AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Renal Physiol 294: F469-F479, 2008. First published January 2, 2008; doi:10.1152/ajprenal.00372.2007
0363-6127/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/F469    most recent
00372.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, D.
Right arrow Articles by Takano, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, D.
Right arrow Articles by Takano, T.

Role of calcium-independent phospholipase A2 in complement-mediated glomerular epithelial cell injury

Daniel Cohen,2 Joan Papillon,1 Lamine Aoudjit,1 Hongping Li,1 Andrey V. Cybulsky,1,2,* and Tomoko Takano1,2,*

Departments of 1Medicine and 2Physiology, McGill University, Montreal, Quebec, Canada

Submitted 7 August 2007 ; accepted in final form 28 December 2007


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In experimental membranous nephropathy, complement C5b-9-induced glomerular epithelial cell (GEC) injury leads to morphological changes in GEC and proteinuria, in association with phospholipase A2 (PLA2) activation. The present study addresses the role of calcium-independent PLA2 (iPLA2) in GEC injury. iPLA2β short and iPLA2{gamma} were expressed in cultured rat GEC and normal rat glomeruli. To determine whether iPLA2 is involved in complement-mediated arachidonic acid (AA) release, GEC were stably transfected with iPLA2{gamma} or iPLA2β cDNAs (GEC-iPLA2{gamma}; GEC-iPLA2β). Compared with control cells (GEC-Neo), GEC-iPLA2{gamma} and GEC-iPLA2β demonstrated greater expression of iPLA2 proteins and activities. Complement-mediated release of [3H]AA was augmented significantly in GEC-iPLA2{gamma} compared with GEC-Neo, and the augmented [3H]AA release was inhibited by the iPLA2-directed inhibitor bromoenol lactone (BEL). For comparison, overexpression of iPLA2{gamma} also amplified [3H]AA release after incubation of GEC with H2O2, or chemical anoxia followed by reexposure to glucose (in vitro ischemia-reperfusion injury). In parallel with release of [3H]AA, complement-mediated production of prostaglandin E2 was amplified in GEC-iPLA2{gamma}. Complement-mediated cytotoxicity was attenuated significantly in GEC-iPLA2{gamma} compared with GEC-Neo, and the cytoprotective effect of iPLA2{gamma} was reversed by BEL, and in part by indomethacin. Overexpression of iPLA2β did not amplify complement-dependent [3H]AA release, but nonetheless attenuated complement-mediated cytotoxicity. Thus iPLA2{gamma} may be involved in complement-mediated release of AA. Expression of iPLA2{gamma} or iPLA2β induces cytoprotection against complement-dependent GEC injury. Modulation of iPLA2 activity may prove to be a novel approach to reducing GEC injury.

iPLA2β; iPLA2{gamma}; cytoprotection

MEMBERS OF the phospholipase A2 (PLA2) family of enzymes hydrolyze fatty acids from the sn-2 position of phospholipids, generating free fatty acids and lysophospholipids (34, 43). Both products of this reaction have signaling properties. Moreover, arachidonic acid (AA) may be further metabolized by cyclooxygenase (COX) and lipoxygenase enzymes to bioactive eicosanoids. The PLA2s may be subdivided into three categories, including secretory PLA2s (sPLA2, groups I, II, III, V, VII–XIV), calcium-dependent PLA2s, e.g., cytosolic PLA2{alpha} (cPLA2, group IV), and the most recently discovered calcium-independent PLA2s (iPLA2s, group VI) (34, 43).

cPLA2 plays an important role in complement-mediated glomerular epithelial cell (GEC) injury in the passive Heymann nephritis (PHN) model of membranous nephropathy (19). GEC, otherwise known as podocytes, are an important component of the glomerular permselective barrier (33, 38, 42). In PHN and human membranous nephropathy, deposition of antibodies in the subepithelial region of the glomerulus leads to activation of complement and assembly of the C5b-9 membrane attack complex in GEC plasma membranes, leading to GEC injury and proteinuria. Studies in cultured GEC and in PHN indicate that C5b-9 induces sublethal GEC injury, which is associated with activation of protein kinases and phospholipases (including cPLA2), upregulation of COX-2, production of reactive oxygen species, induction of endoplasmic reticulum (ER) stress response, and other effects. These pathways ultimately contribute to changes in GEC lipid composition and function, reorganization of the actin cytoskeleton, and displacement of filtration slit diaphragm proteins (19).

Previous studies have demonstrated that assembly of C5b-9 in cultured GEC is linked to the activation of cPLA2 and that glomeruli of rats with PHN demonstrate increased cPLA2 activity compared with control glomeruli (23). Activation of cPLA2 leads to various cellular effects. First, in GEC, activation of cPLA2 perturbs the membrane of the ER and contributes to induction of ER stress. Preconditioning of rats with compounds that induce ER stress can limit proteinuria in PHN (22). Second, activation of cPLA2 may contribute directly to the exacerbation of C5b-9-induced GEC injury (18, 23, 37). Finally, the AA mobilized by cPLA2 is metabolized by COX enzymes (44) to bioactive eicosanoids. Glomeruli from rats with PHN show increased COX-1 and COX-2 protein expression and enhanced production of prostaglandin (PG) E2 and thromboxane A2. Blockade of COX enzymes reduces urinary protein excretion in PHN and in human membranous nephropathy (45, 46).

The purpose of the present study was to determine whether complement could stimulate the activity of iPLA2. Among the various members of the iPLA2 family, we focused on two isoenzyme subfamilies, so-called iPLA2-VIA-1 and -2 (iPLA2β short and iPLA2β long) and iPLA2-VIB (iPLA2{gamma}), each with unique structural features, especially in the NH2 terminus (29, 31, 43). Both iPLA2β short and iPLA2β long are functional enzymes, which differ by a 54-amino acid proline-rich insertion sequence (13). Knockout mice lacking iPLA2β show only impaired sperm motility (7), while transgenic mice overexpressing the same isoform are prone to ventricular tachyarrhythmias (30). iPLA2{gamma} is a membrane-bound enzyme, with competing peroxisomal (COOH terminal) and mitochondrial (NH2 terminal) localization signals (31). iPLA2{gamma} also localizes in the ER (17). iPLA2{gamma} gene transcription and translation are complex (31). iPLA2{gamma} has multiple promoter sites, as well as a transcriptional repressor site in the 5'-untranslated region. The full-length 2.4-kb transcript contains 13 exons and includes four AUG translation initiation codons generating as many as 10 splice variants, which appear as 88-, 77-, 74-, and 63-kDa immunoreactive proteins on SDS-PAGE and immunoblotting (47). iPLA2 enzymes are active in basal phospholipid turnover, phospholipid accumulation during the G1/M phase of mitosis, and are involved at various levels of apoptotic cascades (2, 5). iPLA2{gamma} was shown to be cytoprotective against oxidant insults in renal cells, presumably by removing oxidized phospholipids (17). In contrast, inhibition of rabbit renal proximal tubule cell microsomal iPLA2{gamma} during cisplatin-induced apoptosis reduced annexin V staining, chromatin condensation, and caspase-3 activation, indicating that iPLA2{gamma} inhibition was cytoprotective (16). Mitochondrial iPLA2{gamma} has also been shown to actively participate in the permeability pore transition of the mitochondria and the release of the proapoptotic cytochrome c (25). A recent study showed that iPLA2{gamma} knockout mice display multiple bioenergetic dysfunctional phenotypes (32). In addition, several potential pathophysiological roles have been described for the iPLA2s, including AA release for eicosanoid production, tumorigenesis, cell injury, apoptosis, chemotaxis, and others (2, 5, 35).

In the present study, we have used cultured GEC to demonstrate that C5b-9 can stimulate an iPLA2 to increase free [3H]AA. Overexpression of iPLA2{gamma} in GEC augmented complement-dependent [3H]AA release, and production of PGE2. Furthermore, overexpression of iPLA2{gamma}, as well as iPLA2β limited complement-induced GEC injury via eicosanoids, suggesting that activation of iPLA2 is cytoprotective.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. Tissue culture media, zeomycin, hygromycin, and Lipofectamine 2000 were from Invitrogen-Life Technologies (Burlington, ON). Electrophoresis reagents were from Bio-Rad Laboratories (Mississauga, ON). Mouse anti-iPLA2β, anti-COX-1, and anti-COX-2 antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Enhanced chemiluminescence (ECL) detection reagents were from Amersham Bioscience (Baie d'Urfé, QC). Bromoenol lactone (BEL) and PGE2 enzyme immunoassay kits were purchased from Cayman Chemical (Ann Arbor, MI). [3H]AA (100 mCi/mmol), [14C]arachidonyl-phosphatidylethanolamine (PE; 48 mCi/mmol), and [14C]arachidonyl-phosphatidylcholine (PC; 53 mCi/mmol), were purchased from PerkinElmer Life and Products (Boston, MA). Mouse iPLA2β long and iPLA2β short cDNAs subcloned into pcDNA 3.1 were kindly provided by Dr. Suzanne Jackowski (University of Tennessee Health Centre, Memphis, TN), while human iPLA2{gamma} cDNA in pcDNA 1.1 was provided by Drs. Richard Gross and David Mancuso (Washington University School of Medicine, St. Louis, MO). iPLA2{gamma} antibody was kindly provided by Dr. Makoto Murakami (Showa University, Tokyo, Japan). Unless otherwise specified, all other chemicals and biochemical reagents were purchased from Sigma-Aldrich Canada (Mississauga, ON).

Cell culture, radiolabeling, and transfection. Rat GEC culture and characterization have been described previously (14, 40). According to established criteria, the cells demonstrated cytotoxic susceptibility to low doses of aminonucleoside of puromycin, the presence of junctional complexes by electron microscopy, and expression of a variety of GEC antigens. GEC were maintained in K1 medium. COS cells and Chinese hamster ovary (CHO) cells were cultured in DMEM-10% fetal calf serum.

Phospholipids were radiolabeled to isotopic equilibrium by incubating cells with [3H]AA (0.125 µCi/ml K1 medium) for 72 h (20). At the end of incubations, supernatants and cells were collected, lipids were extracted with chloroform:methanol (1:1.2) and 0.2% formic acid, followed by chloroform, and were then dried under nitrogen. After reconstitution in chloroform:methanol (2:1) and addition of "cold" AA and 1,2-diacylglycerol (DAG) standards, the free AA and DAG were separated from other lipids by thin-layer chromatography in hexane:diethyl ether:acetic acid (80:20:2). Relevant bands were scraped, and radioactivity was quantified in a beta liquid scintillation counter (18, 37). It should be noted that when using this method, we cannot exclude some oxidation of [3H]AA.

For expression of iPLA2 enzymes, plasmids containing iPLA2β short or iPLA2{gamma} cDNAs were transfected in GEC using the Lipofectamine 2000 reagent. Following selection by neomycin and expansion, all subclones were tested for overexpression of the enzyme by immunoblotting. Confirmation of enhanced enzyme activity was determined using an in vitro PLA2 assay (described below). Characterization of GEC that overexpress cPLA2 was published previously (18, 37).

Incubation of GEC with complement. GEC were incubated with rabbit anti-GEC antiserum (5% vol/vol) in modified Krebs-Henseleit buffer containing (in mM) 145 NaCl, 5 KCl, 0.5 MgSO4, 1 Na2HPO4, 0.5 mmol/l CaCl2, 5 glucose, and 20 HEPES, pH 7.4, for 30 min at 22°C. The cells were then incubated at 37°C with normal human serum (NS; with full complement activity) or heat-inactivated serum (HIS; incubated at 56°C for 30 min to inactivate complement) as indicated. In experiments designed to measure Ca2+-independent [3H]AA release, antibody-sensitized GEC were incubated with C8-deficient human serum (C8DS) in buffer containing 0.5 mM Ca2+ for 40 min. Then, GEC were washed and incubated with or without purified C8 (2.0 µg/ml) and C9 (1.5 µg/ml) for 40 min in buffer containing 1 mM EGTA (18, 37).

Preparation of cell extracts and in vitro assay of PLA2 activity. Cells were collected in homogenization buffer containing 50 mM HEPES, 0.25 M sucrose, 1 mM EDTA, 1 mM EGTA, 20 µM leupeptin, 20 µM pepstatin, and 0.1 mM PMSF, pH 7.4 (18, 37). Following centrifugation for 3 min at 1,500 g, the pellet was homogenized with 25 strokes in a Wheaton homogenizer, centrifuged for 5 min at 2,500 g, and the supernatant was collected. The remaining pellet was again homogenized and centrifuged for 5 min with the supernatant being pooled with that collected earlier. The supernatant was centrifuged at 15,000 g for 20 min to remove any remaining insoluble membrane fractions.

To assay PLA2 activity (18, 37), exogenous 2-[14C]arachidonyl-PE or PC (substrate; 3.5 µM) was dried under a stream of nitrogen and reconstituted in 2 µl of DMSO. Cell extracts diluted in homogenization buffer (48 µl) were incubated with substrate for 45 min at 37°C. In some experiments, PLA2 activity was measured after addition of CaCl2 to the homogenization buffer to a final Ca2+ concentration of 2 mM. The reaction was stopped by adding 50 µl of ethanol containing cold AA and acetic acid. [14C]AA was separated from other lipids by thin-layer chromatography as described above.

Immunoblotting. Immunoblotting was done as described previously (45). Glomeruli were isolated from rat kidney cortices by differential sieving (purity of glomeruli was >95%) (22). Briefly, cells or isolated glomeruli were lysed in buffer containing 10 mM sodium pyrophosphate, 25 mM NaF, 2 mM Na3VO4, 2% Triton X-100, 250 mM NaCl, 20 mM Tris, 2 mM EDTA, 2 mM EGTA, and a protease inhibitor cocktail (Roche Diagnostics), pH 7.4. After centrifugation at 14,000 g, soluble components were collected and the protein concentration was quantified using the Bio-Rad assay. Equal quantities of proteins were separated by SDS-PAGE under reducing conditions. Proteins were then transferred to a nitrocellulose membrane, and the membrane was blocked at room temperature for 60 min with 5% dry milk in TBS-T wash buffer containing 10 mM Tris, pH 7.5, 50 mM NaCl, 2.5 mM EDTA, and 0.05% Tween 20. The nitrocellulose membrane was subsequently incubated with primary antibody for 60 min at 22°C, washed three times in TBS-T wash buffer, and incubated with the appropriate secondary antibody conjugated to horseradish peroxidase for 60 min at 22°C. Immunoreactive proteins were then visualized using ECL.

RT-PCR. RNA samples were isolated from cells or normal rat glomeruli using TRIzol reagent (Invitrogen) according to the manufacturer's instructions (3). RT-PCR was performed with an Invitrogen Superscript II One-Step PCR Kit. Primers designed for iPLA2β flanked the insertion site of exon 9 (forward: TTGGGGCAGAAGTAGACACC, reverse: GTCAGCATCACCTTGGGTTT) to distinguish short and long isoforms. Primers for iPLA2{gamma} were ATTGATGGTGGAGGAACAAGA (forward) and ATGGCCTGCCACATTTTATAC (reverse). PCR for iPLA2β and iPLA2{gamma} were performed with 35 cycles of 30 s at 94°C, 1 min at 55°C, and 1 min at 72°C. Experimental conditions for EP4 and β-actin PCR were described previously (3). PCR products were separated by agarose gel electrophoresis and visualized after staining with ethidium bromide.

PGE2 assay. At the end of incubations with complement, supernatants were collected for measurement of PGE2. The samples were further diluted 100- to 200-fold in assay buffer, and PGE2 was quantified using an enzyme immunoassay kit from Cayman Chemical, according to the manufacturer's instructions (45).

Measurement of intracellular Ca2+ concentration. The method has been described in detail (20). Briefly, GEC were loaded in suspension with 5 µM fura 2-AM in buffer containing 0.5 mM CaCl2 for 30 min at 37°C. After washing, aliquots of cells were placed into a spectrofluorometer in Ca2+-free Krebs-Henseleit buffer containing 2 mM EGTA. Fluorescence of fura 2 was monitored continuously (emission wavelength of 510 nm, excitation wavelengths alternating between 340 and 380 nm) at 37°C. Release of Ca2+ from intracellular storage sites was initiated by the addition of 5 µM ionomycin.

Lactate dehydrogenase assay. GEC were incubated with antibody and complement as described above. At the end of the incubations, supernatants were collected and the remaining cell contents were solubilized with Triton-X 100 (1%). The supernatant and Triton fractions were assayed for lactate dehydrogenase (LDH) by incubating 100 µl of the sample in 1.5 ml glycine (58 mM)/lactate buffer (0.2 M), containing NAD (4.8 mg/ml) at 37°C and monitoring absorbance at 340 nm in a spectrophotometer. Specific LDH release was calculated using the formula (NS – HIS)/(100 – HIS) x 100 (40).

Statistics. Data are presented as mean ± SE. The t-statistic was used to determine significant differences between two groups. For more than two groups, one-way ANOVA was used to determine significant differences among groups. Where significant differences were found, individual comparisons were made between groups using the t-statistic, and adjusting the critical value according to the Bonferroni method (see Fig.s 5–8). Two-way ANOVA was used to determine significant differences in multiple measurements among groups (see Figs. 3B and 4B).


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 5. Effects of complement, H2O2, and anoxia/recovery on [3H]AA release in GEC-iPLA2{gamma}. A: complement-induced release of [3H]AA is enhanced in GEC that overexpress GEC-iPLA2{gamma}. GEC-iPLA2{gamma}, and GEC-Neo were labeled with [3H]AA, and incubated with anti-GEC antiserum for 30 min at 22°C in the presence or absence of the iPLA2-directed inhibitor bromoenol lactone (BEL; 25 µM). The cells were then incubated at 37°C with 3% normal serum (NS; to form C5b-9) or heat-inactivated serum (HIS) for 60 min. BEL tended to increase [3H]AA release in control cells modestly, but the change was not significant. *P < 0.002 NS vs. HIS (GEC-Neo), **P < 0.0001 NS vs. HIS (GEC-iPLA2{gamma}) and P < 0.003 GEC-iPLA2{gamma} vs. GEC-Neo (NS), +P < 0.001 NS vs. NS/BEL (GEC-iPLA2{gamma}), 4 experiments. B: H2O2-induced release of [3H]AA is enhanced in GEC that overexpress GEC-iPLA2{gamma}. [3H]AA-labeled GEC-iPLA2{gamma} and GEC-Neo were preincubated with or without BEL for 30 min at 37°C and were then incubated with 1 mM H2O2 for 30 min. *P < 0.02 H2O2 vs. control (GEC-iPLA2{gamma}) and P < 0.01 GEC-iPLA2{gamma} vs. GEC-Neo (H2O2), 3 experiments. C: anoxia/recovery (Anoxia)-induced release of [3H]AA is enhanced in GEC that overexpress GEC-iPLA2{gamma}. Anoxia was induced by incubating cells with 10 mM 2-deoxyglucose and 10 µM antimycin A in glucose-free buffer at 37°C for 90 min. This step was followed by recovery in glucose-replete medium for 30 min at 37°C. *P < 0.05 Anoxia vs. control (GEC-iPLA2{gamma}) and P < 0.05 GEC-iPLA2{gamma} vs. GEC-Neo (Anoxia), **P < 0.05 Anoxia vs. Anoxia/BEL (GEC-iPLA2{gamma}), 3 experiments.

 

Figure 8
View larger version (12K):
[in this window]
[in a new window]

  		Fig. 8. Protective effect of iPLA2{gamma}, but not iPLA2β on complement-mediated injury is prostaglandin dependent. A: GEC-iPLA2{gamma} and GEC-Neo were preincubated with or without BEL (25 µM) or indomethacin (10 µM) for 30 min. Cells were then incubated with anti-GEC antiserum and 5% NS (HIS in control) for 100 min. *P < 0.0001 GEC-iPLA2{gamma} vs. GEC-Neo (NS), **P < 0.0001 NS/BEL vs. NS (GEC-iPLA2{gamma}), +P < 0.0001 NS/indomethacin vs. NS (GEC-iPLA2{gamma}), 3 experiments. B: GEC-iPLA2{gamma} and GEC-Neo were preincubated with or without NS 398 (10 µM) or SC560 (10 µM) for 30 min. Cells were then incubated as described above. *P < 0.0001 GEC-iPLA2{gamma} vs. GEC-Neo (NS), **P < 0.04 NS/NS398 vs. NS (GEC-iPLA2{gamma}), +P < 0.002 NS/SC560 vs. NS (GEC-iPLA2{gamma}), 4 experiments. C: GEC-iPLA2β and GEC-Neo were treated as in A. *P < 0.01 GEC-iPLA2β vs. GEC-Neo (NS), 4 experiments.

 

Figure 3
View larger version (41K):
[in this window]
[in a new window]

  		Fig. 3. Overexpression of iPLA2{gamma} in GEC. A: lysates of control GEC and clones of GEC stably transfected with iPLA2{gamma} (GEC-iPLA2{gamma}) were immunoblotted with an antibody to iPLA2{gamma}. GEC-iPLA2{gamma} express 88-, 77-, and 74-kDa splice variants of the {gamma}-enzyme. Expression of endogenous iPLA2{gamma} in parental GEC is not visible at this exposure. B: serially increasing amounts of cell extracts from GEC-iPLA2{gamma} and GEC-Neo were incubated with [14C]PE for 45 min at 37°C in the absence of Ca2+. The data were analyzed using 2-way ANOVA. The increase in PLA2 activity was significant. P < 0.0001 iPLA2{gamma} vs. Neo, 6 measurements.

 

Figure 4
View larger version (25K):
[in this window]
[in a new window]

  		Fig. 4. Overexpression of iPLA2β in GEC. A: lysates of control GEC and a clone of GEC stably transfected with iPLA2β (GEC-iPLA2β) were immunoblotted with an antibody to iPLA2β. COS cells are shown for comparison. In GEC-iPLA2β, the transfected enzyme migrates slightly more quickly than the endogenous, and it comigrates with iPLA2β short in transfected COS cells. B: serially increasing amounts of cell extracts from GEC-iPLA2β and GEC-Neo were incubated with [14C]phosphatidylethanolamine (PE) for 45 min at 37°C in the absence of Ca2+. The data were analyzed using 2-way ANOVA. P < 0.05 iPLA2β vs. Neo, 6 measurements.

 

   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
C5b-9 induces Ca2+-independent release of [3H]AA in GEC. Previous studies demonstrated that in GEC, assembly of C5b-9 leads to an increase in cytosolic Ca2+ concentration, which is primarily due to Ca2+ influx (20). Furthermore, Ca2+ influx activates the Ca2+-dependent cPLA2, leading to release of [3H]AA (37). In the first set of experiments, we assessed whether C5b-9 could also induce [3H]AA release in the absence of Ca2+ influx. Since antibody-dependent activation of complement (i.e., the classic pathway) is Ca2+dependent, we incubated antibody-sensitized GEC with C8DS in the presence of Ca2+. As a second step, GEC were incubated with or without purified C8 and C9 without Ca2+ (i.e., in the presence of EGTA). The C8DS leads to assembly of the nascent C5b-7 complex, while addition of C8 and C9 allows assembly of the C5b-9 transmembrane channel (in the absence of Ca2+). Formation of C5b-9 resulted in a significant release of [3H]AA, suggesting activation of an iPLA2 (Fig. 1A). C5b-9 also increased [3H]DAG (Fig. 1A), which reflects activation of phospholipase C.


Figure 1
View larger version (8K):
[in this window]
[in a new window]

  		Fig. 1. A: C5b-9 induces Ca2+-independent release of [3H]arachidonic acid (AA) in glomerular epithelial cells (GEC). GEC, labeled with [3H]AA, were incubated with antibody and 10% C8-deficient serum (C8DS) in buffer containing 0.5 mM Ca2+ for 40 min. Then, GEC were washed and then incubated with or without purified C8 (2.0 µg/ml) and C9 (1.5 µg/ml; to assemble C5b-9) in buffer containing 1 mM EGTA. [3H]AA, and [3H]DAG were measured after 40 min. *P < 0.025 C8DS+C8+C9 vs. C8DS alone, 5 experiments. B: GEC, loaded with fura 2, were placed in buffer containing 2 mM EGTA. Ionomycin (5 µM) was added after 3 (top) or 23 min (bottom), and fura 2 fluorescence was monitored for at least another 7 min. Results are presented as the ratio (R) of fluorescence at 340/380-nm excitation, which is proportional to intracellular Ca2+ concentration. Tracings are representative of 3 experiments.

 
It should be noted that the incubation of GEC with C8 and C9 in buffer containing EGTA not only results in chelation of extracellular Ca2+ but would most likely also result in depletion of intracellular Ca2+ stores. To verify this effect of EGTA, we measured changes in intracellular Ca2+ concentration by monitoring fluorescence of the Ca2+ indicator fura 2. Addition of ionomycin to GEC in buffer containing 2 mM EGTA resulted in a Ca2+ spike, reflecting release of Ca2+ from intracellular storage sites (Fig. 1B, top). In contrast, if GEC were preincubated with 2 mM EGTA for 20 min before the addition of ionomycin, the Ca2+ spike was almost completely abolished (Fig. 1B, bottom), indicating that intracellular Ca2+ stores were depleted. In preliminary studies, we determined that a 40-min incubation after the addition of C8 and C9 to the GEC with assembled C5b-7 complexes was required to increase free [3H]AA significantly. Thus the effect of C5b-9 on [3H]AA occurred while Ca2+ stores were largely depleted.

Expression of iPLA2 isoforms. Several isoforms of the group VI iPLA2 enzyme have been described, including iPLA2β long, iPLA2β short, and iPLA2{gamma}. To confirm endogenous expression of iPLA2 in cultured rat GEC, as well as in rat glomeruli, RT-PCR was performed using primers to regions flanking exon 9 of the iPLA2β isoform, and the coding sequence of iPLA2{gamma} (Fig. 2). PCR products consistent with iPLA2β short (Fig. 2A), as well as iPLA2{gamma} (Fig. 2B) were identified in GEC and glomeruli, and identities were confirmed by purification of bands and DNA sequencing. It should be noted that iPLA2β RT-PCR in GEC and glomeruli showed additional faint bands, with a band that appeared to correspond to the predicted PCR product for iPLA2β long. However, we were not able to confirm the identity of this band by purification and DNA sequencing, so it is not possible to make a firm conclusion regarding expression of iPLA2β long.


Figure 2
View larger version (29K):
[in this window]
[in a new window]

  		Fig. 2. Expression of iPLA2. Endogenous expression of calcium-independent PLA2 (iPLA2β; A) and iPLA2{gamma} mRNAs (B) in GEC and rat glomeruli was assessed using RT-PCR. Glomeruli were isolated from adult rat kidneys by differential sieving. Control lanes (–) were devoid of reverse transcriptase. A: GEC express iPLA2β short mRNA and possibly some iPLA2β long. iPLA2β RT-PCR in Chinese hamster ovary cells (CHO), which express only the short isoform (577 bp), is shown for comparison. B: GEC express iPLA2{gamma} mRNA. Expression of iPLA2 mRNAs in glomeruli is similar to expression in GEC (A and B). Expression of iPLA2β (C) and iPLA2{gamma} proteins (D) in GEC and glomeruli was assessed by immunoblotting. COS cells transfected with iPLA2β short and long isoforms (C) and COS cells transfected with iPLA2{gamma} (D) are shown for comparison. C: GEC express an immunoreactive iPLA2β protein, whose molecular mass appears in between the long and short isoforms expressed by COS cells. D: GEC express iPLA2{gamma}. The lower molecular mass bands in glomeruli and GEC (C), and COS-iPLA2{gamma} (D) are probably nonspecific.

 
iPLA2 protein expression was studied by immunoblotting. GEC and glomeruli express iPLA2β, and on SDS-PAGE, migration of this protein was slightly retarded, compared with COS cells transfected with iPLA2β short (Fig. 2C). Nevertheless, the protein migrated faster than the iPLA2β long isoform. iPLA2{gamma} has four potential translational initiation sites, yielding proteins of 88, 77, 74, and 63 kDa, respectively (47). GEC and glomeruli predominantly express the 88-kDa isoform of iPLA2{gamma} (Fig. 2D).

Overexpression of iPLA2 enzymes. To strengthen the link between complement and iPLA2 activation, we transfected GEC with iPLA2{gamma} and iPLA2β short cDNAs. Clones were screened for stable expression by immunoblotting. Several clones of GEC transfected with iPLA2{gamma} (GEC-iPLA2{gamma}) expressed the 88-, 77-, and 74-kDa isoforms of the enzyme (Fig. 3A). Clones that express iPLA2β short (GEC-iPLA2β) were also produced, and a representative clone is presented (Fig. 4A). It should be noted that the transfected enzyme migrates slightly faster than the endogenous isoform.

To ensure that the expressed iPLA2 proteins were enzymatically active, we further tested the extracts of stable subclones for iPLA2 activity, as monitored by release of [14C]AA from exogenous [14C]arachidonyl-PE. GEC transfected with iPLA2{gamma} (Fig. 3B) or iPLA2β short (Fig. 4B) showed augmented [14C]AA release in a concentration-dependent manner, compared with GEC-Neo. Interestingly, release of [14C]AA from exogenous [14C]PC was relatively weak (data not shown), suggesting that at least in our assay system, [14C]PE is a preferred substrate for iPLA2. This observation is in keeping with an earlier study (35).

Stimulus-coupled [3h]AA release in GEC stably transfected with iPLA2{gamma}. The effect of complement on [3H]AA release was studied in GEC-iPLA2{gamma} and was compared with GEC-Neo. GEC-iPLA2{gamma} tended to have slightly increased basal levels of free [3H]AA, in keeping with previous studies (35). Complement stimulated [3H]AA release in GEC-Neo, whereas overexpression of iPLA2{gamma} enhanced complement-mediated [3H]AA release significantly (Fig. 5A). As expected, complement-mediated [3H]AA release in GEC-iPLA2{gamma} was inhibited significantly by the iPLA2{gamma}-directed inhibitor BEL (1) (Fig. 5A). This result confirms that in these cells, a significant portion of complement-dependent [3H]AA release is due to iPLA2{gamma} activity. BEL did not have a significant effect on [3H]AA release in control cells, suggesting that this [3H]AA release may have been mediated by another PLA2, e.g., cPLA2 (18, 37).

In previous studies, we demonstrated that in GEC, C5b-9 can induce [3H]AA release by activating cPLA2 (37). BEL was shown to have an inhibitory concentration (IC50) 250-fold greater for iPLA2 over cPLA2 (1); nevertheless, we wanted to rule out the possibility that BEL had inhibited cPLA2. To determine whether BEL could affect cPLA2 activity, we monitored PLA2 activity in COS cells that had been transiently transfected with cPLA2. In the presence of 1 mM EGTA (Ca2+-free buffer), PLA2 activity in COS cell extracts was low (Table 1). In the presence of 2 mM free Ca2+, PLA2 activity increased more than sixfold, reflecting Ca2+-dependent activation of cPLA2. PLA2 activity was not affected by BEL in Ca2+-replete buffer, indicating that BEL is not an effective inhibitor of cPLA2 activity (Table 1).


View this table:
[in this window]
[in a new window]

  		Table 1. Effect of BEL on cPLA2 activity

 
For comparison, we also studied how other stimuli that may injure GEC may affect free [3H]AA. Overexpression of iPLA2{gamma} enhanced release of [3H]AA by H2O2 (Fig. 5B), and by chemical anoxia/reexposure to glucose (recovery), an in vitro model of ischemia-reperfusion injury (24) (Fig. 5C). These effects of H2O2 (Fig. 5B) and anoxia/recovery (Fig. 5C) in GEC-iPLA2{gamma} were reduced by BEL, although the effect did not reach statistical significance in the case of H2O2. Thus iPLA2{gamma} is involved in stimulus-coupled [3H]AA release, as the liberation of [3H]AA in response to complement, H2O2 and chemical anoxia/recovery is, at least in part, mediated by iPLA2{gamma}.

In previous studies, we demonstrated that overexpression of cPLA2 in GEC (~5- to 10-fold above endogenous levels) amplified the C5b-9-dependent release of [3H]AA (18, 37). In contrast, the increases in free [3H]AA induced by H2O2 or anoxia/recovery (Fig. 5, B and C) were not amplified in GEC that overexpress cPLA2 (Table 2), suggesting lack of involvement of cPLA2. Furthermore, these increases in [3H]AA were attenuated in the presence of BEL (Table 2). Together, the results suggest that iPLA2{gamma} (and possibly other iPLA2s), but not cPLA2, is activated by H2O2 and anoxia/recovery, whereas both iPLA2{gamma} and cPLA2 are activated by complement.


View this table:
[in this window]
[in a new window]

  		Table 2. Effects of H2O2 or anoxia/recovery on free [3H]AA

 
In some cells, AA may be derived from metabolism of DAG. Thus, in the above experiments, we also monitored changes in [3H]DAG. Complement (Fig. 1), H2O2, and anoxia/recovery (data not shown) increased [3H]DAG production, but the increases were not affected by iPLA2{gamma} overexpression (data not shown). Furthermore, BEL did not reduce [3H]DAG production (data not shown), even though BEL is reported to inhibit phosphatidic acid phosphohydrolase, which mediates generation of DAG from phosphatidic acid. Based on these results, it is unlikely that inhibition of DAG production was the mechanism by which BEL attenuated AA release in GEC.

iPLA2-dependent AA release is coupled to production of PGE2. The above experiments demonstrated that complement can induce release of [3H]AA via activation of iPLA2{gamma}. In the next set of experiments, we investigated whether free AA could be metabolized via COX to eicosanoids. We monitored production of PGE2, which was shown to be a major metabolite of COX in GEC (45). GEC-Neo produced a small amount of PGE2 in response to complement, which appeared to be inhibited by indomethacin but not by BEL (HIS: 16 ± 9, HIS/BEL: 7 ± 4, NS: 46 ± 15, NS/BEL: 50 ± 14, NS/Indo: 18 ± 2 pg/ml) (Fig. 6). However, when analyzed together with GEC-iPLA2{gamma}, these changes were not statistically significant. Overexpression of iPLA2{gamma} did not affect basal PGE2 production significantly during short-term incubation (Fig. 6, 60-min incubation), while there was a small increase in PGE2 in culture media of GEC-iPLA2{gamma}, compared with GEC-Neo, after 2 days of cell culture (GEC-Neo: 284 ± 47 pg/ml, GEC-iPLA2{gamma}: 519 ± 8 pg/ml, P < 0.05, 3 experiments). However, after incubation with complement, PGE2 production was ~20-fold greater in GEC-iPLA2{gamma} relative to GEC-Neo (Fig. 6). The effect of complement was inhibited significantly by BEL and by the nonselective COX inhibitor indomethacin (Fig. 6). Thus complement-induced production of PGE2 parallels the release of [3H]AA (Fig. 5A).


Figure 6
View larger version (7K):
[in this window]
[in a new window]

  		Fig. 6. Complement-induced production of PGE2 is enhanced in GEC that overexpress GEC-iPLA2{gamma}. Incubation with complement is described in Fig. 5. In some experiments, BEL (25 µM) or the COX inhibitor indomethacin (10 µM) were included in the incubations. GEC-iPLA2{gamma} produced significantly more PGE2 than GEC-Neo in response to complement, and this increase was attenuated by the addition of BEL or indomethacin. *P < 0.0001 GEC-iPLA2{gamma} vs. GEC-Neo (NS), **P < 0.0001 NS/BEL vs. NS (GEC-iPLA2{gamma}), +P < 0.0001 NS/indomethacin vs. NS (GEC-iPLA2{gamma}), 5 experiments.

 
Overexpression of iPLA2{gamma} limits complement-mediated GEC injury. We reported previously that overexpression of cPLA2 in GEC increased the susceptibility to complement-mediated cytotoxicity (18). We next tested whether overexpression of iPLA2{gamma} has a similar effect. Complement-mediated cytotoxicity was monitored as the release of LDH. Antibody-sensitized GEC-Neo or GEC-iPLA2{gamma} were incubated with normal serum at serially increasing concentrations (to assemble C5b-9) for 100 min. The protocol allows for complement to activate iPLA2, but with increasing incubation time and complement dose, a portion of the cells will undergo lysis. LDH release was attenuated significantly in GEC-iPLA2{gamma}, compared with GEC-Neo (Fig. 7A). Further studies in GEC-iPLA2{gamma} showed that the cytoprotective effect of iPLA2{gamma} was reversed by the addition of BEL, and to a lesser extent by the addition of indomethacin (Fig. 8A). Indomethacin did not reverse the cytoprotective effect of iPLA2{gamma} completely, despite complete inhibition of PGE2 production (Fig. 6). Therefore, part of the cytoprotective effect of iPLA2{gamma} may have been independent of eicosanoid production. In keeping with previous results, GEC-Neo tended to be protected by the addition of indomethacin, since the activation of other PLA2s by complement was shown to involve mobilization of AA and downstream metabolism to bioactive eicosanoids with a cytotoxic effect (46).


Figure 7
View larger version (13K):
[in this window]
[in a new window]

  		Fig. 7. Overexpression of iPLA2{gamma} (A), or iPLA2β (B) limits complement-mediated GEC injury. GEC-iPLA2{gamma}, GEC-iPLA2β, and GEC-Neo were incubated with anti-GEC antiserum and then with 2.5, 5.0, or 7.5% NS for 100 min (HIS in control incubations). Cell injury was monitored as release of LDH. A: *P < 0.0001 GEC-iPLA2{gamma} vs. GEC-Neo (5.0% NS), **P < 0.025 GEC-iPLA2{gamma} vs. GEC-Neo (7.5% NS), 3 experiments. Similar results were obtained when these experiments were performed using another GEC-Neo clone. B: *P < 0.005 GEC-iPLA2β vs. GEC-Neo (2.5% NS), **P < 0.0001 GEC-iPLA2β vs. GEC-Neo (5.0% NS), +P < 0.0001 GEC-iPLA2β vs. GEC-Neo (7.5% NS), 4 experiments.

 
To further elucidate which COX enzyme was responsible for the cytoprotective effect of iPLA2{gamma}, we included isoform-specific COX inhibitors NS 398 (COX-2) and SC560 (COX-1) in incubations with complement (Fig. 8B). Both inhibitors partially reversed the cytoprotective effect of iPLA2{gamma}, suggesting that both COX isoforms were involved. Previously, we showed that C5b-9 upregulates the expression of COX-2 in GEC, although expression of COX-1 was not affected (45). Interestingly, COX-2 was upregulated in resting GEC-iPLA2{gamma}, i.e., independently of a complement effect (Fig. 9A). In contrast, expression of COX-1 was not significantly different between GEC-iPLA2{gamma} and GEC-Neo (Fig. 9B). These results provide further support for the view that following activation of iPLA2{gamma}, both COX enzymes are involved in metabolism of AA.


Figure 9
View larger version (34K):
[in this window]
[in a new window]

  		Fig. 9. Expression of cyclooxygenase 2 (COX-2), but not COX-1, is upregulated in GEC-iPLA2{gamma}. Representative immunoblots demonstrate expression of COX-2 (A) and COX-1 proteins (B) in GEC-Neo and GEC-iPLA2{gamma}. Expression in transiently transfected COS cells is shown for comparison.

 
In GEC, the principal receptor for PGE2 is EP4 (3), and earlier studies have demonstrated that signaling via EP4 is cytoprotective (3). Overexpression of iPLA2{gamma} in GEC did not, however, affect expression of EP4 receptor mRNA (Fig. 10). Thus the cytoprotective effect of iPLA2{gamma} and eicosanoids most likely occurs independently of changes in EP4 receptor expression.


Figure 10
View larger version (32K):
[in this window]
[in a new window]

  		Fig. 10. EP4 receptor mRNA is expressed in GEC-Neo and GEC-iPLA2{gamma}. Semiquantitative RT-PCR demonstrates that there are no significant differences in the amount of EP4 receptor mRNA in the 2 cell lines. β-actin was used as a loading control.

 
Role of iPLA2β in complement-dependent GEC injury. By analogy to the studies that addressed iPLA2{gamma} (described above), we employed GEC-iPLA2β to study complement-mediated effects on [3H]AA release and cell injury. In contrast to GEC-iPLA2{gamma}, there was no amplification of complement-mediated [3H]AA release in GEC-iPLA2β. Levels of free [3H]AA in GEC-Neo and GEC-iPLA2β after exposure to HIS were 1.5 ± 0.2 and 2.5 ± 0.3% of total radioactivity, respectively, while after exposure to NS, [3H]AA increased to 4.1 ± 0.7 (P < 0.0001) and 3.3 ± 0.2% of total radioactivity, respectively (the increase in GEC-iPLA2β was not statistically significant; 3 experiments). After incubation of antibody-sensitized GEC with serially increasing concentrations of complement, LDH release was attenuated significantly in GEC-iPLA2β, compared with GEC-Neo (Fig. 7B). However, in contrast to GEC-iPLA2{gamma}, neither BEL nor indomethacin reversed the protective effect of iPLA2β (Fig. 8C). Thus, while overexpression of iPLA2β in GEC was not involved in complement-induced [3H]AA release, it was nonetheless cytoprotective.


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
The present study demonstrates that in GEC, assembly of C5b-9 resulted in a significant release of [3H]AA in Ca2+-free medium, suggesting activation of an iPLA2 (Fig. 1). GEC endogenously express iPLA2β short, although on SDS-PAGE, the protein appeared to be slightly greater in molecular mass, compared with transfected iPLA2β short in COS cells (Fig. 2). Perhaps the endogenous iPLA2β short undergoes a posttranslational modification in GEC, which accounts for the slight increase in size. GEC also express the 88-kDa isoform of iPLA2{gamma} (Fig. 2). Both iPLA2β short and iPLA2{gamma} were also expressed in isolated normal glomeruli (Fig. 2). Overexpression of iPLA2{gamma} in GEC augmented complement-dependent [3H]AA release, compared with GEC-Neo, and furthermore the [3H]AA release in GEC-iPLA2{gamma} was attenuated by BEL (Fig. 5). These results indicate that activation of complement is coupled with the activation of iPLA2{gamma}. It should also be noted that the AA mobilized by iPLA2{gamma} was accessible to COX and could be metabolized to prostanoids (Fig. 6). An earlier study also showed coupling of iPLA2{gamma} with COX-1 in HEK293 cells (35). In contrast to iPLA2{gamma}, overexpression of iPLA2β in GEC did not amplify complement-dependent [3H]AA release.

By analogy to iPLA2{gamma}, overexpression of cPLA2 in GEC was previously shown to augment complement-dependent [3H]AA release and prostanoid production, compared with GEC-Neo. However, overexpression of group IIA sPLA2 in GEC was similar to iPLA2β, i.e., neither enzyme amplified complement-dependent [3H]AA release (37). Previous studies also demonstrated that complement induces serine505 phosphorylation of cPLA2 in GEC, in association with an increase in enzymatic activity (18) and that glomerular cPLA2 is phosphorylated in PHN (21). This posttranslational modification of cPLA2 , which is generally associated with activation, has been described with multiple agonists (27). iPLA2{gamma} activity has been reported to increase after stimulation with PMA or ATP, but the mechanism is unknown at present and will require further study (16, 28). An alternate mechanism of iPLA2{gamma} activation may involve modification of phospholipids (e.g., by C5b-9-induced deformability of the membrane lipid bilayer, or by lipid peroxidation) (9, 36), such that there is increased substrate availability to iPLA2{gamma}. The overexpression models of the various PLA2s are invaluable in defining links of C5b-9 assembly with PLA2 isoform activation. We have expressed these PLA2s at levels modestly above endogenous, but the results need to be interpreted with some caution. Furthermore, overexpression does not allow for a direct comparison of the amounts of [3H]AA release by cPLA2 vs. iPLA2. Nevertheless, release of [3H]AA by complement in the presence of Ca2+ was substantially greater than that in the absence of Ca2+ (37), and overexpression of cPLA2 generally resulted in a greater amplification of complement-dependent [3H]AA release, compared with iPLA2{gamma}. Thus it is likely that cPLA2 is a quantitatively more important enzyme than iPLA2{gamma}.

To further address the potential functional importance of iPLA2 in GEC, we examined the effects of H2O2 and anoxia/recovery on [3H]AA release. Both of these stimuli model effects of ischemia-reperfusion injury in cultured cells (24). By analogy to complement, overexpression of iPLA2{gamma} enhanced release of [3H]AA by H2O2 and by anoxia/recovery (Fig. 5), providing further support for the view that iPLA2{gamma} activity can be enhanced by specific stimuli, including ischemia-reperfusion. In contrast to complement, the increases in free [3H]AA induced by H2O2 or anoxia/recovery (Fig. 5, B and C) were not amplified in GEC that overexpress cPLA2 (Table 2). Other studies have demonstrated that release of AA in response to H2O2 was mediated by cPLA2 in renal tubular epithelial and mesangial cells (26, 41). Thus H2O2-coupled AA mobilization may be cell specific (10).

Various PLA2 enzymes have been shown to regulate pathways of cell injury in several experimental disease models (5, 11, 12, 15, 39). In vivo, assembly of C5b-9 in GEC is associated with sublethal GEC injury and proteinuria; however, it is not practical to assay proteinuria in cell culture models. Instead, in cultured GEC, we have assayed C5b-9-mediated injury as cytolysis (LDH release), and it has been shown that cytolysis in culture correlates with proteinuria in vivo, in the context of injury associated with generation of prostanoids (46), p38 activation (3), and ER stress (22). The present study demonstrates that overexpression of iPLA2{gamma} attenuated complement-induced GEC injury, and the effect was reversed by BEL (Fig. 8). In addition, the attenuation of complement-induced GEC injury was partially reversed in the presence of a nonselective COX inhibitor, as well as with selective inhibitors of the COX-1 and -2 isozymes (Fig. 8). Thus cytoprotection was, at least in part, mediated via generation of prostanoids, most likely through both COX-1 and COX-2. In support of this view are our earlier results, which show that GEC express COX-1 constitutively and that C5b-9 induces COX-2 expression (45). Interestingly, while GEC-iPLA2{gamma} also express COX-1 constitutively, expression of COX-2 was markedly upregulated in these cells under basal conditions (Fig. 9). The mechanism by which iPLA2{gamma} may be enhancing basal COX-2 expression will require elucidation, but it is noteworthy that similar COX-2 upregulation was observed in HEK293 cells overexpressing iPLA2{gamma} and stimulated with interleukin-1β/fetal calf serum (35). However, despite the increase in basal COX-2 expression in GEC-iPLA2{gamma}, basal PGE2 production was modestly increased in these cells only after long term culture (Fig. 6), indicating that the AA substrate was rate limiting. COX inhibitors did not enhance complement-induced injury in GEC-Neo and actually tended to reduce cytotoxicity (Fig. 8). This result is in keeping with earlier studies in GEC-Neo, which showed that COX inhibitors protected the cells from complement-induced cell death. Finally, it should be noted that inhibition of COX in PHN in vivo with nonselective or with COX-2-selective inhibitors reduced proteinuria (45, 46).

There would seem to be an apparent contradiction in that production of prostanoids was cytoprotective in GEC-iPLA2{gamma} but exacerbated cytotoxicity in other GEC lines (46). Possibly, individual prostanoids downstream of COX (and/or intracellular localization of their production) are responsible for inducing a cytoprotective vs. cytotoxic effect. For example, in earlier studies in GEC-Neo, where COX inhibition protected the cells from complement-induced injury, the protective effect of the COX inhibitor could be reversed by the addition of a thromboxane A2 analog, but not PGE2 (46). Among the PGE2 receptors, GEC predominantly express EP4 as well as some EP1 receptors (3). Previously, it was demonstrated that exogenous PGE2 was protective against apoptosis induced by serum deprivation and that these effects were reversed by an EP4 receptor antagonist. Moreover, exogenous PGE2 could also attenuate puromycin aminonucleoside-induced GEC injury, indicating that PGE2 is cytoprotective (3). In the present study, we have shown that GEC-iPLA2{gamma} express EP4 receptor mRNA, at levels similar to GEC-Neo (Fig. 10). Thus a PGE2-EP4 receptor pathway could mediate the cytoprotective effect of iPLA2{gamma} in complement-dependent injury. Further studies will be required to confirm this hypothesis more directly.

In GEC-iPLA2{gamma}, BEL reversed the cytoprotective effect of iPLA2 to a greater extent than indomethacin (Fig. 8), suggesting that mechanisms distinct from AA metabolism, but nonetheless related to iPLA2 catalytic activity, also contributed to the cytoprotective effects of iPLA2. One possible mechanism is that the iPLA2 enzyme facilitates activation of the ER stress response, a cytoprotective response shown to be activated in GEC exposed to complement C5b-9 (22). At least some iPLA2{gamma} isoforms may be localized at the membrane of the ER (17); consequently, iPLA2{gamma} could perturb the ER membrane sufficiently to initiate the ER stress response, which may limit complement-induced injury. Additional studies will be required to determine the subcellular localization of iPLA2{gamma} in GEC, in particular, whether iPLA2{gamma} is found at the ER. Of interest, iPLA2{gamma} protected mitochondria in renal proximal tubular cells from oxidant-induced lipid peroxidation and dysfunction (28), and iPLA2{gamma} knockout mice show defects in mitochondrial functions and mitochondrial lipid composition (32). Thus mitochondria are another potential target of iPLA2{gamma} in GEC.

The present study demonstrates that overexpression of iPLA2β in GEC also attenuated complement-induced GEC injury (Fig. 7), and this effect occurred in the absence of stimulated [3H]AA release and was not blocked by acute incubation with BEL and indomethacin (Fig. 8). Another study failed to demonstrate stimulus-coupled AA release with iPLA2β, but there are also reports of protein kinase C and calmodulin involvement in iPLA2β activation (2, 5). In the absence of complement-induced [3H]AA release or acute inhibition, our results suggest that overexpression of iPLA2β may have induced "preconditioning" of GEC, such that the cells were able to resist complement-mediated injury. There were no significant differences in basal free [3H]AA levels between GEC-Neo and GEC-iPLA2β, but it is possible that there was enhanced turnover of [3H]AA in the latter. This view is consistent with earlier studies, which have determined that iPLA2β may be involved in both deacylation of membrane phospholipids and production of lysophospholipid acceptors (4, 6, 8). The mechanisms of phospholipid metabolism and cytoprotection in GEC-iPLA2β will require further study.

While the role of complement in the PHN model of membranous nephropathy is appreciated, the ensuing biological changes in GEC are complex and include both proinjurious and protective stimuli (19). The role of PLA2s in complement-mediated GEC injury has been addressed in a number of studies (19). The present study suggests that in addition to cPLA2, iPLA2 may be involved in the pathogenesis of PHN, as complement-mediated GEC injury was reduced in the context of iPLA2 overexpression. Based on previous studies, there are cytoprotective and injurious aspects related to the complement-mediated activation of cPLA2 and production of prostanoids, in both cell culture and in vivo models. Further studies will be required to delineate these effects more precisely and define the interplay between the various PLA2 isoforms. Current treatment approaches to idiopathic membranous nephropathy are nonspecific and not very effective. Modulation of specific PLA2 family enzymes may represent a mechanism of limiting GEC injury and maintaining the integrity of the permselective barrier.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This study was supported by grants from the Canadian Institute of Health Research (A. V. Cybulsky, T. Takano) and Kidney Foundation of Canada (A. V. Cybulsky, T. Takano), scholarships from the Fonds de la Recherche en Santé du Québec (A. V. Cybulsky, T. Takano), and the Catherine McLaughlin Hakim Chair (A. V. Cybulsky).


   FOOTNOTES
 

Address for reprint requests and other correspondence: T. Takano, Div. of Nephrology, McGill Univ., 3775 Univ. St., Rm. 236, Montreal, Quebec, Canada H3A2B4 (e-mail: tomoko.takano{at}mcgill.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* A. V. Cybulsky and T. Takano contributed equally to this work. Back


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Ackermann EJ, Conde-Frieboes K, Dennis EA. Inhibition of macrophage Ca2+-independent phospholipase A2 by bromoenol lactone and trifluoromethyl ketones. J Biol Chem 270: 445–450, 1995.[Abstract/Free Full Text]
  2. Akiba S, Sato T. Cellular function of calcium-independent phospholipase A2. Biol Pharm Bull 27: 1174–1178, 2004.[CrossRef][Web of Science][Medline]
  3. Aoudjit L, Potapov A, Takano T. Prostaglandin E2 promotes cell survival of glomerular epithelial cells via the EP4 receptor. Am J Physiol Renal Physiol 290: F1534–F1542, 2006.[Abstract/Free Full Text]
  4. Baburina I, Jackowski S. Cellular responses to excess phospholipid. J Biol Chem 274: 9400–9408, 1999.[Abstract/Free Full Text]
  5. Balsinde J, Balboa MA. Cellular regulation and proposed biological functions of group VIA calcium-independent phospholipase A2 in activated cells. Cell Signal 17: 1052–1062, 2005.[CrossRef][Web of Science][Medline]
  6. Balsinde J, Balboa MA, Dennis EA. Antisense inhibition of group VI Ca2+-independent phospholipase A2 blocks phospholipid fatty acid remodeling in murine P388D1 macrophages. J Biol Chem 272: 29317–29321, 1997.[Abstract/Free Full Text]
  7. Bao S, Miller DJ, Ma Z, Wohltmann M, Eng G, Ramanadham S, Moley K, Turk J. Male mice that do not express group VIA phospholipase A2 produce spermatozoa with impaired motility and have greatly reduced fertility. J Biol Chem 279: 38194–38200, 2004.[Abstract/Free Full Text]
  8. Barbour SE, Kapur A, Deal CL. Regulation of phosphatidylcholine homeostasis by calcium-independent phospholipase A2. Biochim Biophys Acta 1439: 77–88, 1999.[Medline]
  9. Bhakdi S, Tranum-Jensen J. Membrane damage by complement. Biochim Biophys Acta 737: 343–372, 1983.[Medline]
  10. Birbes H, Gothie E, Pageaux JF, Lagarde M, Laugier C. Hydrogen peroxide activation of Ca2+-independent phospholipase A2 in uterine stromal cells. Biochem Biophys Res Commun 276: 613–618, 2000.[CrossRef][Web of Science][Medline]
  11. Bonventre JV. The 85-kD cytosolic phospholipase A2 knockout mouse: a new tool for physiology and cell biology. J Am Soc Nephrol 10: 404–412, 1999.[Free Full Text]
  12. Chilton F. Would the real role(s) for secretory PLA2s please stand up. J Clin Invest 97: 2161–2162, 1996.[Medline]
  13. Chiu CH, Jackowski S. Role of calcium-independent phospholipases (iPLA2) in phosphatidylcholine metabolism. Biochem Biophys Res Commun 287: 600–606, 2001.[CrossRef][Web of Science][Medline]
  14. Coers W, Reivinen J, Miettinen A, Huitema S, Vos JT, Salant DJ, Weening JJ. Characterization of a rat glomerular visceral epithelial cell line. Exp Nephrol 4: 184–192, 1996.[Web of Science][Medline]
  15. Cummings BS, McHowat J, Schnellmann RG. Phospholipase A2s in cell injury and death. J Pharmacol Exp Ther 294: 793–799, 2000.[Abstract/Free Full Text]
  16. Cummings BS, McHowat J, Schnellmann RG. Role of an endoplasmic reticulum Ca2+-independent phospholipase A2 in cisplatin-induced renal cell apoptosis. J Pharmacol Exp Ther 308: 921–928, 2004.[Abstract/Free Full Text]
  17. Cummings BS, McHowat J, Schnellmann RG. Role of an endoplasmic reticulum Ca2+-independent phospholipase A2 in oxidant-induced renal cell death. Am J Physiol Renal Physiol 283: F492–F498, 2002.[Abstract/Free Full Text]
  18. Cybulsky AV, Monge JC, Papillon J, McTavish AJ. Complement C5b-9 activates cytosolic phospholipase A2 in glomerular epithelial cells. Am J Physiol Renal Fluid Electrolyte Physiol 269: F739–F749, 1995.[Abstract/Free Full Text]
  19. Cybulsky AV, Quigg RJ, Salant DJ. Experimental membranous nephropathy redux. Am J Physiol Renal Physiol 289: F660–F671, 2005.[Abstract/Free Full Text]
  20. Cybulsky AV, Salant DJ, Quigg RJ, Badalamenti J, Bonventre JV. Complement C5b-9 complex activates phospholipases in glomerular epithelial cells. Am J Physiol Renal Fluid Electrolyte Physiol 257: F826–F836, 1989.[Abstract/Free Full Text]
  21. Cybulsky AV, Takano T, Papillon J, Bijian K, Guillemette J. Activation of the extracellular signal-regulated kinase by complement C5b-9. Am J Physiol Renal Physiol 289: F593–F603, 2005.[Abstract/Free Full Text]
  22. Cybulsky AV, Takano T, Papillon J, Khadir A, Liu J, Peng H. Complement C5b-9 membrane attack complex increases expression of endoplasmic reticulum stress proteins in glomerular epithelial cells. J Biol Chem 277: 41342–41351, 2002.[Abstract/Free Full Text]
  23. Cybulsky AV, Takano T, Papillon J, McTavish AJ. Complement-induced phospholipase A2 activation in experimental membranous nephropathy. Kidney Int 57: 1052–1062, 2000.[CrossRef][Web of Science][Medline]
  24. Dagher PC.1. Modeling ischemia in vitro: selective depletion of adenine and guanine nucleotide pools. Am J Physiol Cell Physiol 279: C1270–C1277, 2000.[Abstract/Free Full Text]
  25. Gadd ME, Broekemeier KM, Crouser ED, Kumar J, Graff G, Pfeiffer DR. Mitochondrial iPLA2 activity modulates the release of cytochrome c from mitochondria and influences the permeability transition. J Biol Chem 281: 6931–6939, 2006.[Abstract/Free Full Text]
  26. Han WK, Sapirstein A, Hung CC, Alessandrini A, Bonventre JV. Cross-talk between cytosolic phospholipase A2 alpha (cPLA2 alpha) and secretory phospholipase A2 (sPLA2) in hydrogen peroxide-induced arachidonic acid release in murine mesangial cells: sPLA2 regulates cPLA2 alpha activity that is responsible for arachidonic acid release. J Biol Chem 278: 24153–24163, 2003.[Abstract/Free Full Text]
  27. Hirabayashi T, Shimizu T. Localization and regulation of cytosolic phospholipase A2. Biochim Biophys Acta 1488: 124–138, 2000.[Medline]
  28. Kinsey GR, McHowat J, Beckett CS, Schnellmann RG. Identification of calcium-independent phospholipase A2{gamma} in mitochondria and its role in mitochondrial oxidative stress. Am J Physiol Renal Physiol 292: F853–F860, 2007.[Abstract/Free Full Text]
  29. Larsson PK, Claesson HE, Kennedy BP. Multiple splice variants of the human calcium-independent phospholipase A2 and their effect on enzyme activity. J Biol Chem 273: 207–214, 1998.[Abstract/Free Full Text]
  30. Mancuso DJ, Abendschein DR, Jenkins CM, Han X, Saffitz JE, Schuessler RB, Gross RW. Cardiac ischemia activates calcium-independent phospholipase A2beta, precipitating ventricular tachyarrhythmias in transgenic mice: rescue of the lethal electrophysiologic phenotype by mechanism-based inhibition. J Biol Chem 278: 22231–22236, 2003.[Abstract/Free Full Text]
  31. Mancuso DJ, Jenkins CM, Sims HF, Cohen JM, Yang J, Gross RW. Complex transcriptional and translational regulation of iPLAgamma resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization. Eur J Biochem 271: 4709–4724, 2004.[Web of Science][Medline]
  32. Mancuso DJ, Sims HF, Han X, Jenkins CM, Guan SP, Yang K, Moon SH, Pietka T, Abumrad NA, Schlesinger PH, Gross RW. Genetic ablation of calcium-independent phospholipase A2gamma leads to alterations in mitochondrial lipid metabolism and function resulting in a deficient mitochondrial bioenergetic phenotype. J Biol Chem 282: 34611–34622, 2007.[Abstract/Free Full Text]
  33. Mundel P, Shankland SJ. Podocyte biology and response to injury. J Am Soc Nephrol 13: 3005–3015, 2002.[Free Full Text]
  34. Murakami M, Kudo I. Phospholipase A2. J Biochem (Tokyo) 131: 285–292, 2002.[Abstract/Free Full Text]
  35. Murakami M, Masuda S, Ueda-Semmyo K, Yoda E, Kuwata H, Takanezawa Y, Aoki J, Arai H, Sumimoto H, Ishikawa Y, Ishii T, Nakatani Y, Kudo I. Group VIB Ca2+-independent phospholipase A2gamma promotes cellular membrane hydrolysis and prostaglandin production in a manner distinct from other intracellular phospholipases A2. J Biol Chem 280: 14028–14041, 2005.[Abstract/Free Full Text]
  36. Neale TJ, Ojha PP, Exner M, Poczewski H, Ruger B, Witztum JL, Davis P, Kerjaschki D. Proteinuria in passive Heymann nephritis is associated with lipid peroxidation and formation of adducts on type IV collagen. J Clin Invest 94: 1577–1584, 1994.[Web of Science][Medline]
  37. Panesar M, Papillon J, McTavish AJ, Cybulsky AV. Activation of phospholipase A2 by complement C5b-9 in glomerular epithelial cells. J Immunol 159: 3584–3594, 1997.[Abstract]
  38. Pavenstadt H, Kriz W, Kretzler M. Cell biology of the glomerular podocyte. Physiol Rev 83: 253–307, 2003.[Abstract/Free Full Text]
  39. Portilla D. Role of fatty acid beta-oxidation and calcium-independent phospholipase A2 in ischemic acute renal failure. Curr Opin Nephrol Hypertens 8: 473–477, 1999.[CrossRef][Web of Science][Medline]
  40. Quigg RJ, Cybulsky AV, Jacobs JB, Salant DJ. Anti-Fx1A produces complement-dependent cytotoxicity of glomerular epithelial cells. Kidney Int 34: 43–52, 1988.[Web of Science][Medline]
  41. Sapirstein A, Spech RA, Witzgall R, Bonventre JV. Cytosolic phospholipase A2 (PLA2), but not secretory PLA2, potentiates hydrogen peroxide cytotoxicity in kidney epithelial cells. J Biol Chem 271: 21505–21513, 1996.[Abstract/Free Full Text]
  42. Shankland SJ. The podocyte's response to injury: role in proteinuria and glomerulosclerosis. Kidney Int 69: 2131–2147, 2006.[CrossRef][Web of Science][Medline]
  43. Six DA, Dennis EA. The expanding superfamily of phospholipase A2 enzymes: classification and characterization. Biochim Biophys Acta 1488: 1–19, 2000.[Medline]
  44. Smith WL, Garavito RM, DeWitt DL. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2. J Biol Chem 271: 33157–33160, 1996.[Free Full Text]
  45. Takano T, Cybulsky AV. Complement C5b-9-mediated arachidonic acid metabolism in glomerular epithelial cells: role of cyclooxygenase-1 and -2. Am J Pathol 156: 2091–2101, 2000.[Abstract/Free Full Text]
  46. Takano T, Cybulsky AV, Cupples WA, Ajikobi DO, Papillon J, Aoudjit L. Inhibition of cyclooxygenases reduces complement-induced glomerular epithelial cell injury and proteinuria in passive Heymann nephritis. J Pharmacol Exp Ther 305: 240–249, 2003.[Abstract/Free Full Text]
  47. Yang J, Han X, Gross RW. Identification of hepatic peroxisomal phospholipase A2 and characterization of arachidonic acid-containing choline glycerophospholipids in hepatic peroxisomes. FEBS Lett 546: 247–250, 2003.[CrossRef][Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/F469    most recent
00372.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, D.
Right arrow Articles by Takano, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, D.
Right arrow Articles by Takano, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.