. Brown D. Analysis of protein expression by immunocytochemistry. In: Gene Probes: A Practical Approach, edited by Hames BD and Higgins S. Oxford: Oxford Univ. Press, 1996, p. 267–311.
  12. Brown D, Breton S. Mitochondria-rich, proton-secreting epithelial cells. J Exp Biol 199: 2345–2358, 1996.[Abstract]
  13. Brown D, Hirsch S, Gluck S. Localization of a proton-pumping ATPase in rat kidney. J Clin Invest 82: 2114–2126, 1988.[Web of Science][Medline]
  14. Brown D, Lydon J, McLaughlin M, Stuart-Tilley A, Tyszkowski R, Alper S. Antigen retrieval in cryostat tissue sections and cultured cells by treatment with sodium dodecyl sulfate (SDS). Histochem Cell Biol 105: 261–267, 1996.[CrossRef][Web of Science][Medline]
  15. Brown D, Sabolic I, Gluck S. Colchicine-induced redistribution of proton pumps in kidney epithelial cells. Kidney Int Suppl 33: S79–S83, 1991.[Medline]
  16. Buck J, Sinclair ML, Schapal L, Cann MJ, Levin LR. Cytosolic adenylyl cyclase defines a unique signaling molecule in mammals. Proc Natl Acad Sci USA 96: 79–84, 1999.[Abstract/Free Full Text]
  17. Chen SH, Bubb MR, Yarmola EG, Zuo J, Jiang J, Lee BS, Lu M, Gluck SL, Hurst IR, Holliday LS. Vacuolar H+-ATPase binding to microfilaments: regulation in response to phosphatidylinositol 3-kinase activity and detailed characterization of the actin-binding site in subunit B. J Biol Chem 279: 7988–7998, 2004.[Abstract/Free Full Text]
  18. Chen Y, Cann MJ, Litvin TN, Iourgenko V, Sinclair ML, Levin LR, Buck J. Soluble adenylyl cyclase as an evolutionarily conserved bicarbonate sensor. Science 289: 625–628, 2000.[Abstract/Free Full Text]
  19. Da Silva N, Shum WW, El-Annan J, Paunescu TG, McKee M, Smith PJ, Brown D, Breton S. Relocalization of the V-ATPase B2 subunit to the apical membrane of epididymal clear cells of mice deficient in the B1 subunit. Am J Physiol Cell Physiol 293: C199–C210, 2007.[Abstract/Free Full Text]
  20. Finberg KE, Wagner CA, Bailey MA, Paunescu TG, Breton S, Brown D, Giebisch G, Geibel JP, Lifton RP. The B1 subunit of the H+-ATPase is required for maximal urinary acidification. Proc Natl Acad Sci USA 102: 13616–13621, 2005.[Abstract/Free Full Text]
  21. Geng W, Wang Z, Zhang J, Reed BY, Pak CY, Moe OW. Cloning and characterization of the human soluble adenylyl cyclase. Am J Physiol Cell Physiol 288: C1305–C1316, 2005.[Abstract/Free Full Text]
  22. Hurtado-Lorenzo A, Skinner M, El Annan J, Futai M, Sun-Wada GH, Bourgoin S, Casanova J, Wildeman A, Bechoua S, Ausiello DA, Brown D, Marshansky V. V-ATPase interacts with ARNO and Arf6 in early endosomes and regulates the protein degradative pathway. Nat Cell Biol 8: 124–136, 2006.[CrossRef][Web of Science][Medline]
  23. Jaiswal BS, Conti M. Calcium regulation of the soluble adenylyl cyclase expressed in mammalian spermatozoa. Proc Natl Acad Sci USA 100: 10676–10681, 2003.[Abstract/Free Full Text]
  24. Jaiswal BS, Conti M. Identification and functional analysis of splice variants of the germ cell soluble adenylyl cyclase. J Biol Chem 276: 31698–31708, 2001.[Abstract/Free Full Text]
  25. Jurevicius J, Fischmeister R. cAMP compartmentation is responsible for a local activation of cardiac Ca2+ channels by beta-adrenergic agonists. Proc Natl Acad Sci USA 93: 295–299, 1996.[Abstract/Free Full Text]
  26. Kamenetsky M, Middelhaufe S, Bank EM, Levin LR, Buck J, Steegborn C. Molecular details of cAMP generation in mammalian cells: a tale of two systems. J Mol Biol 362: 623–639, 2006.[CrossRef][Web of Science][Medline]
  27. Klengel T, Liang WJ, Chaloupka J, Ruoff C, Schroppel K, Naglik JR, Eckert SE, Mogensen EG, Haynes K, Tuite MF, Levin LR, Buck J, Muhlschlegel FA. Fungal adenylyl cyclase integrates CO2 sensing with cAMP signaling and virulence. Curr Biol 15: 2021–2026, 2005.[CrossRef][Web of Science][Medline]
  28. Kwon TH, Pushkin A, Abuladze N, Nielsen S, Kurtz I. Immunoelectron microscopic localization of NBC3 sodium-bicarbonate cotransporter in rat kidney. Am J Physiol Renal Physiol 278: F327–F336, 2000.[Abstract/Free Full Text]
  29. Li S, Sato S, Yang X, Preisig PA, Alpern RJ. Pyk2 activation is integral to acid stimulation of sodium/hydrogen exchanger 3. J Clin Invest 114: 1782–1789, 2004.[CrossRef][Web of Science][Medline]
  30. Litvin TN, Kamenetsky M, Zarifyan A, Buck J, Levin LR. Kinetic properties of "soluble" adenylyl cyclase. Synergism between calcium and bicarbonate. J Biol Chem 278: 15922–15926, 2003.[Abstract/Free Full Text]
  31. Madsen KM, Tisher CC. Response of intercalated cells of rat outer medullary collecting duct to chronic metabolic acidosis. Lab Invest 51: 268–276, 1984.[Web of Science][Medline]
  32. Mittag TW, Guo WB, Kobayashi K. Bicarbonate-activated adenylyl cyclase in fluid-transporting tissues. Am J Physiol Renal Fluid Electrolyte Physiol 264: F1060–F1064, 1993.[Abstract/Free Full Text]
  33. Mogensen EG, Janbon G, Chaloupka J, Steegborn C, Fu MS, Moyrand F, Klengel T, Pearson DS, Geeves MA, Buck J, Levin LR, Muhlschlegel FA. Cryptococcus neoformans senses CO2 through the carbonic anhydrase Can2 and the adenylyl cyclase Cac1. Eukaryot Cell 5: 103–111, 2006.[Abstract/Free Full Text]
  34. Nicoletta JA, Ross JJ, Li G, Cheng Q, Schwartz J, Alexander EA, Schwartz JH. Munc-18-2 regulates exocytosis of H+-ATPase in rat inner medullary collecting duct cells. Am J Physiol Cell Physiol 287: C1366–C1374, 2004.[Abstract/Free Full Text]
  35. Pastor-Soler N, Beaulieu V, Litvin TN, Da Silva N, Chen Y, Brown D, Buck J, Levin LR, Breton S. Bicarbonate-regulated adenylyl cyclase (sAC) is a sensor that regulates pH-dependent V-ATPase recycling. J Biol Chem 278: 49523–49529, 2003.[Abstract/Free Full Text]
  36. Paunescu TG, Da Silva N, Marshansky V, McKee M, Breton S, Brown D. Expression of the 56-kDa B2 subunit isoform of the vacuolar H+-ATPase in proton-secreting cells of the kidney and epididymis. Am J Physiol Cell Physiol 287: C149–C162, 2004.[Abstract/Free Full Text]
  37. Paunescu TG, Russo LM, Da Silva N, Kovacikova J, Mohebbi N, Van Hoek AN, McKee M, Wagner CA, Breton S, Brown D. Compensatory membrane expression of the V-ATPase B2 subunit isoform in renal medullary intercalated cells of B1-deficient mice. Am J Physiol Renal Physiol 293: F1915–F1926, 2007.[Abstract/Free Full Text]
  38. Pietrement C, Sun-Wada GH, Da Silva N, McKee M, Marshansky V, Brown D, Futai M, Breton S. Distinct expression patterns of different subunit isoforms of the V-ATPase in the rat epididymis. Biol Reprod 74: 185–194, 2006.[Abstract/Free Full Text]
  39. Pushkin A, Abuladze N, Newman D, Muronets V, Sassani P, Tatishchev S, Kurtz I. The COOH termini of NBC3 and the 56-kDa H+-ATPase subunit are PDZ motifs involved in their interaction. Am J Physiol Cell Physiol 284: C667–C673, 2003.[Abstract/Free Full Text]
  40. Royaux IE, Wall SM, Karniski LP, Everett LA, Suzuki K, Knepper MA, Green ED. Pendrin, encoded by the Pendred syndrome gene, resides in the apical region of renal intercalated cells and mediates bicarbonate secretion. Proc Natl Acad Sci USA 98: 4221–4226, 2001.[Abstract/Free Full Text]
  41. Sabolic I, Brown D, Gluck SL, Alper SL. Regulation of AE1 anion exchanger and H+-ATPase in rat cortex by acute metabolic acidosis and alkalosis. Kidney Int 51: 125–137, 1997.[Web of Science][Medline]
  42. Schwartz GJ, Al-Awqati Q. Carbon dioxide causes exocytosis of vesicles containing H+ pumps in isolated perfused proximal and collecting tubules. J Clin Invest 75: 1638–1644, 1985.[Web of Science][Medline]
  43. Seuwen K, Ludwig MG, Wolf RM. Receptors for protons or lipid messengers or both? J Recept Signal Transduct Res 26: 599–610, 2006.[CrossRef][Medline]
  44. Smith AN, Lovering RC, Futai M, Takeda J, Brown D, Karet FE. Revised nomenclature for mammalian vacuolar-type H+-ATPase subunit genes. Mol Cell 12: 801–803, 2003.[CrossRef][Web of Science][Medline]
  45. Stefan E, Wiesner B, Baillie GS, Mollajew R, Henn V, Lorenz D, Furkert J, Santamaria K, Nedvetsky P, Hundsrucker C, Beyermann M, Krause E, Pohl P, Gall I, MacIntyre AN, Bachmann S, Houslay MD, Rosenthal W, Klussmann E. Compartmentalization of cAMP-dependent signaling by phosphodiesterase-4D is involved in the regulation of vasopressin-mediated water reabsorption in renal principal cells. J Am Soc Nephrol 18: 199–212, 2007.[Abstract/Free Full Text]
  46. Tang WJ, Gilman AG. Adenylyl cyclases. Cell 70: 869–872, 1992.[CrossRef][Web of Science][Medline]
  47. Van Adelsberg J, Al-Awqati Q. Regulation of cell pH by Ca2+-mediated exocytotic insertion of H+-ATPases. J Cell Biol 102: 1638–1645, 1986.[Abstract/Free Full Text]
  48. Wagner CA, Finberg KE, Breton S, Marshansky V, Brown D, Geibel JP. Renal vacuolar H+-ATPase. Physiol Rev 84: 1263–1314, 2004.[Abstract/Free Full Text]
  49. Wagner CA, Kovacikova J, Stehberger PA, Winter C, Benabbas C, Mohebbi N. Renal acid-base transport: old and new players. Nephron Physiol 103: p1–6, 2006.
  50. Zaccolo M, Magalhaes P, Pozzan T. Compartmentalisation of cAMP and Ca2+ signals. Curr Opin Cell Biol 14: 160–166, 2002.[CrossRef][Web of Science][Medline]
  51. Zhou Y, Bouyer P, Boron WF. Role of a tyrosine kinase in the CO2-induced stimulation of HCO3 reabsorption by rabbit S2 proximal tubules. Am J Physiol Renal Physiol 291: F358–F367, 2006.[Abstract/Free Full Text]
  52. Zhou Y, Zhao J, Bouyer P, Boron WF. Evidence from renal proximal tubules that HCO3 and solute reabsorption are acutely regulated not by pH but by basolateral HCO3 and CO2. Proc Natl Acad Sci USA 102: 3875–3880, 2005.[Abstract/Free Full Text]
  53. Zippin JH, Chen Y, Nahirney P, Kamenetsky M, Wuttke MS, Fischman DA, Levin LR, Buck J. Compartmentalization of bicarbonate-sensitive adenylyl cyclase in distinct signaling microdomains. FASEB J 17: 82–84, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
D. Brown, T. G. Paunescu, S. Breton, and V. Marshansky
Regulation of the V-ATPase in kidney epithelial cells: dual role in acid-base homeostasis and vesicle trafficking
J. Exp. Biol., June 1, 2009; 212(11): 1762 - 1772.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. G. Paunescu, A. C. Jones, R. Tyszkowski, and D. Brown
V-ATPase expression in the mouse olfactory epithelium
Am J Physiol Cell Physiol, October 1, 2008; 295(4): C923 - C930.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/1/F130    most recent
00406.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paunescu, T. G.
Right arrow Articles by Brown, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paunescu, T. G.
Right arrow Articles by Brown, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.