| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
unescu,Center for Systems Biology, Program in Membrane Biology and Division of Nephrology, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts
Submitted 31 August 2007 ; accepted in final form 23 October 2007
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
proton pump; kidney; intercalated cells; acid-base homeostasis
Intracellular cAMP levels are modulated by enzymes that synthesize cAMP [adenylyl cyclases (ACs)] and those that degrade it (cAMP phosphodiesterases). Mammalian cells express two distinct classes of ACs: the well-known transmembrane ACs (tmACs) (46) and the so-called sAC (6, 18, 53). sAC has no predicted transmembrane domains but, despite its name, is mostly found associated with particulate fractions in cell homogenates. sAC is insensitive to tmAC regulators such as forskolin and heterotrimeric G proteins but is, instead, activated directly by bicarbonate ions, although calcium can further modify its bicarbonate-stimulated activity (18, 23, 26, 30). sAC is, therefore, a potential sensor for monitoring acid-base status by responding to intracellular bicarbonate concentration, a hypothesis that is strongly supported by our own published data (35). In proton-secreting clear cells of the epididymis, V-ATPase recycling was found to be highly dependent on luminal bicarbonate; sAC-mediated increases in intracellular cAMP levels produced an accumulation of apical membrane V-ATPase (35). Furthermore, sAC could also potentially act as a CO2 sensor, because an increase in CO2 levels entering the cell would produce bicarbonate via the action of cytosolic carbonic anhydrases (53). Indeed, sAC has recently been associated with CO2 sensing in fungi and bacteria (27, 33). Whether sAC is a sensor that is involved in the response of renal epithelial cells to systemic acid-base status remains unknown.
We previously provided preliminary evidence that sAC is expressed in many segments of the kidney tubule, including thick ascending limbs of Henle and collecting ducts (35). These findings are consistent with the bicarbonate-stimulated AC activity previously described in rat kidney (32). Importantly, high levels of V-ATPase are also found in most of these cell types, both on intracellular vesicles and associated with the plasma membrane (13, 36, 48). Our prior findings relating sAC activity to epididymal proton secretion prompted us to evaluate the potential relationship between these enzymes in the kidney, with the hypothesis that the sAC-regulated cAMP signaling pathway may constitute a general sensing mechanism for regulating V-ATPase-mediated proton transport. Indeed, sAC is also present in the choroid plexus, another tissue involved in acid-base regulation (18). Our present results showing that sAC and the V-ATPase are colocalized in renal epithelial cells, are both concentrated at the plasma membrane of intercalated cells (IC) under conditions that are believed to stimulate proton secretion, and are present in an immunoprecipitated complex are consistent with the idea that they may closely interact to regulate proton secretion by renal collecting duct IC.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
To determine sAC expression and localization in the rodent kidney, we used a previously described monoclonal antibody raised against the NH2-terminal catalytic regions of the enzyme (35, 53), kindly provided by Drs. L. Levin and J. Buck (Cornell Univ. Medical School, New York). Several antibodies against various V-ATPase subunits were used to assess coexpression of sAC with V-ATPase: affinity-purified rabbit polyclonal antibodies, each raised against a synthetic peptide corresponding to the COOH-terminal region of mouse ATP6V1A (the V-ATPase 70-kDa "A" subunit), ATP6V1B1 (the V-ATPase 56-kDa "B1" subunit isoform), and ATP6V1B2 (the "B2" isoform), as previously described (2, 10, 22, 36, 38). Affinity-purified chicken antibodies were raised against synthetic peptides corresponding to the COOH-terminal region of ATP6V1E1 (the revised nomenclature for the ubiquitous V-ATPase 31-kDa "E" isoform) (10, 44) and ATP6V1B2 using the same peptide as for the rabbit anti-B2 antibody (19, 36).
To identify collecting duct A (A-IC)- and B-type IC (B-IC), an anti-AE1 anion exchanger affinity-purified rabbit polyclonal antibody was used (1, 7), kindly provided by Dr. S. Alper (Beth Israel Deaconess Medical Center, Boston) and an affinity-purified anti-pendrin rabbit polyclonal antibody (40) generously provided by Dr. I. E. Royaux (National Human Genome Research Institute, National Institutes of Health).
The following affinity-purified secondary antibodies were used: Alexa Fluor 488 goat anti-mouse IgG (H+L; Invitrogen, Carlsbad, CA) at a final concentration of 20 µg/ml, Alexa Fluor 594 goat anti-rabbit IgG (H+L; Invitrogen) at 2.5 µg/ml, indocarbocyanine (Cy3)-conjugated donkey anti-mouse IgG (H+L) at 1.75 µg/ml (Jackson ImmunoResearch Laboratories, West Grove, PA), fluorescein isothiocyanate (FITC)-conjugated donkey anti-rabbit IgG (H+L) at 1.75 µg/ml (Jackson ImmunoResearch Laboratories), and Cy3-conjugated donkey anti-chicken IgY (H+L) at 1.5 µg/ml (Jackson ImmunoResearch Laboratories).
Tissue Preparation
Adult male Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) and adult male mice, wild-type (Atp6v1b1+/+; C57BL6, Jackson Laboratory, Bar Harbor, ME) and B1 V-ATPase-deficient (Atp6v1b1–/–), were housed under standard conditions and maintained on a standard rodent diet. Generation and breeding of Atp6v1b1–/– mice have been described elsewhere; mice were genotyped by PCR as described previously (20). Some kidney tissue from rats treated for 28 days with the carbonic anhydrase inhibitor acetazolamide (15 mg·kg–1·day–1) was also processed for immunostaining. These tissues were from rats used in our prior study, in which acetazolamide was delivered by osmotic minipump infusion (2). All animal studies were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care, in accordance with National Institutes of Health, Department of Agriculture, and American Association for Accreditation of Laboratory Animal Care requirements.
For immunofluorescence experiments, animals were anesthetized using pentobarbital sodium (50 mg/kg body wt ip; Nembutal, Abbott Laboratories, North Chicago, IL) and perfused through the left cardiac ventricle with PBS (0.9% NaCl in 10 mM phosphate buffer, pH 7.4), followed by paraformaldehyde-lysine-periodate fixative (PLP) as described previously (36). Both kidneys were dissected, sliced, and further fixed by immersion in PLP for 4 h at room temperature and subsequently overnight at 4°C, and then rinsed extensively in PBS, and stored at 4°C in PBS containing 0.02% sodium azide until use.
Immunofluorescence and Confocal Microscopy
PLP-fixed kidney slices prepared as described above were cryoprotected in PBS containing 0.9 M sucrose overnight at 4°C and then embedded in Tissue-Tek OCT compound 4583 (Sakura Finetek USA, Torrance, CA), mounted on a specimen disk, and frozen at –20°C. Four-micrometer sections were cut on a Leica CM3050 S cryostat (Leica Microsystems, Bannockburn, IL), collected onto Superfrost Plus precleaned, charged microscope slides (Fisher Scientific, Pittsburgh, PA), air-dried, and stored at 4°C until use.
Sections were rehydrated in PBS and treated with 1% (wt/vol) SDS for 4 min for retrieval of antigenic sites, as previously described (14). After being washed 3 x 5 min in PBS and incubated for 10 min in 1% (wt/vol) bovine serum albumin in PBS with 0.02% sodium azide to minimize nonspecific staining, the sections were incubated for 90 min with the primary antibody diluted in Dako antibody diluent (Dako, Carpinteria, CA) and then with the secondary antibody for 1 h at room temperature. Slides were rinsed in high-salt (2.7% NaCl) PBS for 5 min and 2 x 5 min in regular PBS (0.9% NaCl) after each antibody incubation. For dual immunostaining, this protocol was repeated for the second primary antibody, followed by the appropriate secondary antibody. Slides were mounted in Vectashield medium (Vector Laboratories, Burlingame, CA) for microscopy and image acquisition. Control incubations confirmed that the secondary anti-mouse IgG reagents did not cross-react with rabbit anti-V-ATPase primary antibodies and, conversely, that the anti-rabbit IgG secondary antibodies did not cross-react with monoclonal mouse primary antibodies.
Digital images were acquired as described previously (36), using a Nikon Eclipse 800 epifluorescence microscope (Nikon Instruments, Melville, NY) equipped with an Orca 100 CCD camera (Hamamatsu, Bridgewater, NJ). Confocal laser-scanning microscopy imaging was performed on a Zeiss (formerly BioRad) Radiance 2000 confocal microscopy system (Carl Zeiss Microimaging, Thornwood, NY) using LaserSharp 2000 version 4.1 software. Epifluorescence and confocal images were analyzed using IPLab version 3.2.4 image processing software (Scanalytics, Fairfax, VA) and imported into Adobe Photoshop version CS2 image-editing software (Adobe Systems, San Jose, CA) for production of the final figures.
Immunogold Electron Microscopy
Sections of PLP-fixed mouse or rat kidney were prepared and immunostained either after embedding at low temperature in Lowicryl HM20 resin (Electron Microscopy Sciences, Hatfield, PA) or after ultrathin cryosectioning of frozen sections, as previously described (11). Sections were incubated on drops of primary anti-sAC monoclonal antibody diluted in Dako antibody diluent for 2 h at room temperature. After being rinsed on PBS drops, the grids were incubated on drops of goat anti-mouse IgG coupled to 10- or 15-nm gold particles (Ted Pella, Redding, CA) for 1 h at room temperature. For double immunostaining, grids were washed on drops of distilled water and then transferred to PBS and subsequently incubated as above on drops of chicken anti-B2 V-ATPase followed by rabbit anti-chicken IgG secondary antibody coupled to 10- or 15-nm gold particles or rabbit anti-V-ATPase A subunit followed by anti-rabbit IgG coupled to 15-nm gold (Ted Pella). Sections were examined in a JEM-1011 transmission electron microscope (JEOL, Tokyo, Japan) at 80 kV, and images acquired using an AMT XR60 digital imaging system (Advanced Microscopy Techniques, Danvers, MA) were subsequently imported into Adobe Photoshop CS2.
Protein Extraction from Kidneys
Freshly isolated rat kidneys were cut into smaller pieces and disrupted with a Tenbroeck tissue grinder in homogenization buffer (320 mM sucrose, 10 mM HEPES, pH 7.5, 1 mM EGTA, 0.1 mM EDTA, and complete protease inhibitors from Roche Applied Science, Indianapolis, IN). Homogenates were centrifuged for 10 min at 1,000 g at 4°C. Triton X-100 was added to the supernatants to a final concentration of 1%. After a second homogenization, DTT was added to a final concentration of 1 mM. Homogenates were centrifuged for 30 min at 16,000 g at 4°C and supernatants were collected. The protein concentration was determined with the bicinchoninic acid protein assay (Pierce Biotechnology, Rockford, IL) using albumin as standard. Protein extracts were aliquoted and stored at –80°C. For direct Western blotting, 50 µg of protein were diluted in Laemmli reducing sample buffer, boiled for 5 min, and loaded onto Tris-glycine polyacrylamide 4–20% gradient gels (Lonza, Rockland, ME).
Immunoprecipitation of sAC and V-ATPase from Kidney
One milligram of kidney extract prepared as above was incubated overnight at 4°C with 5 µg of rabbit antibody raised against the B1 subunit of the V-ATPase, in a buffer containing 10 mM HEPES, pH 7.5, 100 mM KCl, 2 mM MgCl2, 2 mM CaCl2, and complete protease inhibitors. Fifty microliters of Dynabeads Protein A (Invitrogen) were added. After 2 h of incubation at 4°C, proteins bound to the beads were recovered using a magnetic particle concentrator. Beads were washed four times in the immunoprecipitation buffer containing 0.5% Triton X-100, resuspended in 45 µl of Laemmli reducing sample buffer, and boiled for 5 min. After a brief centrifugation, supernatants were loaded onto a Tris-glycine polyacrylamide 4–20% gradient gel (Lonza), and separated proteins were transferred onto an Immun-Blot PVDF membrane (Bio-Rad, Hercules, CA). Membranes were blocked in Tris-buffered saline (TBS) with 5% nonfat dry milk and then incubated overnight at 4°C with the mouse anti-sAC antibody or a rabbit anti-V-ATPase A subunit antibody diluted in TBS with 2.5% milk. After four washes in TBS with 0.1% Tween 20, membranes were incubated with a donkey anti-mouse or anti-rabbit antibody conjugated to horseradish peroxidase (Jackson) for 1 h at room temperature. After four further washes, antibody binding was detected with the Western Lightning chemiluminescence reagent (Perkin Elmer Life Sciences, Boston, MA).
Total RNA Extraction, Reverse-Transcription, and Polymerase Chain Reaction
Kidneys from three wild-type and three B1-deficient (Atp6v1b1–/–) mice were dissected and disrupted immediately in RLT lysis buffer (Qiagen, Valencia, CA) with 10 µl/ml β-mercaptoethanol. Total RNA was isolated using the Qiagen RNeasy Mini kit, and genomic DNA contamination was removed by on-column incubation with 25 units DNase I for 30 min at room temperature. DNA-free RNA was reverse transcribed (RT) and polymerase chain reaction (PCR) was performed with 2 µl of RT products as templates. The sequences of the oligonucleotide primers flanking exon 11 were: MSAC-F2: cagatcctggacccgtgtat; MSAC-R2: gctgcagttcgtcatcaaaa. The amplicon sizes are 167 bp (full-length sAC) and 111 bp (truncated sAC) (18, 23, 53). See 
Fig. 10 for an explanation of how two different amplicon sizes are generated using these primers. PCR products were analyzed by electrophoresis on a 2.5% agarose gel containing GelStar stain (Lonza). No template controls (NTC) were performed by omitting cDNA template from the PCR amplification. Primers were synthesized by Sigma-Genosys (The Woodlands, TX).
|
|
|
|
|
|
|
|
|
|
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
As previously described, sAC was detectable in several epithelial cell types in the kidney (35). It was strongly expressed in collecting duct IC, as identified by their abundant V-ATPase expression detected using an antibody against the B1 subunit (Fig. 1). sAC is also variably expressed in B1-negative principal cells, in which both intracellular and apparent plasma membrane staining was detectable. Partial colocalization of sAC and the V-ATPase was seen in all IC, but distinct patterns of overlapping staining were obvious in different IC subpopulations. In some IC, sAC and B1 staining were concentrated toward the apical pole of the cell, whereas other IC showed marked apical and basolateral staining for both proteins. A-IC and B-IC were positively identified using antibodies against AE1 (an A-IC marker) and pendrin (a B-IC marker). sAC was concentrated in the apical pole of AE1-positive A-IC (Fig. 2, A–C), whereas it had a bipolar distribution in pendrin-positive B-IC (Fig. 2, D–F). Both pendrin and sAC were colocalized at the apical pole of these B-IC.
By immunogold electron microscopy, sAC was localized in the apical domain of A-IC, both in apical microvilli and in the apical cytoplasmic region in rat (Fig. 3A) and mouse (Fig. 3B) collecting ducts. The basolateral domain of A-IC, identified by staining with anti-AE1 antibodies, showed only very weak or no staining for sAC (data not shown), consistent with the low level of immunofluorescence staining for sAC seen in this cell type. In B-IC from cortical collecting ducts, sAC was present in both the apical and basolateral pole of the cell (Fig. 4), as also seen by immunofluorescence microscopy. In tissues from control rats, sAC was partially colocalized with the V-ATPase (A subunit) at the apical plasma membrane of A-IC (Fig. 5A) and in the basolateral membrane of B-IC (Fig. 5B). Using the immunogold technique, staining for sAC was consistently weaker than the very strong V-ATPase labeling.
Distribution of sAC Upon "Stimulation" of A-type IC
The distribution of sAC was next examined under conditions in which A-IC have been reported previously to have a tight apical band of V-ATPase immunostaining, presumably reflecting an activated state of proton secretion.
Acetazolamide-treated rats. Acetazolamide treatment results in a transient metabolic acidosis by inhibiting proximal bicarbonate reabsorption. In these rats, bicarbonate delivery to the apical pole of collecting duct epithelial cells is increased. We previously showed that in acetazolamide-treated rats, the number of A-IC with tight apical V-ATPase staining is significantly increased in the collecting duct and that the number of B-IC is greatly reduced (2). After 4 wk of acetazolamide treatment, B-IC were rarely found in the cortical collecting duct. In acetazolamide-treated rats, sAC is concentrated at the apical pole of many IC, along with the E subunit of the V-ATPase (Fig. 6). However, while apical colocalization was apparent, the sAC staining in some IC had a more diffuse distribution that extended deeper into the cytoplasm than the tight apical V-ATPase staining. Identical images were obtained with anti-B1 and B2 subunit antibodies (not shown). sAC is also present in adjacent principal cells, which are poorly stained with the anti-E subunit antibody, but expression was lower than in the V-ATPase-positive IC.
Mice that lack the V-ATPase B1 subunit isoform (Atp6vb1–/– mice). We previously reported that B1-deficient mice compensate for the loss of the V-ATPase B1 subunit by inserting V-ATPase containing the alternative B2 subunit into the apical plasma membrane of A-IC in medullary collecting ducts and in epididymal clear cells (19, 20, 37). This allows them to partially compensate for the loss of B1 by maintaining proton secretion in some A-IC. In these mice, sAC is apically colocalized with the V-ATPase in medullary A-IC, as illustrated in sections that were double stained with sAC and the B2 subunit of the V-ATPase (Fig. 7). The tight relationship between sAC and the V-ATPase was confirmed by immunogold electron microscopy in ultrathin cryostat sections in IC from Atp6v1b1–/– mice where both proteins were colocalized on or close to the apical plasma membrane (Fig. 8). These data show that colocalization of sAC with the V-ATPase does not require the B1 isoform, since sAC is apically located also in mice that lack this B1 subunit.
sAC Coimmunoprecipitates With the V-ATPase
The partial overlap between sAC and V-ATPase localization in renal IC suggested a close association between the two enzymes. Whole rat kidney tissue homogenates were, therefore, subjected to coimmunoprecipitation using a polyclonal antibody against the B1 subunit of the V-ATPase. The immunoprecipitated complex contained abundant sAC (Fig. 9A), as well as the A subunit of the V-ATPase (Fig. 9B), which closely interacts with the B subunit in the native enzyme. The sAC that was identified in the kidney was a 50-kDa splice variant of the protein, which is the major functional sAC variant in many tissues (16, 26). RT-PCR using primers spanning exon 11 (whose deletion results in a frameshift that generates a premature TAG stop codon to produce a 50-kDa sAC protein) generated a predicted product of 
111 bp from the wild-type and B1-deficient mouse kidney, corresponding to a sequence from the 50-kDa sAC isoform. However, a 167-bp product was also produced, indicating that mRNA coding for full-length sAC is also expressed in the kidney (Fig. 10).
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
Various experimental conditions stimulate distal proton secretion by the kidney, and this results primarily from increased V-ATPase levels in the apical plasma membrane of A-IC. It has been clearly shown that under conditions such as systemic metabolic acidosis (4, 31, 41), increased basolateral CO2 in vitro (42), and acetazolamide treatment (2), the V-ATPase accumulates in the apical pole of these cells (12, 48). This response is also calcium dependent (47), involves SNARE proteins (3, 8, 34), microtubules (15), and the actin cytoskeleton (5, 17). However, the intracellular signaling mechanism that triggers the membrane accumulation of the V-ATPase remains unknown. In the kidney proximal tubule, apical proton secretion and reabsorption of bicarbonate appear to be regulated by basolateral CO2 and bicarbonate (42, 52), possibly via activation of a receptor tyrosine kinase (51). Interestingly, the tyrosine kinase pyk2 can activate Na+/H+ exchange in cultured cells in response to acidification of the medium (29). Our recent work using proton-secreting cells of the epididymis, known as clear cells, showed that the apical accumulation of V-ATPase in response to luminal bicarbonate and/or an increase in luminal pH is dependent on sAC activity (35). Furthermore, this apical accumulation can be induced by elevating intracellular cAMP, even when the luminal pH is acidic, which normally reduces apical V-ATPase activity. Basolateral CO2 also stimulates apical proton secretion by IC (42) and, as mentioned earlier, sAC could be indirectly activated by elevated CO2 as a result of bicarbonate generation via cytosolic carbonic anhydrase type II, which is highly expressed in IC (12).
In the kidney, apical insertion of the V-ATPase is usually considered to be a physiological response to metabolic or respiratory acidosis (48), but the mechanism by which the acid-base disturbance is sensed by IC is not known. We suggest here that sAC might be one component of the sensing apparatus. In metabolic acidosis that results from a diminished bicarbonate reabsorption by the proximal tubule, increased distal delivery of bicarbonate could result in a stimulation of intercalated cell proton secretion via activation of sAC, and apical mobilization of V-ATPase. Indeed, after inhibition of carbonic anhydrase by acetazolamide, a dramatic increase in apical V-ATPase is seen in IC (2). This is analogous to the situation we previously described in the epididymis, in which an elevation in luminal bicarbonate stimulates apical membrane V-ATPase accumulation (35). IC express the electroneutral sodium bicarbonate cotransporter NBC3 on their apical membrane, through which luminal bicarbonate could enter the cell to activate sAC (28). Apical expression of holoenzymes containing B1 and B2 subunit isoforms occurs in IC after acetazolamide treatment (36), possibly to maximize proton secretion by these cells in the face of inhibition of the proximal bicarbonate reabsorptive mechanism and the resulting increased distal delivery of bicarbonate.
In B1-deficient mice, under normal conditions of ad libitum food and water uptake, acidemia is not detectable, but the urine of these mice is significantly more alkaline than normal controls (20). The medullary A-type IC of these mice show characteristic features of "stimulated" cells, with tight and intense apical membrane expression of V-ATPase holoenzymes that contain the B2 subunit isoform (20, 36, 37). We show here that sAC also has a similar strong apical expression in these animals, indicating that its colocalization with the V-ATPase does not depend on the presence of the B1 isoform that is normally highly expressed in these proton-secreting cells. We proposed that the apical expression of B2-containing holoenzymes in these mice is an "isoform replacement" regulatory response to the lack of the usual B1 subunit. While the activity of the B2-containing enzyme at the plasma membrane is sufficient to maintain systemic pH within the normal range, the alkaline urine pH suggests that this homeostasis is borderline effective, and indeed when challenged with an acid load, B1-deficient mice become severely acidotic (20, 37). However, in B1-deficient mice, the increased accumulation of V-ATPase complexes containing the B2 subunit at the apical plasma membrane of epididymal clear cells is sufficient to allow an acidic luminal pH to be generated in this organ, which is critical for the maintenance of male fertility (9, 19).
It is becoming increasingly understood that local complexes of proteins within cells play an important role in restricting and compartmentalizing a variety of signaling events that lead to physiological responses of cells to various stimuli. These complexes can include sensors and signaling proteins, as well as channels, transporters, or enzymes that elicit the final cellular actions to the stimulus. In the case of sAC, it has been proposed that its association with defined intracellular structures or compartments such as the nucleus and mitochondria allows a more localized cAMP elevation to occur, without affecting the rest of the cell (53). The activity of sAC could also be restricted by phosphodiesterase "barriers" that further limit cAMP diffusion within cells (25, 50, 53). Similar complexes have also been proposed in the case of the aquaporin-2 (AQP2) water channel for example, where PKA, AKAPs, and phosphodiesterases are associated with AQP2-containing vesicles (45). Thus the close association of sAC with the V-ATPase is consistent with the presence of a signaling complex that responds to an increase in bicarbonate to generate cAMP, and ultimately cause membrane accumulation of the enzyme. Intriguingly, NBC3 has also been colocalized at the apical membrane of IC with the V-ATPase in a complex that also contains the PDZ binding protein NHERF (39). However, the association of the V-ATPase with sAC does not seem to depend on a similar PDZ-protein-dependent interaction, because only the B1 subunit isoform contains a COOH-terminal PDZ binding motif (10) and colocalization was seen even in B1-deficient mice. Nevertheless, entry of bicarbonate through NBC3 (or another bicarbonate transporter) would stimulate sAC. The subsequent elevation of cAMP could be associated with protein phosphorylation via PKA, for example, but it remains to be determined whether any V-ATPase subunits can be phosphorylated by PKA. Alternatively, increased cAMP could directly activate exchange proteins known as EPACs, which in turn could regulate the cytoskeleton, a process that we and others showed to be important for V-ATPase trafficking (5, 17). More work will be required to determine whether sAC associates directly or indirectly with the V-ATPase, and how sAC activation results in the plasma membrane accumulation of the enzyme and an increase in apical proton secretion.
Finally, while we propose that sAC might be a bicarbonate sensor that allows IC to respond to acid-base cues via V-ATPase mobilization and/or activation, other pH sensing proteins have been identified that might play complementary roles in the regulation of systemic acid-base balance. For example, the pH-sensitive G protein-coupled receptors known as OGR1 and GPR4 have been identified in the kidney and are poised to respond directly to pH by activating the cAMP/PKA pathway (43, 49). Thus sAC might be one player in a complex but integrated network of protein sensors that together allow IC, in collaboration with other renal tubular segments, to modulate proton secretion and bicarbonate reabsorption by the kidney.
|
GRANTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
unescu), a KO8 award DK-75940 (to H. A. J. Lu), and a grant from the Juvenile Diabetes Foundation (to L. M. Russo). The Microscopy Core Facility of the Program in Membrane Biology received additional support from the Boston Area Diabetes and Endocrinology Research Center (NIH DK-57521) and from the Center for the Study of Inflammatory Bowel Disease (NIH DK-43341).
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
unescu TG, McKee M, Smith PJ, Brown D, Breton S. Relocalization of the V-ATPase B2 subunit to the apical membrane of epididymal clear cells of mice deficient in the B1 subunit. Am J Physiol Cell Physiol 293: C199–C210, 2007.unescu TG, Breton S, Brown D, Giebisch G, Geibel JP, Lifton RP. The B1 subunit of the H+-ATPase is required for maximal urinary acidification. Proc Natl Acad Sci USA 102: 13616–13621, 2005.unescu TG, Da Silva N, Marshansky V, McKee M, Breton S, Brown D. Expression of the 56-kDa B2 subunit isoform of the vacuolar H+-ATPase in proton-secreting cells of the kidney and epididymis. Am J Physiol Cell Physiol 287: C149–C162, 2004.unescu TG, Russo LM, Da Silva N, Kovacikova J, Mohebbi N, Van Hoek AN, McKee M, Wagner CA, Breton S, Brown D. Compensatory membrane expression of the V-ATPase B2 subunit isoform in renal medullary intercalated cells of B1-deficient mice. Am J Physiol Renal Physiol 293: F1915–F1926, 2007.This article has been cited by other articles:
|
|
 |
|
  D. Brown, T. G. Paunescu, S. Breton, and V. Marshansky Regulation of the V-ATPase in kidney epithelial cells: dual role in acid-base homeostasis and vesicle trafficking J. Exp. Biol., June 1, 2009; 212(11): 1762 - 1772. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. G. Paunescu, A. C. Jones, R. Tyszkowski, and D. Brown V-ATPase expression in the mouse olfactory epithelium Am J Physiol Cell Physiol, October 1, 2008; 295(4): C923 - C930. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
