AJP - Renal AJP: Gastrointestinal and Liver Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 294: F480-F490, 2008. First published January 2, 2008; doi:10.1152/ajprenal.00214.2007
0363-6127/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/F480    most recent
00214.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bylander, J.
Right arrow Articles by Bond, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bylander, J.
Right arrow Articles by Bond, J. S.

Targeted disruption of the meprin metalloproteinase β gene protects against renal ischemia-reperfusion injury in mice

John Bylander,1 Qing Li,2 Ganesan Ramesh,2 Binzhi Zhang,2 W. Brian Reeves,2 and Judith S. Bond1

Departments of 1Biochemistry and Molecular Biology and 2Medicine, Penn State University College of Medicine, Hershey, Pennsylvania

Submitted 9 May 2007 ; accepted in final form 1 January 2008


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Meprins are membrane-bound and secreted metalloproteinases consisting of {alpha}- and/or β-subunits that are highly expressed in mouse kidney proximal tubules. Previous studies have implied that the meprin {alpha}/β-isoform is deleterious when renal tissue is subjected to ischemia-reperfusion (I/R). To delineate the roles of the meprin isoforms in renal disease, we subjected mice deficient in meprin-β (KO) and their wild-type (WT) counterparts to I/R. WT mice were markedly more susceptible to renal injury after I/R than the meprin-β KO mice as determined by blood urea nitrogen levels. Urinary levels of inflammatory cytokines IL-6 and KC (CXCL1) were significantly higher in WT compared with meprin-β KO mice by 6 h post-I/R. At 96 h postischemia, kidney mRNA expression levels for tumor necrosis factor-{alpha}, transforming growth factor-β, inducible nitric oxide synthase, and heat shock protein-27 were significantly higher in the WT than meprin-β KO mice. For WT mice subjected to I/R, there was a rapid (3 h) redistribution of meprin β-subunits in cells in S3 segments of proximal tubules, followed by shedding of apical cell membrane and detachment of cells. These studies indicate that meprin-β is important in the pathogenesis of renal injury following I/R and that the redistribution of active meprin-{alpha}/β is a major contributor to renal injury and subsequent inflammation.

metalloproteases; kidney; knockout mice; inflammation


ISCHEMIC ACUTE TUBULAR NECROSIS is a frequent cause of acute renal failure (ARF), a common disorder that affects ~5% of all hospitalized patients and has a mortality rate of over 50% (51). The mortality rate has not decreased significantly over the past 50 years (18). An understanding of the cellular and molecular mechanisms involved in ischemic kidney injury is critical to developing effective treatments to reduce mortality. Work in experimental animal models of renal ischemia-reperfusion (I/R) has established that the S3, or pars recta, segment of the proximal tubule is the most susceptible to injury (22, 29).

Meprins are multimeric metalloproteinases composed of two subunits, {alpha} and β, that are highly expressed in the kidney, intestine, and certain leukocytes in mammals (7). The subunits form homo- or hetero- disulfide-bridged dimers, resulting in {alpha}/{alpha}-, {alpha}/β-, or β/β-isoforms. In adult mouse kidneys that express both subunits (e.g., C57BL/6 mice), meprins are estimated to make up more than 5% of total brush-border membrane protein (12). Expression is localized to the apical membrane of proximal tubule cells in the S3 (pars recta) segment (12). The β-subunit retains a hydrophobic transmembrane domain as a type I protein, whereas this domain is removed by proteolytic processing of the meprin {alpha}-subunit during biosynthesis. Thus the β/β-dimer (referred to as meprin B) and the {alpha}/β-isoform (referred to as heteromeric meprin A) are membrane-bound proteases, whereas the {alpha}/{alpha}-isoform (homomeric meprin A) is secreted into the lumen of the proximal tubule.

Meprins are proposed to be the major matrix-degrading activity in rodent kidney, capable of degrading several extracellular matrix proteins (4, 5, 50). The meprin {alpha}- and β-subunits have some overlapping and some distinct substrate and peptide bond specificities. Thus both subunits can degrade gastrin-releasing peptide, laminins, collagen IV, gelatin, nidogen, and fibronectin. Meprin-{alpha} (in homomeric or heteromeric meprin A) cleaves monocyte chemotactic protein-1, bradykinin, leutinizing hormone-releasing hormone, and {alpha}-melanocyte-stimulating hormone, whereas meprin-β (in dimeric meprin B) cleaves gastrin 17 and osteopontin (5).

Previous studies with inbred strains of mice that express different isoforms of meprin metalloproteases have implicated these proteases in the pathology of acute renal failure. For example, inbred strains of mice that have high levels of heteromeric forms of meprin (meprin-{alpha}/β) in the kidney (e.g., C57BL/6, BALB/c) display more severe damage in response to I/R compared with inbred strains that express only meprin B (dimers of meprin-β; e.g., C3H/He) (47). The inbred strains of mice differ in the expression of a variety of genes so that the specific role of meprins in the response to I/R is not clear from these studies. Studies in rats have also implicated meprins in I/R renal injury (10). For example, it has been demonstrated that administration of actinonin (a selective inhibitor of meprins) decreases the damage to the kidney subjected to I/R. However, because actinonin is not a specific inhibitor of meprins (aminopeptidases, mitochondrial deformylase, and some matrix metalloproteinases are also inhibited by this compound), the conclusion that meprins are the damaging agent in ARF is not definitive (3, 27).

To explore further the role of meprins in renal disease, we deleted the meprin-β gene by homologous recombination (33). The meprin-β knockout (KO) mice did not express meprin-β mRNA or protein in the kidney, whereas meprin-{alpha} mRNA and protein were produced at the same level as in wild-type (WT) mice. Because of the lack of meprin-β protein, there was no meprin-{alpha} or -β bound to the kidney proximal tubule membrane; the meprin A homooligomeric isoform was secreted as an inactive protein into the urine of meprin-β KO mice at approximately twice the concentration as in the WT mice. The null mice did not exhibit any obvious abnormal phenotype and were fertile. For the studies herein, the meprin-β KO mice and their WT counterparts were subjected to renal I/R to determine whether the lack of meprin-β and active meprin-{alpha} at the kidney proximal brush-border membrane affects the pathological sequellae that develop with ischemic injury.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals and induction of ischemia. Homozygous meprin-β KO mice derived by homologous recombination in embryonic stem cells were described previously (33). Because meprin-β KO mice were produced in C57BL/6 (B6) with 129/Sv strain embryonic stem cells, C57BL/6 x 129/Sv F2 littermates were used as WT controls for most experiments. Mice were housed in an animal facility that was maintained at 25°C with a 12:12-h light-dark cycle. Animals had free access to water and standard rodent chow. Urine samples were obtained before surgery and at times of serum collection. The mice were housed and maintained in the Penn State University College of Medicine animal care facility in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals under an Institutional Animal Care and Use Committee protocol. All animal protocols were approved by the Penn State Institutional Animal Care and Use Committee.

Renal I/R was performed according to an established procedure with minor modifications (36). Male mice aged 9–10 wk and weighing 26–29 g were anesthetized with intraperitoneal administration of Nembutal (50 mg/kg). Immediately after loss of the righting reflex, they were placed on a heated surgical pad (surface temperature 37°C), where they were kept during the entire procedure. Two incisions 5 mm lateral to the spine were made, and the left and right renal pedicle were exposed and clamped for 26 min with Kleinert-Kutz microvessel clamps. The time of ischemia was chosen to obtain a reversible model of ischemic ARF and to avoid animal mortality. The reperfusion was monitored de visu. The incisions were closed in two layers using 4/0 resorbable sutures. Animals were kept on the heated pad until restoration of the righting reflex. Sham surgery was performed on B6/129 F2 mice, which were killed at 24 h and used as controls. Sham surgery was performed in an identical fashion, except that the renal pedicles were not clamped. The mice were volume resuscitated with 0.5 ml of warm normal saline administered subcutaneously during surgery and kept for 4 h postoperatively in an incubator at 30°C to maintain body temperature. Mice were killed at various intervals following reperfusion, and kidneys were harvested for assessment of renal injury and mRNA quantitation. One longitudinal half of right kidney tissue was fixed in methyl Carnoy's (6:3:1 methanol-chloroform-acetic acid) and the other in 10% buffered formalin. Left kidneys were processed for RNA.

Blood and urine. Tail blood samples (60 µl) were collected under light isoflurane anesthesia in Li-Hep capillary collection tubes (Microvette CB300LH; Sarstedt) at 6, 24, 48, and 72 h of reperfusion. Plasma was collected after centrifugation at 8,500 rpm for 6 min and frozen at –20°C until analysis. Urine samples were collected at times of blood sampling and frozen at –20°C.

Biochemical analysis. Renal function was assessed by measurement of blood urea nitrogen (BUN) with Vitros DT60II chemistry slides (Ortho Clinical Diagnostics, Rochester, NY) and serum creatinine (catalog no. D2072B; Diazyme Laboratories, San Diego, CA).

RNA preparation. At the time of death, total RNA was extracted from the left kidneys using TRIzol (Invitrogen, Carlsbad, CA). The quantity and integrity of total RNA were determined using an absorption ratio at 260 and 280 nm and agarose-formaldehyde gel electrophoresis, respectively.

Real-time PCR. Synthesis of cDNA was performed with 2 µg of each RNA preparation, SuperScript III reverse transcriptase (Invitrogen), and hexanucleotide random primers (Roche, Indianapolis, IN). A reaction without reverse transcriptase was run in parallel for each RNA sample to control for DNA amplification. PCR primers were designed with Primer Express 1.5 software (Applied Biosystems), and the Spidey data-mining tool (National Center for Biotechnology Information) was used to minimize DNA amplification. Primers were as follows: meprin-{alpha} forward, CGCCTCAAGTCTTGTGTGGATT; reverse, ATTTCATGTTCAATGGTGGCCTT (product size, 164 bp); meprin-β forward, AGGATTCAGCCAGGCAAGGA; reverse, CGTGACGATGGTAGACTCTGTCC (product size, 144 bp); heat shock protein-27 (HSP-27) forward, CTTCACCCGGAAATACACGCT; reverse, GGCCTCGAAAGTAACCGGAA (product size, 151 bp); inducible nitric oxide synthase (iNOS) forward CCCTGCTTTGTGCGAAGTGT; reverse ATGCGGCCTCCTTTGAGC (product size 158); β-actin forward, TGACGTTGACATCCGTAAAGACC; reverse, CTCAGGAGGAGCAATGATCTTGA (product size, 148 bp); tumor necrosis factor-{alpha} (TNF-{alpha}) forward, GCATGATCCGCGACGTGGAA, reverse AGATCCATGCCGTTGGCCAG (product size, 352 bp); transforming growth factor-β (TGF-β) forward, TGACGTCACTGGAGTTGTACGG; reverse, GGTTCATGTCATGGATGGTGC (product size, 219 bp); interleukin-6 (IL-6) forward, GATGCTACCAAACTGGATATAATC; reverse, GGTCCTTAGCCACTCCTTCTGTG (product size, 249 bp); and CXCL1 (KC) forward, CCAAACCGAAGTCATAGCCACA; reverse, CGGTGCCATCAGAGCAGTCT (product size, 146 bp). Quantitative fluorescent real-time-PCR analysis was performed in an ABI 7700 sequence detector (Applied Biosystems) using the QuantiTect SYBR green PCR kit and 300 nM gene-specific primers. The cycle profile was 15 min at 95°C followed by 40 cycles of 15 s at 94°C, 30 s at 55°C, and 30 s at 71°C. Analyses of 40 ng of cDNA for meprin-β, TGF-β, TNF-{alpha}, IL-6, iNOS, and HSP-27 and 16 ng for meprin-{alpha} and β-actin were performed in triplicate, and reverse transcriptase negative control reactions were performed in duplicate. For determination of standard curves and PCR efficiencies, standards were prepared using dilutions of C57Bl/6 mouse kidney total RNA. Differences between slopes were <0.1, and PCR efficiencies were >1.97 for all primer pairs. Data were normalized to β-actin and analyzed using the comparative threshold cycle method. The results are presented as fold expression relative to sham-operated mice.

Immunohistochemical analysis. Paraffin-fixed renal tissue specimens were cut into 4- to 5-µm sections and placed onto polylysine-coated slides. Sections were deparaffinized and rehydrated. Tissue was permeabilized for 10 min in 0.2% Triton in PBS, washed, and incubated with 3% hydrogen peroxide in 20% methanol to quench endogenous peroxides. Sections were then blocked sequentially with PBS/0.2% BSA, Background Buster (Vector Laboratories), and 2% normal goat serum/0.5% BSA in PBS, followed by incubation overnight at 4°C with either anti-meprin antibody or anti-dipeptidyl peptidase IV (DPPIV) antibody or with corresponding preimmune sera. Preimmune sera controls were performed for all ischemic tissues on consecutive sections. Slides were then washed and incubated with a biotinylated secondary antibody for 1 h, followed by ABC reagent. Color was developed with a metal-enhanced DAB reagent (Pierce), counterstained with hematoxylin, and mounted. For confocal microscopy, the above protocol was amended by omitting the hydrogen peroxide quench and using as a secondary antibody Cy3-labeled goat anti-rabbit IgG (Molecular Probes). Slides were washed and mounted in Prolong Gold (Molecular Probes) containing the fluorescent nuclear stain Hoechst 33258 (0.1 µg/ml). Images of fluorescence-labeled sections of mouse kidney tissue were captured with a Leica TCS SP2 AOBS confocal microscope (512 x 512 resolution). Formalin-fixed tissue was also prepared for determination of naphthol AS-D chloroacetate esterase (kit no. 91A; Sigma). The esterase stain identifies infiltrating neutrophils and monocytes; ten x40 fields of esterase-stained sections were examined to quantify leukocytes.

Chemicals. All chemicals and reagents were purchased from Sigma Chemicals (St. Louis, MO), unless otherwise stated. Anti-meprin-{alpha} and anti-meprin-β antibodies were produced in the laboratory of J. S. Bond. Rabbit anti-mouse DPPIV was purchased from R&D Systems (Minneapolis, MN).

Urinary cytokines. To quantify urinary cytokines and inflammatory markers, urine samples collected at 6 and 24 h after reperfusion were analyzed in duplicate, using mixtures of specific antibody-coated beads (Linco Research, St. Charles, MO). Data were collected using the Luminex-100 system version 1.7 (Luminex, Austin, TX). Data analysis was performed using the MasterPlex QT 2.5 (MiraiBio, Alameda, CA). Concentrations of cytokines were normalized to creatinine levels in the urine (Diazyme Laboratories).

Statistical analysis. Results are means ± SE. Differences between groups were compared using an analysis of variance and the Student's t-test. Differences were considered significant if the P value was <0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Kidney function after I/R. To gain insights into the role of kidney meprins in the development of kidney injury, we subjected meprin-β KO and their WT counterparts to I/R. BUN values were analyzed at various time points to assess kidney function (Fig. 1A). At all time points (6 to 72 h) after ischemic renal injury, the meprin-β KO mice had significantly lower BUN values than the WT mice, indicating better preservation of renal function. Immediately after the 26-min ischemic insult, all groups had BUN levels of ~16 mg/dl. By 6 h after reperfusion, meprin-β KO mouse BUN values rose to 38 ± 5 mg/dl plasma compared with values of 64 ± 3 mg/dl for WT mice (P < 0.0001). The increase in plasma BUN values above baseline in the WT animals was four times greater than that in the meprin-β KO animals at 24 h of reperfusion and throughout the course of the experiment. Plasma creatinine values mirrored those of BUN (Fig. 1B). Creatinine and BUN values for sham controls of both genotypes were similar. Figure 1A shows the combined data from two separate experiments (n = 14). Two WT mice died between 24 and 48 h, whereas no meprin-β KO mice died during either experiment. These results clearly demonstrate that the meprin-β KO mice are more tolerant to I/R kidney injury than WT mice.


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 1. Blood urea nitrogen (BUN; A) and plasma creatinine levels (B) following renal ischemia-reperfusion (I/R) in wild-type (WT) and meprin (Mep)-β knockout (KO) mice. Male WT and meprin-β KO C57BL/6 x 129 F2 mice, 8–10 wk old, were subjected to 26 min of warm renal ischemia followed by up to 72 h of reperfusion. {blacksquare} WT mice; {blacktriangleup}, meprin-β KO mice. Values are means ± SE; n = 13–14 and 6–7 for each group in A and B, respectively. *P < 0.02; **P < 0.01; ***P < 0.001 (Student's t-test).

 
Expression of immune system markers after I/R. To determine whether meprin-β deletion was associated with an altered inflammatory response in I/R injury, we measured mRNA expression of chemokines, cytokines, and stress response genes in mice subjected to I/R. The expression values of TNF-{alpha}, TNF-β, iNOS, and HSP-27 in WT kidneys were all significantly elevated compared with values in kidneys of sham-operated WT mice (Fig. 2). By contrast, the levels of these inflammatory markers were not elevated, or only modestly elevated, in meprin-β KO mouse kidneys subjected to I/R. TNF-{alpha} and iNOS mRNA levels of meprin-β KO mice subjected to I/R were similar to those of sham-operated controls and significantly lower than WT levels at 96 h of reperfusion. Expression of HSP-27 and TGF-β mRNA levels in meprin-β KO mice were somewhat elevated after I/R but were significantly lower (by approximately one-half) than WT levels. There was no difference in renal mRNA expression levels of any of these genes between WT and meprin-β KO mice at baseline and at 96 h after sham surgery. These results indicate that the inflammatory response of I/R is more severe in WT than in meprin-β KO mice.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 2. Expression of tumor necrosis factor-{alpha} (TNF-{alpha}), transforming growth factor-β (TGF-β), inducible nitric oxide synthase (iNOS), and heat shock protein-27 (HSP-27) mRNA in the kidney 96 h after I/R in WT and meprin-β KO mice. The mRNA was analyzed using real-time PCR. The mRNA levels were normalized to β-actin mRNA and expressed relative to levels in sham-operated mouse kidneys. Values are means ± SE for 5 WT, 6 meprin-β KO, and 3 sham-operated mice of each genotype. *P < 0.05; **P < 0.005; ***P < 0.001.

 
The levels of proinflammatory mediators in the urine also revealed a difference between WT and meprin-β KO mice subjected to I/R. For example, IL-6 and KC (CXCL1) were elevated markedly in the urine of WT mice at 6 and 24 h postischemia and to a much lower extent in meprin-β KO mice (Fig. 3). Consistent with the upregulation of these markers, leukocyte infiltration was increased after I/R in the kidney of WT relative to meprin-β KO and sham-operated mice (Fig. 4). Together, these data indicate that the inflammatory response after I/R injury was significantly muted in kidneys of mice without meprins on the brush-border membrane.


Figure 3
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 3. Inflammatory markers interleukin-6 (IL-6) and CXCL1 (KC) in mouse urine 6 and 24 h after I/R. Urinary cytokine levels were measured using cytokine analysis kits, and data were collected using the Luminex-100 system as described in MATERIALS AND METHODS. Assays were performed in duplicate. Cytokine levels were normalized to urinary creatinine. Values are means ± SE, n = 4 mice for each group. **P < 0.02.

 

Figure 4
View larger version (115K):
[in this window]
[in a new window]

 
Fig. 4. Inflammatory cells in kidney of WT and meprin-β KO mice after I/R. Sections of kidney harvested following bilateral renal ischemia and 96 h of reperfusion were stained for leukocytes as described in MATERIALS AND METHODS. A: WT (left) and meprin-β KO kidney (right). Arrows show cells staining positive. B: ten x40 fields of kidney corticomedullary region were examined from each animal. The total number of leukocytes in those 10 fields is presented (n = 3). **P < 0.02.

 
Renal histology in WT and meprin-β KO mice after I/R. There were marked differences in the renal histology of WT and meprin-β KO mouse kidneys at 96 h after I/R (Fig. 5). To visualize the differences in the proximal tubules of the two genotypes, we stained kidney sections for DPPIV, an abundant brush-border membrane protease (17). In WT mice, DPPIV staining revealed much more brush-border disruption and collapse, patchy staining, and a predominance of dilated tubules containing detached DPPIV staining material. Staining in meprin-β KO mice, by contrast, remained predominantly on intact brush-border membranes, and fewer than 10% of tubules contained detached membrane.


Figure 5
View larger version (146K):
[in this window]
[in a new window]

 
Fig. 5. Renal histology and dipeptidyl dipeptidase IV (DPPIV) immunohistochemical localization following renal ischemia and 96 h of reperfusion in WT and meprin-β KO mice. Sections were fixed and stained with goat anti-mouse DPPIV as described in MATERIALS AND METHODS. A and B: cortical region in WT mouse kidney. Solid arrows in A show DPPIV (brown staining) localized to brush-border membranes of proximal tubules; note tubular dilation and disruption of membranes (open arrows). B shows a section of tissue in A stained with nonimmune goat serum. C and D: cortical region in meprin-β KO kidney. Solid arrows in C show DPPIV localized to brush-border membranes. D shows section of tissue in C stained with nonimmune goat serum.

 
Renal meprin localization after I/R in WT mice. To determine whether the localization and redistribution of meprin-{alpha}/β after I/R is consistent with an early role in initiating tubular injury, we subjected WT mice to renal I/R and prepared kidney tissue sections for immunohistochemical analyses after 3, 6, or 24 h of I/R (Figs. 6GoGoGo10). In sham-operated animals, meprin-β was localized exclusively to the apical brush borders of proximal straight (S3) segments of proximal tubules at the corticomedullary junction and in bundles of S3 segments extending into the outer cortex (Fig. 6, A–C). Meprin β-subunits localized exclusively to apical brush borders. No signal was detected when the preimmune rabbit serum was used on an adjacent section (Fig. 6D). In WT mouse kidney, meprin-{alpha} colocalized with meprin-β at the brush-border membrane (data not shown).


Figure 6
View larger version (140K):
[in this window]
[in a new window]

 
Fig. 6. Immunohistochemical localization of meprin-β in kidney 24 h after sham operation in WT mice. Tissue sections were fixed and stained with anti-meprin-β antibody (dark brown stain) as described in MATERIALS AND METHODS. Slides were counterstained with hematoxylin. A: corticomedullary region. B: higher magnification of the corticomedullary region showing meprin-β immunostaining confined to tubular apical brush-border membrane. C: immunostaining in bundles of proximal straight (S3) tubules in outer cortex. D: section of same tissue stained with preimmune serum. m, Medulla; c, cortex: oc, outer cortex; ic, inner cortex.

 

Figure 7
View larger version (148K):
[in this window]
[in a new window]

 
Fig. 7. Immunohistochemical localization of meprin-β in kidney of WT mice 3 h after I/R. A: corticomedullary region. Meprin is diffusely localized to dilated tubules in cortex (solid arrows) and membranous material in loops of Henle. B: higher magnification shows cells and cellular debris in corticomedullary tubules (arrows). C: tubules are dilated and meprin localization is patchy and more diffuse in the outer cortical region. D: section of same tissue stained with preimmune serum.

 

Figure 8
View larger version (123K):
[in this window]
[in a new window]

 
Fig. 8. Higher magnification of corticomedullary region after 3 h of I/R in WT mice. Meprin is localized to membranes and cells in the lumen (arrowheads) and redistributed to lateral surfaces and between intact cells still attached to the basement membrane (arrows).

 

Figure 9
View larger version (66K):
[in this window]
[in a new window]

 
Fig. 9. Confocal microscopy of corticomedullary region after 3 h of reperfusion in WT mice. Kidneys sections ware immunostained with fluorescent antibody to detect meprin-β (red) and Hoechst to detect nuclei (blue). The image depth is 0.35 µm. A: in sham-operated WT mice, meprin is localized to brush-border membranes extending into the tubular lumen. B: 3 h after reperfusion in ischemic mice, meprin localized in luminal regions of the tubules (asterisks) and in the cytoplasm surrounding nuclei of intact cells (arrows).

 

Figure 10
View larger version (135K):
[in this window]
[in a new window]

 
Fig. 10. Immunohistochemical localization of meprin-β in kidney sections of WT mice 6 h after reperfusion. A and B: corticomedullary region. Meprin-β localizes to accumulated debris in dilated tubules: filled arrows indicate meprin staining in damaged tubules, and open arrows indicate dilated tubules filled with material that does not stain for meprin. C: medullary region. Meprin is localized to material in tubules and collecting ducts in inner and outer medulla. D: higher magnification of the medullary region shown in C.

 
The localization of meprin-β in WT mouse kidney changed markedly after 3 h of reperfusion (Fig. 7). Meprin localized to dilated tubules and membranous material associated with tubular segments in the inner medulla (Fig. 7A). Nearly all S3 tubule segments contain detached cells (Fig. 7B, arrows). In the cortical region, tubules were dilated and meprin localization was patchy and more diffuse (Fig. 7C). Higher magnification of the corticomedullary junction region revealed not only meprin on cells in the lumen (solid arrows) but also redistribution to lateral surfaces and between intact cells still attached to the basement membrane (Fig. 8).

To examine further the intracellular localization and redistribution of meprin in ischemic mouse kidney, we labeled meprins with fluorescent secondary antibodies in optical sections using confocal microscopy (Fig. 9). In sham-operated animals (Fig. 9A), optical sections 0.4 µm thick showed meprin-β exclusively localized to brush-border membranes extending into the tubular lumen. By 3 h of reperfusion in ischemic kidney (Fig. 9B), meprin-β was localized not only at the luminal surface but also in the cytoplasm surrounding, but not inside, nuclei of intact cells. No staining of ischemic tissue was observed when preimmune serum was used on consecutive sections (data not shown).

By 6 h of reperfusion, there was increased accumulation of meprin-containing cells and cellular debris in tubular lumens in the corticomedullary junction region (Fig. 10, A and B). Meprin was found in the inner medulla localized to material in tubule lumens within the loop of Henle and collecting ducts (Fig. 10C). Higher magnification of the corticomedullary region reveals meprin reaching to tubular basement membranes and into the interstitium (Fig. 10B). Of note, some tubules were dilated and filled with amorphous material which did not stain for meprin (open arrows).

By 24 h of I/R, tubules were disrupted, dilated, and filled with meprin-positive debris in juxtamedullary regions (Fig. 11A). Meprin was found on all sides of cells and in acellular tubules. There was an overall loss of meprin-β staining in the outer cortical regions (Fig. 11C).


Figure 11
View larger version (143K):
[in this window]
[in a new window]

 
Fig. 11. Immunohistochemical localization of meprin-β in kidney of WT mice 24 h after reperfusion. A and B: corticomedullary region. Medullary region contains blocked tubules with intense meprin staining material as well as dilated tubules with non-meprin-staining material. B: higher magnification of the region shown in A showing cells with fragmented nuclei at the basement membranes of heavily damaged tubules (arrows). C: in the outer cortex there is decreased meprin staining compared with the juxtamedullary region. Dilated tubules are lined with cells with flattened morphology, and there is an overall loss of meprin-β staining in cortical S3 segments. D: section of same tissue stained with preimmune serum.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The present work demonstrates that deletion of the meprin-β gene, and subsequent lack of expression of meprin-β and/or -{alpha} protein at the kidney brush-border membrane, results in less damage to kidney tissue upon exposure to I/R. In the meprin-β KO mouse, there is less disruption and shedding of membranes in proximal tubules cells, a less severe inflammatory response, and better preservation of kidney function after I/R compared with the WT mouse. The histological data show that there is a marked redistribution of meprin proteins in the WT kidney in response to I/R, and we propose that the relocalization of meprin proteases causes severe damage to kidney proteins (in the cytosol, at cell junctions, and/or at the basal lateral membrane) that is responsible for a cascade of reactions that lead to cellular damage and an inflammatory response.

This work is the first to demonstrate the role of meprins in mice with similar genetic backgrounds. The inbred strains of mice that have been investigated in the past express high levels of both meprin-{alpha} and -β in the kidney (such as C57BL/6, DBA mice, designated "high-meprin mice") or meprin-β only (such as C3H/HeJ, CBA mice, designated "low-meprin mice") (6). These inbred strains differ in their histocompatibility genes in the major histocompatibility complex (MHC) on chromosome 17, and meprin-{alpha} is linked to this locus (26, 37). Most of the low-meprin strains are of the k-haplotype. The MHC genes are involved in inflammatory processes and self-nonself recognition. The meprin-β KO mice on the C57BL/6 x 129 background all have the same MHC genes, so the differences observed in different meprin genotypes in the response to ischemia cannot be attributed to the MHC genes.

In the normal mouse kidney, membrane-bound meprin-β and secreted homooligomeric meprin A (the {alpha}-{alpha} oligomer) are present in latent forms; that is, they contain prosequences that prevent proteolytic activity (9, 49). By contrast, membrane-bound meprin-{alpha} in the heterooligomeric form is activated; the prosequence is removed by a yet unidentified protease. Our studies indicate that the latent secreted homooligomeric meprin A (present in the WT and meprin-β KO mice) is not a toxic agent in I/R. However, the activity of meprin isoforms in the urine of WT and meprin-β KO mice after I/R has not been measured, and therefore there might be differences between the genotypes in meprin activity after ischemia. It is more likely, however, that the active membrane-bound heterooligomeric meprin A is the damaging factor in vivo after I/R. This is consistent with previous findings showing that the lack of membrane-bound meprin A in inbred mice and infusion of actinonin (a particularly good inhibitor of meprin-{alpha}) into rats (that express both meprin-{alpha} and -β) protects against I/R-induced kidney damage and secretion of nidogen fragments in the urine (10). Furthermore, in a sepsis-induced model of acute renal failure, actinonin prevented ARF in aged mice, and pretreatment of mice with actinonin protected against cisplatin nephrotoxicity (21, 24). Actinonin is not a specific inhibitor of meprins, and thus the action of this inhibitor from previous studies rendered suggestive rather than definitive conclusions. The present studies in genetically altered mice show more definitively that meprins are active factors in I/R-induced kidney damage.

The pathogenesis of ischemic ARF is multifactorial, and our studies demonstrate that meprins are among the factors that participate in the cascade of reactions leading to damage. Other factors that have been implicated in the injury to the kidney include cellular apoptosis and necrosis (46), inflammation (28), reactive oxygen species (45), leukocyte adhesion molecules, dendritic cell-endothelial cell interactions (44), T-cell recruitment and activation (35), C5b-9 (52), and poly(ADP-ribose) polymerase (13). The present studies indicate that after I/R, meprins relocalize to the lateral and basolateral membranes of proximal cells in S3 segments in mice. Meprins could contribute to cellular injury by damaging cell-cell interactions by hydrolyzing cell junction proteins [e.g., E-cadherin (Lottaz D, personal communication)] or extracellular matrix proteins (e.g., laminin, nidogen, fibrinogen, collagen IV), given that these proteins have been demonstrated to be substrates for meprins in vitro (5, 11, 49). Studies in rats had suggested the possibility that meprins might enter the cytoplasmic compartment of tubular cells after I/R injury (10). In the present study, a series of confocal optical sections <0.4 µm thick revealed intracellular localization of meprins throughout the cytoplasmic compartment of intact cells 3 h after injury. In addition, subcellular fractionation data (not shown) support the contention that meprins redistribute to the cytoplasm after I/R. Thus meprins could contribute to cell injury and inflammation by hydrolyzing cytosolic proteins such as PKA and latent IL-1β (11, 20). Ultimately, redistribution of meprins will have to be examined by electron microscopy to confirm the cytoplasmic localization.

Meprins could initiate or accelerate cell detachment thru hydrolysis of focal attachment proteins that are important in stabilizing focal adhesions. These substrates would not be encountered by meprins in the normal proximal tubule cell. Only upon relocalization of the meprin after I/R would substrates in compartments other than the brush-border membrane and apical lumen be encountered. Meprins may also contribute to release and activation of cytokines that participate in the inflammatory response (e.g., TNF-{alpha}). For example, proteolytic activation and release of membrane-bound TNF-{alpha} and IL-1β have been shown to occur in experimental models of ischemia reperfusion injury (15, 20, 39). A database of predicted hydrolysis sites in potential meprin substrates indicated meprins could efficiently release and activate membrane-bound TNF-{alpha} and IL-1β (8).

It is also possible that membrane-bound meprins have a specific role in the ischemic response. It has been known that OS-9 interacts with the COOH-terminal tail of meprin-β, and it was proposed that this interaction is important for endoplasmic reticulum-to-Golgi transport of the protease (30). Recently, there have been data indicating that the cytoplasmic tail of meprin-β is involved in a complex with hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) and OS-9 (2, 16). HIF-1{alpha} may play an important cytoprotective role in I/R injury (42, 48). OS-9 also interacts with HIF-1{alpha} to promote oxygen-dependent degradation of HIF-1{alpha} (by the proteasome). Treatment of rats with SnCl2, a heme oxygenase inducer, before I/R was correlated with protection against I/R injury (1). This raises the possibility that meprin-β is involved in oxygen sensing and in the response of the kidney proximal tubule cells to hypoxia.

The urinary KC and IL-6 levels in mice subjected to I/R were significantly lower in meprin-β KO relative to WT mice. The extent of early elevation in urinary IL-6 correlated with the eventual severity of subsequent injury (Fig. 3). Deletion or blockade of IL-6 has been shown to protect against renal I/R injury (34). Neutrophil infiltration in renal I/R was also significantly decreased in IL-6(–/–) mice and WT mice administered an IL-6 antibody (48). In the present study, leukocyte infiltration and the expression of inflammatory markers were decreased in the kidney of meprin-β KO relative to WT mice after injury. These results add new impetus to the possibility of using meprin metalloproteinase inhibition as prophylaxis against ischemic injury.

Meprins are also endogenous ligands for mannose binding lectin (MBL) (23), a C-type serum lectin that plays a central role in the innate immune response and, upon binding exogenous ligand, triggers complement activation via the lectin pathway (14). Both complement and MBL have been implicated in renal I/R injury and diabetic kidney disease (19), and MBL knockout mice were protected against I/R (32). It is possible that translocation of meprin from the apical surface to the basolateral surface could lead to MBL-dependent complement activation and subsequent renal injury (14, 23).

The role of meprin in the pathogenesis of renal damage may vary in acute versus chronic disease processes. Although the present studies demonstrate that the high levels of membrane-bound meprin A are deleterious in an experimental model of ARF, there are several other studies indicating that low levels of kidney meprins are associated with chronic forms of nephropathy and fibrosis. For example, renal pathology associated with hydronephrosis (unilateral urethral obstruction) occurs with an early and progressive decline in rat meprin-{alpha} and-β mRNA and protein (40). Microarray analysis demonstrated marked declines in mouse meprin-β expression in adriamycin-induced nephropathy (41). Meprin-β is downregulated during transdifferentiation of renal tubule epithelial cells to a fibroblast-like phenotype in vitro upon exposure to TGF-β and EGF, suggesting a role in fibrogenesis. Meprin-β is also downregulated in collagen IVA3 knockout mice that develop Alport's syndrome and renal pathology (43). In addition, the meprin-β metalloprotease gene has been linked to a heightened risk of diabetic nephropathy in patients with type 2 diabetes (38). Meprin-β is chronically downregulated in models of both type I and type II diabetes (31). Thus, whereas in acute renal injury, high levels of meprin A may be deleterious, in chronic forms of nephropathy, low meprin A activity may result in increased fibrosis and progression of glomerulopathies such as in diabetic nephropathy.

In summary, our results provide fresh support for the view that active brush-border membrane meprin contributes to renal ischemic injury. The absence of meprin-β, and thus meprin-{alpha}, in the brush border, is associated with a decreased inflammatory response to ischemia. There is evidence that the meprin expression varies in human kidney at both the mRNA and protein level (Ref. 25; Sterchi E, personal communication). Thus the level of meprin expression in humans could be a factor in individual susceptibility to renal ischemic injury. Meprin inhibitors in early stages of ARF could be useful therapeutically in people who express high levels of kidney meprins.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-54625 and DK-19691 (to J. S. Bond) and DK-063120 (to W. B. Reeves).


    ACKNOWLEDGMENTS
 
We acknowledge the assistance of Rhona Ellis, Penn State Hershey Confocal Imaging Facility, and Rob Brucklacher, Functional Genomics Core Facility of the Section of Research Resources, Penn State College of Medicine.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. S. Bond, Dept. of Biochemistry and Molecular Biology, Penn State Univ. College of Medicine, 500 Univ. Drive, Hershey, PA 17033 (e-mail: jbond{at}psu.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Akagi R, Takahashi T, Sassa S. Cytoprotective effects of heme oxygenase in acute renal failure. Contrib Nephrol 148: 70–85, 2005.[Web of Science][Medline]
  2. Baek JH, Mahon PC, Oh J, Kelly B, Krishnamachary B, Pearson M, Chan DA, Giaccia AJ, Semenza GL. OS-9 interacts with hypoxia-inducible factor 1alpha and prolyl hydroxylases to promote oxygen-dependent degradation of HIF-1alpha. Mol Cell 17: 503–512, 2005.[CrossRef][Web of Science][Medline]
  3. Bauvois B, Dauzonne D. Aminopeptidase-N/CD13 (EC 3.4112) inhibitors: chemistry, biological evaluations, and therapeutic prospects. Med Res Rev 26: 88–130, 2006.[CrossRef][Web of Science][Medline]
  4. Bertenshaw GP, Bond JS. Handbook of Proteolytic Enzymes. Amsterdam: Elsevier Academic, 2004.
  5. Bertenshaw GP, Turk BE, Hubbard SJ, Matters GL, Bylander JE, Crisman JM, Cantley LC, Bond JS. Marked differences between metalloproteases meprin A and B in substrate and peptide bond specificity. J Biol Chem 276: 13248–13255, 2001.[Abstract/Free Full Text]
  6. Beynon RJ, Bond JS. Deficiency of a kidney metalloproteinase activity in inbred mouse strains. Science 219: 1351–1353, 1983.[Abstract/Free Full Text]
  7. Bond JS, Matters GL, Banerjee S, Dusheck RE. Meprin metalloprotease expression and regulation in kidney, intestine, urinary tract infections and cancer. FEBS Lett 579: 3317–3322, 2005.[CrossRef][Web of Science][Medline]
  8. Boyd SE, Pike RN, Rudy GB, Whisstock JC, Garcia de la Banda M. PoPS: a computational tool for modeling and predicting protease specificity. J Bioinform Comput Biol 3: 551–585, 2005.[CrossRef][Medline]
  9. Butler PE, Bond JS. A latent proteinase in mouse kidney membranes. Characterization and relationship to meprin. J Biol Chem 263: 13419–13426, 1988.[Abstract/Free Full Text]
  10. Carmago S, Shah SV, Walker PD. Meprin, a brush-border enzyme, plays an important role in hypoxic/ischemic acute renal tubular injury in rats. Kidney Int 61: 959–966, 2002.[CrossRef][Web of Science][Medline]
  11. Chestukhin A, Litovchick L, Muradov K, Batkin M, Shaltiel S. Unveiling the substrate specificity of meprin beta on the basis of the site in protein kinase A cleaved by the kinase splitting membranal proteinase. J Biol Chem 272: 3153–3160, 1997.[Abstract/Free Full Text]
  12. Craig SS, Reckelhoff JF, Bond JS. Distribution of meprin in kidneys from mice with high- and low-meprin activity. Am J Physiol Cell Physiol 253: C535–C540, 1987.[Abstract/Free Full Text]
  13. Devalaraja-Narashimha K, Singaravelu K, Padanilam BJ. Poly(ADP-ribose) polymerase-mediated cell injury in acute renal failure. Pharmacol Res 52: 44–59, 2005.[CrossRef][Medline]
  14. Eisen DP, Minchinton RM. Impact of mannose-binding lectin on susceptibility to infectious diseases. Clin Infect Dis 37: 1496–1505, 2003.[CrossRef][Web of Science][Medline]
  15. Eissner G, Kirchner S, Lindner H, Kolch W, Janosch P, Grell M, Scheurich P, Andreesen R, Holler E. Reverse signaling through transmembrane TNF confers resistance to lipopolysaccharide in human monocytes and macrophages. J Immunol 164: 6193–6198, 2000.[Abstract/Free Full Text]
  16. Flashman E, McDonough MA, Schofield CJ. OS-9: another piece in the HIF complex story. Mol Cell 17: 472–473, 2005.[Medline]
  17. Girardi AC, Degray BC, Nagy T, Biemesderfer D, Aronson PS. Association of Na+-H+ exchanger isoform NHE3 and dipeptidyl peptidase IV in the renal proximal tubule. J Biol Chem 276: 46671–46677, 2001.[Abstract/Free Full Text]
  18. Han WK, Bonventre JV. Biologic markers for the early detection of acute kidney injury. Curr Opin Crit Care 10: 476–482, 2004.[CrossRef][Medline]
  19. Hansen TK. Mannose-binding lectin (MBL) and vascular complications in diabetes. Horm Metab Res 37, Suppl 1: 95–98, 2005.[CrossRef][Medline]
  20. Herzog C, Kaushal GP, Haun RS. Generation of biologically active interleukin-1beta by meprin B. Cytokine 31: 394–403, 2005.[CrossRef][Medline]
  21. Herzog C, Seth R, Shah SV, Kaushal GP. Role of meprin A in renal tubular epithelial cell injury. Kidney Int 71: 1009–1018, 2007.[CrossRef][Medline]
  22. Heyman SN, Shina A, Brezis M, Rosen S. Proximal tubular injury attenuates outer medullary hypoxic damage: studies in perfused rat kidneys. Exp Nephrol 10: 259–266, 2002.[CrossRef][Medline]
  23. Hirano M, Ma BY, Kawasaki N, Okimura K, Baba M, Nakagawa T, Miwa K, Kawasaki N, Oka S, Kawasaki T. Mannan-binding protein blocks the activation of metalloproteases meprin alpha and beta. J Immunol 175: 3177–3185, 2005.[Abstract/Free Full Text]
  24. Holly MK, Dear JW, Hu X, Schechter AN, Gladwin MT, Hewitt SM, Yuen PS, Star RA. Biomarker and drug-target discovery using proteomics in a new rat model of sepsis-induced acute renal failure. Kidney Int 70: 496–506, 2006.[Web of Science][Medline]
  25. Jiang W, Le B. Structure and expression of the human MEP1A gene encoding the alpha subunit of metalloendopeptidase meprin A. Arch Biochem Biophys 379: 183–187, 2000.[CrossRef][Medline]
  26. Jiang W, Sadler PM, Jenkins NA, Gilbert DJ, Copeland NG, Bond JS. Tissue-specific expression and chromosomal localization of the alpha subunit of mouse meprin A. J Biol Chem 268: 10380–10385, 1993.[Abstract/Free Full Text]
  27. Lee MD, She Y, Soskis MJ, Borella CP, Gardner JR, Hayes PA, Dy BM, Heaney ML, Philips MR, Bornmann WG, Sirotnak FM, Scheinberg DA. Human mitochondrial peptide deformylase, a new anticancer target of actinonin-based antibiotics. J Clin Invest 114: 1107–1116, 2004.[CrossRef][Web of Science][Medline]
  28. Li L, Okusa MD. Blocking the immune response in ischemic acute kidney injury: the role of adenosine 2A agonists. Nat Clin Pract Nephrol 2: 432–444, 2006.[CrossRef][Web of Science][Medline]
  29. Lieberthal W, Nigam SK. Acute renal failure. I. Relative importance of proximal vs distal tubular injury. Am J Physiol Renal Physiol 275: F623–F631, 1998.[Abstract/Free Full Text]
  30. Litovchick L, Friedmann E, Shaltiel S. A selective interaction between OS-9 and the carboxyl-terminal tail of meprin beta. J Biol Chem 277: 34413–34423, 2002.[Abstract/Free Full Text]
  31. Mathew R, Futterweit S, Valderrama E, Tarectecan AA, Bylander JE, Bond JS, Trachtman H. Meprin-{alpha} in chronic diabetic nephropathy: interaction with the renin-angiotensin axis. Am J Physiol Renal Physiol 289: F911–F921, 2005.[Abstract/Free Full Text]
  32. Moller-Kristensen M, Wang W, Ruseva M, Thiel S, Nielsen S, Takahashi K, Shi L, Ezekowitz A, Jensenius JC, Gadjeva M. Mannan-binding lectin recognizes structures on ischaemic reperfused mouse kidneys and is implicated in tissue injury. Scand J Immunol 61: 426–434, 2005.[CrossRef][Web of Science][Medline]
  33. Norman LP, Jiang W, Han X, Saunders TL, Bond JS. Targeted disruption of the meprin beta gene in mice leads to underrepresentation of knockout mice and changes in renal gene expression profiles. Mol Cell Biol 23: 1221–1230, 2003.[Abstract/Free Full Text]
  34. Patel NS, Chatterjee PK, Di Paola R, Mazzon E, Britti D, De Sarro A, Cuzzocrea S, Thiemermann C. Endogenous interleukin-6 enhances the renal injury, dysfunction, and inflammation caused by ischemia/reperfusion. J Pharmacol Exp Ther 312: 1170–1178, 2005.[Abstract/Free Full Text]
  35. Rabb H. The T cell as a bridge between innate and adaptive immune systems: implications for the kidney. Kidney Int 61: 1935–1946, 2002.[CrossRef][Web of Science][Medline]
  36. Rabb H, Daniels F, O'Donnell M, Haq M, Saba SR, Keane W, Tang WW. Pathophysiological role of T lymphocytes in renal ischemia-reperfusion injury in mice. Am J Physiol Renal Physiol 279: F525–F531, 2000.[Abstract/Free Full Text]
  37. Reckelhoff JF, Bond JS, Beynon RJ, Savarirayan S, David CS. Proximity of the Mep-1 gene to H-2D on chromosome 17 in mice. Immunogenetics 22: 617–623, 1985.[CrossRef][Medline]
  38. Red Eagle AR, Hanson RL, Jiang W, Han X, Matters GL, Imperatore G, Knowler WC, Bond JS. Meprin beta metalloprotease gene polymorphisms associated with diabetic nephropathy in the Pima Indians. Hum Genet 118: 12–22, 2005.[CrossRef][Medline]
  39. Reil JC, Gilles S, Zahler S, Brandl A, Drexler H, Hultner L, Matrisian LM, Welsch U, Becker BF. Insights from knock-out models concerning postischemic release of TNFalpha from isolated mouse hearts. J Mol Cell Cardiol 42: 133–141, 2007.[CrossRef][Medline]
  40. Ricardo SD, Bond JS, Johnson GD, Kaspar J, Diamond JR. Expression of subunits of the metalloendopeptidase meprin in renal cortex in experimental hydronephrosis. Am J Physiol Renal Fluid Electrolyte Physiol 270: F669–F676, 1996.[Abstract/Free Full Text]
  41. Sadlier DM, Connolly SB, Kieran NE, Roxburgh S, Brazil DP, Kairaitis L, Wang Y, Harris DC, Doran P, Brady HR. Sequential extracellular matrix-focused and baited-global cluster analysis of serial transcriptomic profiles identifies candidate modulators of renal tubulointerstitial fibrosis in murine adriamycin-induced nephropathy. J Biol Chem 279: 29670–29680, 2004.[Abstract/Free Full Text]
  42. Salom MG, Nieto Ceron S, Rodriguez F, Lopez B, Hernandez I, Gil Martinez J, Martinez Losa A, Fenoy FJ. Heme oxygenase-1 induction improves ischemic renal failure: role of nitric oxide and peroxynitrite. Am J Physiol Heart Circ Physiol 293: H3542–H3549, 2007.[Abstract/Free Full Text]
  43. Sampson NS, Ryan ST, Enke DA, Cosgrove D, Koteliansky V, Gotwals P. Global gene expression analysis reveals a role for the alpha 1 integrin in renal pathogenesis. J Biol Chem 276: 34182–34188, 2001.[Abstract/Free Full Text]
  44. Schlichting CL, Schareck WD, Weis M. Renal ischemia-reperfusion injury: new implications of dendritic cell-endothelial cell interactions. Transplant Proc 38: 670–673, 2006.[CrossRef][Medline]
  45. Shah SV, Walker PD. Reactive oxygen metabolites in toxic acute renal failure. Ren Fail 14: 363–370, 1992.[Web of Science][Medline]
  46. Sheridan AM, Bonventre JV. Cell biology and molecular mechanisms of injury in ischemic acute renal failure. Curr Opin Nephrol Hypertens 9: 427–434, 2000.[CrossRef][Web of Science][Medline]
  47. Trachtman H, Valderrama E, Dietrich JM, Bond JS. The role of meprin A in the pathogenesis of acute renal failure. Biochem Biophys Res Commun 208: 498–505, 1995.[CrossRef][Web of Science][Medline]
  48. Tracz MJ, Juncos JP, Croatt AJ, Ackerman AW, Grande JP, Knutson KL, Kane GC, Terzic A, Griffin MD, Nath KA. Deficiency of heme oxygenase-1 impairs renal hemodynamics and exaggerates systemic inflammatory responses to renal ischemia. Kidney Int 72: 1073–1080, 2007.[CrossRef][Medline]
  49. Villa JP, Bertenshaw GP, Bylander JE, Bond JS. Meprin proteolytic complexes at the cell surface and in extracellular spaces. Biochem Soc Symp: 53–63, 2003.
  50. Walker PD, Kaushal GP, Shah SV. Meprin A, the major matrix degrading enzyme in renal tubules, produces a novel nidogen fragment in vitro and in vivo. Kidney Int 53: 1673–1680, 1998.[CrossRef][Web of Science][Medline]
  51. Ympa YP, Sakr Y, Reinhart K, Vincent JL. Has mortality from acute renal failure decreased? A systematic review of the literature. Am J Med 118: 827–832, 2005.[CrossRef][Web of Science][Medline]
  52. Zhou W, Farrar CA, Abe K, Pratt JR, Marsh JE, Wang Y, Stahl GL, Sacks SH. Predominant role for C5b-9 in renal ischemia/reperfusion injury. J Clin Invest 105: 1363–1371, 2000.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
R. E. Yura, S. G. Bradley, G. Ramesh, W. B. Reeves, and J. S. Bond
Meprin A metalloproteases enhance renal damage and bladder inflammation after LPS challenge
Am J Physiol Renal Physiol, January 1, 2009; 296(1): F135 - F144.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/F480    most recent
00214.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bylander, J.
Right arrow Articles by Bond, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bylander, J.
Right arrow Articles by Bond, J. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.