AJP - Renal Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 294: F621-F627, 2008. First published December 5, 2007; doi:10.1152/ajprenal.00412.2007
0363-6127/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/F621    most recent
00412.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lynch, I. J.
Right arrow Articles by Wingo, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lynch, I. J.
Right arrow Articles by Wingo, C. S.

Impaired acid secretion in cortical collecting duct intercalated cells from H-K-ATPase-deficient mice: role of HK{alpha} isoforms

I. Jeanette Lynch,1,2 Alicia Rudin,1,2 Shen-Ling Xia,1,2 Lisa R. Stow,1,2 Gary E. Shull,3 I. David Weiner,1,2 Brian D. Cain,2 and Charles S. Wingo1,2

1North Florida/South Georgia Veterans Health System and 2College of Medicine, University of Florida, Gainesville, Florida; and 3College of Medicine, University of Cincinnati, Cincinnati, Ohio

Submitted 5 September 2007 ; accepted in final form 5 December 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Two classes of H pumps, H-K-ATPase and H-ATPase, contribute to luminal acidification and HCO3 transport in the collecting duct (CD). At least two H-K-ATPase {alpha}-subunits are expressed in the CD: HK{alpha}1 and HK{alpha}2. Both exhibit K dependence but have different inhibitor sensitivities. The HK{alpha}1 H-K-ATPase is Sch-28080 sensitive, whereas the pharmacological profile of the HK{alpha}2 H-K-ATPase is not completely understood. The present study used a nonpharmacological, genetic approach to determine the contribution of HK{alpha}1 and HK{alpha}2 to cortical CD (CCD) intercalated cell (IC) proton transport in mice fed a normal diet. Intracellular pH (pHi) recovery was determined in ICs using in vitro microperfusion of CCD after an acute intracellular acid load in wild-type mice and mice of the same strain lacking expression of HK{alpha}1, HK{alpha}2, or both H-K-ATPases (HK{alpha}1,2). A-type and B-type ICs were differentiated by luminal loading with BCECF-AM and peritubular chloride removal from CO2/HCO3-buffered solutions to identify the membrane locations of Cl/HCO3 exchange activity. H-ATPase- and Na/H exchange-mediated H transport were inhibited with bafilomycin A1 (100 nM) and EIPA (10 µM), respectively. Here, we report 1) initial pHi and buffering capacity were not significantly altered in the ICs of HK{alpha}-deficient mice, 2) either HK{alpha}1 or HK{alpha}2 deficiency resulted in slower acid extrusion, and 3) A-type ICs from HK{alpha}1,2-deficient mice had significantly slower acid extrusion compared with A-type ICs from HK{alpha}1-deficient mice alone. These studies are the first nonpharmacological demonstration that both HK{alpha}1 and HK{alpha}2 contribute to H secretion in both A-type and B-type ICs in animals fed a normal diet.

potassium; microperfusion; pH; acid-base balance; P-type ATPase


AT LEAST TWO H-K-ATPase {alpha}-subunits (HK{alpha}) are expressed in the collecting duct (CD): the HK{alpha}1 (gastric) and the HK{alpha}2 (colonic). These enzymes function in renal acid-base balance and potassium homeostasis (25). The {alpha}-subunit is the catalytic subunit and is essential for proton (H) and potassium (K) pumping. It assembles with a β-subunit to form the functional H-K-ATPase enzyme (20). Although previous studies reported the contribution of each H pump based on pharmacological inhibition and other studies reported the enzymatic activity in knockout mice, the contribution of each pump to net cellular H extrusion or the effects of the combined knockout have not been quantified. One or both pumps play a role in K reabsorption during K depletion.

Both HK{alpha}1 and HK{alpha}2 proton pumps are K dependent but demonstrate different pharmacological profiles (8). HK{alpha}1 H-K-ATPase is sensitive to imidazopyridine, 2-methyl-8-phenylmethoxy[imidazol(1,2a)]-pyridine-3-acetonitrile (Sch-28080) (34), whereas the pharmacologic profile of HK{alpha}2 H-K-ATPase is not completely understood. Functional studies provided convincing evidence for the existence of HK{alpha}1 in the cortical CD (CCD) (4649). Specifically in the intercalated cells (ICs) from CCD, there are physiological (11, 17, 18, 2124, 39), immunohistochemical (3, 45), and molecular (1) data that collectively support the role of an active HK{alpha}1 H-K-ATPase. The presence of HK{alpha}2 in the ICs of CCD is supported by physiological (11, 21), immunohistochemical (32), and molecular (6) data. Ouabain, a classic inhibitor of the Na-K-ATPase, has been used to assess the physiological contribution of HK{alpha}2 (8), although the sensitivity of the HK{alpha}2 H-K-ATPase to ouabain is not precisely clear. Additionally, when HK{alpha}1-deficient mice were maintained on a K-deplete diet, both Sch-28080-sensitive and ouabain-sensitive K-ATPase activity was observed (Type III) (9). This activity did not exist in the HK{alpha}2-deficient mice suggesting that HK{alpha}2 may be inhibited by both compounds at least under K-deplete conditions. Therefore, assessing the contribution of each isoform to acid extrusion using the traditional pharmacological approach may be less than ideal. The present study used a genetic approach to determine the contribution of HK{alpha}1 and HK{alpha}2 to CCD IC proton transport as opposed to a pharmacological approach.

Mice lacking functional expression of HK{alpha}1, HK{alpha}2, or both HK{alpha}1 and HK{alpha}2 (double knockout, HK{alpha}1,2) provide a unique opportunity to evaluate the effects of specific HK{alpha} gene product deficiency at the cellular level. We investigated rates of pH recovery and acid extrusion in response to acute acid loading in two types of ICs from the CCD of wild-type (WT) C57BL/6J mice and in C57BL/6J mice with genetic disruption of ATP4a (HK{alpha}1), ATP12a (HK{alpha}2), or both ATP4a and ATP12a (HK{alpha}1,2). Following identification of IC type, the cells were acid-loaded using the ammonium chloride (NH4Cl)-prepulse method (41) in HEPES-buffered solutions containing EIPA to block the Na/H exchanger, and bafilomycin A1, to block the H-ATPase. With the use of the pH-sensitive dye, BCECF, intracellular pH (pHi) recovery was measured, and buffering capacity was assessed in each cell. This allowed the comparison of acid extrusion in the A-type and B-type ICs of WT and HK{alpha} knockout (HK{alpha}1, HK{alpha}2, and HK{alpha}1,2) mice. The results confirm a significant and separate contribution of both HK{alpha}1 and HK{alpha}2 to acid extrusion in both A-type and B-type ICs in mice fed a normal diet.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal preparation. The generation and characterization of HK{alpha}1- and HK{alpha}2-deficient mice were previously reported (16, 27, 28). The HK{alpha}1 mice used in these original reports were backcrossed onto the C57BL/6J stain for more than 10 generations to generate HK{alpha}1-deficient mice on a C57BL/6J genetic background. These HK{alpha}1 mice were then crossed with the HK{alpha}2-deficient mice, also on a C57BL/6J genetic background to generate the HK{alpha}1,2-deficient mice. Homozygous breeding pairs were established, and WT mice used in the control experiments were purchased from Jackson Laboratories (Bar Harbor, ME). WT (C57BL/6J) and HK{alpha} knockout mice were maintained on a normal diet (Teklad 2016S, 0.25% Na, 0.53% K) and allowed free access to tap water. All mice were females between ages 8 and 19 wk (mean age was 11.9 ± 0.5 wk). All animal use was in compliance with the American Physiological Society's Guiding Principles in the Care and Use of Laboratory Animals, and animal use protocols were approved by the North Florida/South Georgia Veterans Administration Institutional Animal Care and Use Committee.

Genotyping of mice. Genomic DNA was isolated from ~0.25 cm of a tail clipping. Genomic DNA was amplified in two separate triplex PCR reactions, one reaction with the gene-specific primers for HK{alpha}1: forward GCCTGTCACTGACAGCAAAGAGG, reverse GGTCTTCTGTGGTGTCCGCC, and Neo CTGACTAGGGGAGGAGTAGAAGG, and a second reaction with the HK{alpha}2 primers: forward CTGGAATGGACAGGCTCAACG, reverse GTACCTGAAGAGCCCCTGCTG, and Neo CTGACTAGGGGAGGAGTAGAAGG. PCR conditions vary slightly for each reaction. Both reactions contained HotStart Taq-polymerase (Qiagen, Valencia, CA) under the following conditions (40 cycles): an initial hot start at 94°C for 10 min for both the HK{alpha}1 and HK{alpha}2 reactions, denaturation at 94°C for 30 s for the HK{alpha}1 and HK{alpha}2 reactions, annealing at 56°C for 30 s for HK{alpha}1 reaction and at 60°C for 1 min for HK{alpha}2 reaction, and extension at 72°C for 1 min for the HK{alpha}1 reaction and for 30 s for the HK{alpha}2 reaction with a final extension at 72°C for 1 min for both HK{alpha}1 and HK{alpha}2 reactions. The resultant PCR products were separated on a 2% agarose gel and detected with 0.1% ethidium bromide. In the HK{alpha}1 PCR reaction, WT and HK{alpha}2 knockout mice yield a native HK{alpha}1 band at 189 bp and HK{alpha}1 and HK{alpha}1,2 mice yield an HK{alpha}1 mutant band at ~310 bp indicative of the presence of the neomycin resistance gene insert in the ATP4a gene. Similarly, in the HK{alpha}2 reaction, the WT and HK{alpha}1 knockout mice yield the native HK{alpha}2 band at 117 bp, and HK{alpha}2 and HK{alpha}1,2 mice yield the mutant band at 307 bp.

CCD isolation and microperfusion. Standard in vitro microperfusion methods (5) as modified by this laboratory were used. Mice were killed by intraperitoneal injection of pentobarbital sodium (120 mg/kg) and cervical dislocation. Both kidneys were quickly removed, and ~1-mm coronal slices were placed in a chilled Petri dish containing HEPES-buffered solution A (Table 1). A single CCD was hand-dissected at 4°C within 60 min and transferred to a thermostatically controlled channel style perfusion chamber where both ends were aspirated into hand-fashioned holding pipettes. Pipettes were mounted and micromanipulated using a renal microperfusion system (Vestavia Scientific, Birmingham, AL). One end was cannulated with the perfusion pipette containing HEPES-buffered solution A. The luminal perfusion rate was assessed and adjusted to ~10 nl/min and maintained at this rate using a WPI SP100I syringe pump. Collection of perfusate into the holding pipette was confirmed at the end of each experiment. Throughout the remainder of the experiment, the bath solution was continuously exchanged at 4 ml/min maintained at 37 ± 2°C, beginning with solution A. All HEPES-buffered solutions were supplied by a gravity-fed syringe, and the perfusion chamber volume was constantly maintained at ~1 ml. The CCD was equilibrated under these conditions for ~10 min before luminal BCECF loading.


View this table:
[in this window]
[in a new window]

 
Table 1. Solutions

 
pHi measurements. The luminal solution was changed to solution A containing 15 µM acetoxymethyl ester and lipid-soluble form of the pH-sensitive dye BCECF (BCECF-AM), a pH-sensitive dye used to distinguish ICs. After 10 min of luminal dye loading, the perfusate and bath solution were changed to bicarbonate containing solution B. The luminal solution contained FD&C Green (60 µg/ml) to aid in visualizing the perfusate, to ensure that the flow rate was adequate, and that the perfusate exchange was complete. At the end of the experiments, no FD&C Green cellular uptake was observed. All bicarbonate-containing solutions were gassed with 95% O2-5% CO2 to pH 7.4 at 37°C and delivered to the bath chamber using a closed-syringe delivery system (Harvard Apparatus PHD2000 infusion syringe pump, Holliston, MA) with polyethylene tubing (Intramedic TM, Becton Dickson, Franklin Lakes, NJ). Under these conditions, there is no significant pH change from the delivery syringe to the perfusion chamber as verified by a bath pH probe (Accumet 13–620-96). Fluorescence measurements were taken on a Nikon Eclipse TE300 microscope using an S Fluor x40/1.30 oil immersion lens and an imaging system developed by Intracellular Imaging (Cincinnati, OH). The imaging system included a Xenon lamp source, Lambda 10-C (Sutter Instrument, Novato, CA), Cohu cooled CCD camera (COHU, San Diego, CA), and InCytIm2 software (Intracellular Imaging). Tubules were perfused for at least 10 min after removal of luminal BCECF-AM to allow for deesterification of the intracellular BCECF-AM before commencement of pHi measurements. The CCD segment of interest was focused and the Xenon lamp intensity was minimized to prevent phototoxicity (38). During a given measurement, the discrete ICs were excited alternately at 490 and 440 nM, and emission intensity at 520 nM was digitally stored for subsequent analysis. For each individual cell of interest, the ratio of the intensity of the emissions at each excitation wavelength (I490/I440) was correlated to pHi by performing a high K/nigericin (145 mM/15 µM) calibration at the end of the experiment as modified by this laboratory and described originally by Thomas et al. (30). In brief, calibration solutions of known pH from ~pH 6.6 to 7.8 were plotted against the average I490/I440 for each cell. Using linear regression, the ratiometric intensity measurements for each cell over the duration of the experiment were converted to pHi.

IC identification. In the mouse, the CCD contains ICs that are easily distinguished from principal cells (PCs) based on the differential luminal uptake of BCECF-AM. Specifically, lumen application of BCECF-AM results in a much greater luminal uptake and deesterification of the dye in ICs than in the PCs (18). Similar observations were previously reported in the rabbit CD (38). A-type and B-type ICs were differentiated by the removal and return of peritubular chloride (Cl) as previously described in rabbit (37) and shown to be applicable in mouse (18).

Acid loading and pHi recovery. The luminal and peritubular solutions were changed to solution A containing inhibitors and vehicle, and the tubule was reequilibrated for 20 min. To ensure that acid secretion reflected an H-K-ATPase-mediated mechanism, all experiments contained 100 nM luminal bafilomycin A1, to inhibit the H-ATPase, and the peritubular solution contained 10 µM EIPA, to inhibit basolateral Na/H exchange. Cells were acid-loaded using a 3-min exposure to 40 mM NH4Cl (solution B) followed by NH4Cl removal (solution A). The lowest pHi achieved from acid loading (nadir) and pHi recovery were determined during the subsequent 5 min.

Calculations. pHi measurements were made in individual, well-focused ICs on the lateral walls of the basement membrane. pHi recovery rates were calculated from the initial linear portion of the pHi recovery curve starting from the nadir pHi and were expressed as the change in pHi per minute (dpHi/min). The intrinsic buffering capacity was calculated in bicarbonate-free solutions using the formula βi = {Delta}[NH4+]i/{Delta}pHi (19) where {Delta}[NH4+]i is the change in the intracellular ammonium concentration (pKa = 9.15) and {Delta}pHi is the change in the pHi resulting from the removal of peritubular NH4Cl during the acid-loading phase of the experiment in the presence of EIPA and bafilomycin A1. Acid extrusion rates (JH) were calculated from the formula JH = βi* dpHi/min and were expressed as [H]/min.

Chemicals. All chemicals were obtained from Sigma (St. Louis, MO) or Fisher Scientific (Waltham, MA) unless otherwise specified. BCECF-AM was purchased from Molecular Probes (Eugene, OR) and frozen in 1-µl aliquots at –20°C in DMSO at 30 mM. On the day of the experiment, the BCECF-AM was dissolved in solution A at a final concentration of 15 µM. Bafilomycin A1 was obtained from Calbiochem (Darmstadt, Germany), dissolved in DMSO at 100 µM, and stored in 2-µl aliquots at –20°C. EIPA was purchased from Sigma and frozen in aliquots at –20°C in DMSO at 0.2 M. Immediately before use, bafilomycin A1 was thawed and diluted to final concentrations of 100 nM in solution A for the perfusate, and EIPA was thawed and diluted to a final concentration of 10 µM in solution A for the peritubular solution. Nigericin was obtained from Sigma and was stored at 4°C in ethanol and diluted to 15 µM in each standard.

Statistical analysis. The results are expressed as means ± SE. This report focuses primarily on the effects of HK{alpha} deficiency (WT compared with knockout groups). However, we wanted to examine the differences between A-type and B-type ICs. Therefore, we also examined whether there were differences between IC types. Multiple linear regression (Quattro Pro, Corel 2003) was used to examine the contribution of each H-K-ATPase {alpha}-subunit to Cl removal, initial pHi, buffering capacity, pHi recovery, and acid extrusion. Data compared between groups (initial pHi, buffering capacity, and pHi recovery between genotypes and between A-type and B-type ICs within the same genotype) were examined by one-way ANOVA (Origin 7.0, OriginLab). Differences between groups were considered statistically significant at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Genotyping. Figure 1 shows the expected PCR products for each genotype and was performed to confirm the genotype of the original homozygous progenitors of the animals used in this study.


Figure 1
View larger version (32K):
[in this window]
[in a new window]

 
Fig. 1. Genotyping of HK{alpha}-deficient mice. HK{alpha}1-deficient mice yield mutant bands (~310 bp) in the HK{alpha}1 reaction and native bands (189 bp) in the HK{alpha}2 reaction (lane {alpha}1). HK{alpha}2-deficient mice yield native bands (117 bp) in the HK{alpha}1 reaction and mutant bands (307 bp) in the HK{alpha}2 reaction (lane {alpha}2). HK{alpha}1,2-deficient mice yield mutant bands (~310 and 307 bp) in both HK{alpha}1 and HK{alpha}2 reactions (lane {alpha}1,2). Wild-type (WT) mice yield native bands (189 and 117 bp) in both HK{alpha}1 and HK{alpha}2 reactions (lane WT).

 
Characterization of IC type. Figure 2 shows the mean effect of peritubular Cl removal on pHi in A-type (top) and B-type (bottom) ICs from WT mice in A with representative tracings shown in B. A-type ICs in the control experiments from WT mice (29 cells from 7 CCDs) demonstrated reversible intracellular alkalinization (0.30 ± 0.03 pHi units) in response to peritubular Cl removal. In contrast, B-type ICs from WT mice (25 cells from 6 CCDs) exhibited reversible acidification (–0.22 ± 0.02 pHi units). ICs from HK{alpha}-deficient mice responded similarly to WT ICs except B-type ICs from HK{alpha}1,2-deficient mice exhibited a significantly greater reversible acidification to Cl removal compared with HK{alpha}1 alone (–0.21 ± 0.02 vs. –0.15 ± 0.02, P < 0.05).


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 2. Effect of peritubular Cl removal and readdition on intracellular pH (pHi) in 2 populations of intercalated cells (IC). A, top: A-type ICs [29 cells, 7 cortical collecting duct cells (CCDs)] in the control experiments from WT mice alkalinized 0.30 ± 0.03 pHi units and reacidified –0.27 ± 0.02 pHi units. The B-type ICs (25 cells, 6 CCDs; bottom) acidified –0.22 ± 0.02 pHi units and realkalinized 0.18 ± 0.02 pHi units. B: representative tracings of the pHi change in an A-type (top) and B-type (bottom) IC.

 
Initial cell pHi. The initial pHi of A-type and B-type IC from WT and HK{alpha}-deficient mice was recorded in the absence of the inhibitors at the start of the experiment before the removal of peritubular chloride and is shown in Table 2. For a given cell type, there was no significant difference in the initial pHi for any HK{alpha} knockout compared with the WT. A-type ICs from WT, HK{alpha}1, and HK{alpha}2 were significantly more acidic than B-type ICs of the same genotype. There was a tendency for A-type ICs to be more acidic than B-type ICs from HK{alpha}1,2-deficient mice (P = 0.05080) similar to the, respectively, more acidic pHi for A-type ICs vs. B-type ICs from WT, HK{alpha}1-deficient, and HK{alpha}2-deficient mice.


View this table:
[in this window]
[in a new window]

 
Table 2. Effect of HK{alpha} knockout on initial pHi, buffering capacity, pHi recovery, and acid extrusion

 
EIPA- and bafilomycin A1-insensitive pHi recovery in HK{alpha}-deficient mice. Figure 3 shows representative tracings of the effect of acid-loading on pHi in a WT A-type and B-type IC. EIPA- and bafilomycin A1-insensitive pHi recovery in WT and HK{alpha}-deficient mice is shown in Table 2. The pHi recovery in A-type and B-type ICs from both HK{alpha}1- and HK{alpha}2-deficient mice was significantly slower than in WT. Importantly, the rate of pHi recovery in A-type ICs from HK{alpha}1,2-deficient mice was significantly slower than in A-type ICs from HK{alpha}1-deficient mice alone. Quantitatively, the A-type ICs from the HK{alpha}1-, HK{alpha}2-, and HK{alpha}1,2-deficient mice recovered significantly slower than WT mice (43, 45, and 60%, respectively, P < 0.01). Similarly, B-type ICs from the HK{alpha}1-, HK{alpha}2-, and HK{alpha}1,2-deficient mice recovered 48, 41, and 57% slower than WT mice, respectively (P < 0.05). Of note, the rates of pHi recovery were significantly faster in A-type cells from either HK{alpha}1- or HK{alpha}2- compared with the HK{alpha}1,2-deficient mice. Specifically, the A-type cells of HK{alpha}1,2-deficient mice were 30 and 27% slower than HK{alpha}1 and HK{alpha}2, respectively (P < 0.05). There was a tendency for pHi recovery in the B-type ICs to be slower in HK{alpha}1,2-deficient mice than either HK{alpha}1 or HK{alpha}2 that was not statistically significant.


Figure 3
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 3. Representative tracings showing EIPA- and bafilomycin A1-insensitive pHi recovery in WT mice after acute acid loading in an A-type and a B-type IC. In HEPES-buffered solution, A-type and B-type ICs recover similarly from acid loading (40 mM NH4 prepulse for 3 min).

 
Buffering capacity. Intrinsic buffering capacity results are shown in Table 2. The buffering capacity was not significantly altered in any HK{alpha} knockout group, either in the A-type IC compared with WT [84.3 ± 5.7 (HK{alpha}1), 77.6 ± 4.0 (HK{alpha}2), 79.3 ± 5.2 (HK{alpha}1,2) vs. 74.3 ± 3.8 (WT)] or in the B-type ICs compared with WT [70.8 ± 9.2 (HK{alpha}1), 71.6 ± 10.4 (HK{alpha}2), 61.3 ± 6.7 (HK{alpha}1,2) vs. 72.7 ± 7.5 (WT)]. The buffering capacity was not different between A-type and B-type ICs of the same genotype except in the HK{alpha}1,2 experiments. In the HK{alpha}1,2 knockouts, A-type ICs had significantly higher buffering capacity than B-type ICs (79.3 ± 5.2 vs. 61.3 ± 6.7, P < 0.02).

EIPA- and bafilomycin A1-insensitive acid extrusion in HK{alpha}-deficient mice. Although subject to more experimental error, pHi regulation is more accurately expressed in terms of acid extrusion, the product of pHi recovery, and intrinsic buffering capacity (4). The EIPA- and bafilomycin A1-insensitive acid extrusion rates (JH) in WT, HK{alpha}1, HK{alpha}2, and HK{alpha}1,2 mice are reported in Table 2 and shown in Fig. 4. Either HK{alpha}1 or HK{alpha}2 deletion resulted in significantly slower acid extrusion in both A-type and B-type ICs. Furthermore, A-type ICs from HK{alpha}1,2 mice had significantly slower acid extrusion compared with A-type ICs from HK{alpha}1 knockout mice alone. These data provide unambiguous evidence that both HK{alpha}1 and HK{alpha}2 subunits independently contribute to H extrusion. Additionally, acid extrusion was faster in A-type ICs than in B-type ICs in the HK{alpha}1, HK{alpha}2, and HK{alpha}1,2 knockout groups, but not in WT.


Figure 4
View larger version (25K):
[in this window]
[in a new window]

 
Fig. 4. Effect of HK{alpha} gene deficiency on the EIPA- and bafilomycin A1-insensitive acid extrusion (JH) in A-type and B-type ICs. Values are means ± SE. Number in column is number of cells, and number in parentheses is number of CCDs. Actual acid extrusion values are shown in Table 2.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The present studies establish a definitive role for both HK{alpha}1 and HK{alpha}2 in renal H pumping in mice fed a normal laboratory diet. HK{alpha} knockout results in reduced EIPA- and bafilomycin A1-insensitive acid secretion in the CD. Specifically, acid extrusion following an acute acid load was significantly faster in ICs from WT mice compared with HK{alpha}1-, HK{alpha}2-, or HK{alpha}1,2-deficient mice. Furthermore, there is clearly a separate effect of both H-K-ATPase subtypes, and this effect was evident in both A-type and B-type ICs. These studies are the first demonstration of the contribution of HK{alpha}1 and HK{alpha}2 to CCD IC proton transport by nonpharmacological means and that these subunits and their respective H pumps contribute independently to pHi recovery.

Rabbit ICs are differentiated into two functionally different populations, A-type and B-type, by either the removal of luminal or peritubular Cl in bicarbonate-containing solutions due to the presence of a predominant basolateral, or a predominate apical Cl/HCO3 exchange activity, respectively (14, 37, 40). In the rabbit where these responses have been extensively studied, A-type cells have only basolateral Cl/HCO3 exchange activity. A-type ICs alkalinize upon removal of peritubular Cl, due to inhibition or reversal of the basolateral Cl/HCO3 exchange, and their pHi is not significantly altered with luminal Cl removal. In contrast, upon peritubular Cl removal B-type cells acidify as a result of increased apical Cl/HCO3 exchange activity due to reduction of intracellular Cl from enhanced basolateral Cl exit via Cl channels (36). Two populations of ICs have also been functionally characterized in the mouse (18). A-type and B-type ICs in this study demonstrated characteristic responses to the removal of peritubular Cl comparable to the previous report in mouse (18). Of note, under these experimental conditions, the basal pHi of the A-type IC is more acidic than that of the B-type IC.

Like the B-type IC, the non-A-non-B-type IC expresses pendrin protein, an apical Cl/HCO3 exchanger (33), and under these experimental conditions, the non-A-non-B-type IC would be functionally characterized as a B-type IC. However, the non-A-non-B-type IC was exclusively observed in the mouse connecting segment and initial collecting tubule and not in the CCD (29, 33).

There was no difference between the buffering capacity of A-type ICs from WT compared with the buffering capacity of A-type ICs in any of the knockout groups. Similarly, there was no difference between the buffering capacity of B-type ICs from WT compared with the buffering capacity of B-type ICs in any knockout group. Therefore, we evaluated the effect of gene knockout in each cell type using pHi recovery rates in addition to confirming the contribution of H-K-ATPase to acid extrusion in the ICs of CCD. HK{alpha}1 and HK{alpha}2 knockout both significantly reduce pHi recovery and acid extrusion in A-type and B-type ICs. Collectively, these studies unambiguously demonstrate the functional presence of two H-K-ATPases in the CCD.

In our experiments, EIPA- and bafilomycin A1-insensitive pHi recovery rates were similar in A-type and B-type ICs, which are in agreement with Petrovic et al. (18). When taking into consideration the buffering capacity (βi), JH also was not different between A-type and B-type ICs. Of note, the control pHi recovery rates reported by Petrovic et al. were considerably less than what was observed in our experiments. This discrepancy could be explained in part by differences in the precise experimental conditions and solutions used in these separate studies. In addition, Petrovic et al. used a different background mouse strain (129 Bl Swiss). Residual pHi recovery exists in our experiments in both A-type and B-type ICs from HK{alpha}1,2-deficient, suggesting that another acid extrusion mechanism not encoded by either ATP4a or ATP12a is functioning under these experimental conditions. Petrovic et al. report a novel Sch-28080- and ouabain-insensitive K-dependent secretion mechanism in the ICs of HK{alpha} knockout mice. This suggests that the pharmacologically unique transporter reported in their study may also be genetically unique, originating from a gene different than either of the known HK{alpha} genes. Petrovic et al. report that HK{alpha}2 mRNA expression does not appear by Northern analysis to be upregulated in the HK{alpha}1 knockout which further supports the case for a novel H-K-ATPase. There are presently no reports investigating the relative expression of HK{alpha}1 in the HK{alpha}2 knockout. There exists the likelihood that one or more related proteins may compensate for the deletion of the expression of the given H-K-ATPase {alpha}-subunit.

These data provide further evidence for the presence of H-K-ATPases in H transport under normal dietary conditions. Circumstances such as Na depletion, secondary hyperaldosteronism, K deprivation, ambient PCO2, and ammonium chloride loading (1113, 25, 27, 46, 47, 49) have been reported to affect the activity of one or more of these H-K-ATPases. The contribution of each one of these pumps may be modulated by different factors. In particular, chronic or acute dietary K restriction has been shown to produce a volume- and Na-dependent form of hypertension. In this study, we provide convincing evidence for substantial H-K-ATPase activity that mediates renal H transport in the ICs of the CCD using a gene knockout approach. The outer medullary CD is a major site for H-K-ATPase-mediated H secretion under K-replete (2, 35) and K-deplete dietary conditions (15, 4244), and the H-K-ATPase in this segment remains to be characterized in these mice. Potassium deprivation causes an upregulation of HK{alpha}2 (7, 10) suggesting that the colonic isoform facilitates K reabsorption. Genetic disruption of the HK{alpha}2 isoform in mice resulted in severe hypokalemia when the mice were fed a potassium-depleted diet, yet their urinary potassium excretion was normal (16). This is consistent with the present observation that both isoforms are active in the kidney and suggests that one isoform may compensate for the absence of the other. Although an impaired renal phenotype has not been previously reported in these mice, the possible involvement of the H-K-ATPase in distal renal tubular acidosis with hypokalemia in humans has been proposed (26, 31). No significant effect of renal HK{alpha}1 or HK{alpha}2 knockout on whole animal K homeostasis was observed, but in each case these animals had another intact HK{alpha} isoform. Clearly, defects in compensatory acid extrusion mechanisms require a complete understanding of the H-K-ATPase's role in renal function.

In summary, the present studies functionally characterized two IC populations of the mouse CCD. More importantly, these studies unambiguously demonstrate that mice fed a normal diet clearly possess two separate mechanisms of H extrusion, one which can be attributed to HK{alpha}1 and a second functionally distinct mechanism that can be attributed to HK{alpha}2. Future studies will be needed to examine the contribution of each H pump under different physiological stimuli.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
These studies were supported by National Institutes of Health Grant R01-DK-049750 (to C. Wingo) and DK-045788 (to D. Weiner). Part of this report was presented in Free Communication at the American Society of Nephrology Renal Week 2007.


    ACKNOWLEDGMENTS
 
We thank Dr. J. Verlander-Reed and Dr. M. Gumz for kind support.


    FOOTNOTES
 

Address for reprint requests and other correspondence: I. Jeanette Lynch, Malcom Randall VA Medical Center, General Medical Research Service, 1601 SW Archer Rd., Gainesville, FL 32608 (e-mail: lynchj{at}ufl.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Ahn KY, Kone BC. Expression and cellular localization of mRNA encoding the "gastric" isoform of H+-K+-ATPase {alpha}-subunit in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 268: F99–F109, 1995.[Abstract/Free Full Text]
  2. Armitage FE, Wingo CS. Luminal acidification in K-replete OMCDi: contributions of H-K-ATPase and bafilomycin-A1-sensitive H-ATPase. Am J Physiol Renal Fluid Electrolyte Physiol 267: F450–F458, 1994.[Abstract/Free Full Text]
  3. Bastani B. Colocalization of H-ATPase and H-K-ATPase immunoreactivity in the rat kidney. J Am Soc Nephrol 5: 1476–1482, 1995.[Abstract]
  4. Boron WF. Regulation of intracellular pH. Adv Physiol Educ 28: 160–179, 2004.[Abstract/Free Full Text]
  5. Burg M, Grantham J, Abramow M, Orloff J. Preparation and study of fragments of single rabbit nephrons. Am J Physiol 210: 1293–1298, 1966.[Free Full Text]
  6. Campbell WG, Weiner ID, Wingo CS, Cain BD. H-K-ATPase in the RCCT-28A rabbit cortical collecting duct cell line. Am J Physiol Renal Physiol 276: F237–F245, 1999.[Abstract/Free Full Text]
  7. Codina J, Delmas-Mata JT, DuBose TD Jr. Expression of HK{alpha}2 protein is increased selectively in renal medulla by chronic hypokalemia. Am J Physiol Renal Physiol 275: F433–F440, 1998.[Abstract/Free Full Text]
  8. Codina J, DuBose TD Jr. Molecular regulation and physiology of the H+,K+-ATPases in kidney. Semin Nephrol 26: 345–351, 2006.[CrossRef][Web of Science][Medline]
  9. Dherbecourt O, Cheval L, Bloch-Faure M, Meneton P, Doucet A. Molecular identification of Sch28080-sensitive K-ATPase activities in the mouse kidney. Pflügers Arch 451: 769–775, 2006.[CrossRef][Web of Science][Medline]
  10. DuBose TD Jr, Codina J, Burges A, Pressley TA. Regulation of H+-K+-ATPase expression in kidney. Am J Physiol Renal Fluid Electrolyte Physiol 269: F500–F507, 1995.[Abstract/Free Full Text]
  11. Frank AE, Weiner ID. Effects of ammonia on acid-base transport by the B-type intercalated cell. J Am Soc Nephrol 12: 1607–1614, 2001.[Abstract/Free Full Text]
  12. Frank AE, Wingo CS, Andrews PM, Ageloff S, Knepper MA, Weiner ID. Mechanisms through which ammonia regulates cortical collecting duct net proton secretion. Am J Physiol Renal Physiol 282: F1120–F1128, 2002.[Abstract/Free Full Text]
  13. Frank AE, Wingo CS, Weiner ID. Effects of ammonia on bicarbonate transport in the cortical collecting duct. Am J Physiol Renal Physiol 278: F219–F226, 2000.[Abstract/Free Full Text]
  14. Furuya H, Breyer MD, Jacobson HR. Functional characterization of {alpha}- and β-intercalated cell types in rabbit cortical collecting duct. Am J Physiol Renal Fluid Electrolyte Physiol 261: F377–F385, 1991.[Abstract/Free Full Text]
  15. Guntupalli J, Onuigbo M, Wall S, Alpern RJ, DuBose TD Jr. Adaptation to low-K+ media increases H+-K+-ATPase but not H+-ATPase-mediated pHi recovery in OMCD1 cells. Am J Physiol Cell Physiol 273: C558–C571, 1997.[Abstract/Free Full Text]
  16. Meneton P, Schultheis PJ, Greeb J, Nieman ML, Liu LH, Clarke LL, Duffy JJ, Doetschman T, Lorenz JN, Shull GE. Increased sensitivity to K+ deprivation in colonic H-K-ATPase-deficient mice. J Clin Invest 101: 536–542, 1998.[Web of Science][Medline]
  17. Milton AE, Weiner ID. Intracellular pH regulation in the rabbit cortical collecting duct A-type intercalated cell. Am J Physiol Renal Physiol 273: F340–F347, 1997.[Abstract/Free Full Text]
  18. Petrovic S, Spicer Z, Greeley T, Shull GE, Soleimani M. Novel Schering and ouabain-insensitive potassium-dependent proton secretion in the mouse cortical collecting duct. Am J Physiol Renal Physiol 282: F133–F143, 2002.[Abstract/Free Full Text]
  19. Roos A, Boron WF. Intracellular pH. Physiol Rev 61: 296–434, 1981.[Free Full Text]
  20. Scarff KL, Judd LM, Toh BH, Gleeson PA, Van Driel IR. Gastric H+,K+-adenosine triphosphatase beta subunit is required for normal function, development, and membrane structure of mouse parietal cells. Gastroenterology 117: 605–618, 1999.[CrossRef][Web of Science][Medline]
  21. Silver RB, Choe H, Frindt G. Low-NaCl diet increases H-K-ATPase in intercalated cells from rat cortical collecting duct. Am J Physiol Renal Physiol 275: F94–F102, 1998.[Abstract/Free Full Text]
  22. Silver RB, Frindt G. Functional identification of H-K-ATPase in intercalated cells of cortical collecting tubule. Am J Physiol Renal Fluid Electrolyte Physiol 264: F259–F266, 1993.[Abstract/Free Full Text]
  23. Silver RB, Frindt G, Mennitt P, Satlin LM. Characterization and regulation of H-K-ATPase in intercalated cells of rabbit cortical collecting duct. J Exp Zool 279: 443–455, 1997.[CrossRef][Web of Science][Medline]
  24. Silver RB, Mennitt PA, Satlin LM. Stimulation of apical H-K-ATPase in intercalated cells of cortical collecting duct with chronic metabolic acidosis. Am J Physiol Renal Fluid Electrolyte Physiol 270: F539–F547, 1996.[Abstract/Free Full Text]
  25. Silver RB, Soleimani M. H+-K+-ATPases: regulation and role in pathophysiological states. Am J Physiol Renal Physiol 276: F799–F811, 1999.[Abstract/Free Full Text]
  26. Simpson AM, Schwartz GJ. Distal renal tubular acidosis with severe hypokalaemia, probably caused by colonic H+-K+-ATPase deficiency. Arch Dis Child 84: 504–507, 2001.[Abstract/Free Full Text]
  27. Spicer Z, Clarke LL, Gawenis LR, Shull GE. Colonic H+-K+-ATPase in K+ conservation and electrogenic Na+ absorption during Na+ restriction. Am J Physiol Gastrointest Liver Physiol 281: G1369–G1377, 2001.[Abstract/Free Full Text]
  28. Spicer Z, Miller ML, Andringa A, Riddle TM, Duffy JJ, Doetschman T, Shull GE. Stomachs of mice lacking the gastric H-K-ATPase {alpha}-subunit have achlorhydria, abnormal parietal cells, and ciliated metaplasia. J Biol Chem 275: 21555–21565, 2000.[Abstract/Free Full Text]
  29. Teng-umnuay P, Verlander JW, Yuan W, Tisher CC, Madsen KM. Identification of distinct subpopulations of intercalated cells in the mouse collecting duct. J Am Soc Nephrol 7: 260–274, 1996.[Abstract]
  30. Thomas JA, Buchsbaum RN, Zimniak A, Racker E. Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry 18: 2210–2218, 1979.[CrossRef][Web of Science][Medline]
  31. Tosukhowong P, Tungsanga K, Eiam-Ong S, Sitprija V. Environmental distal renal tubular acidosis in Thailand: an enigma. Am J Kidney Dis 33: 1180–1186, 1999.[Medline]
  32. Verlander JW, Moudy RM, Campbell WG, Cain BD, Wingo CS. Immunohistochemical localization of H-K-ATPase {alpha}2c-subunit in rabbit kidney. Am J Physiol Renal Physiol 281: F357–F365, 2001.[Abstract/Free Full Text]
  33. Wall SM, Hassell KA, Royaux IE, Green ED, Chang JY, Shipley GL, Verlander JW. Localization of pendrin in mouse kidney. Am J Physiol Renal Physiol 284: F229–F241, 2003.[Abstract/Free Full Text]
  34. Wallmark B, Briving C, Fryklund J, Munson K, Jackson R, Mendlein J, Rabon E, Sachs G. Inhibition of gastric H+,K+-ATPase and acid secretion by SCH 28080, a substituted pyridyl(1,2a)imidazole. J Biol Chem 262: 2077–2084, 1987.[Abstract/Free Full Text]
  35. Weiner ID, Frank AE, Wingo CS. Apical proton secretion by the inner stripe of the outer medullary collecting duct. Am J Physiol Renal Physiol 276: F606–F613, 1999.[Abstract/Free Full Text]
  36. Weiner ID, Hamm LL. Regulation of Cl/HCO3 exchange in the rabbit cortical collecting tubule. J Clin Invest 87: 1553–1558, 1991.[Web of Science][Medline]
  37. Weiner ID, Hamm LL. Regulation of intracellular pH in the rabbit cortical collecting tubule. J Clin Invest 85: 274–281, 1990.[Web of Science][Medline]
  38. Weiner ID, Hamm LL. Use of fluorescent dye BCECF to measure intracellular pH in cortical collecting tubule. Am J Physiol Renal Fluid Electrolyte Physiol 256: F957–F964, 1989.[Abstract/Free Full Text]
  39. Weiner ID, Milton AE. H+-K+-ATPase in rabbit cortical collecting duct B-type intercalated cell. Am J Physiol Renal Fluid Electrolyte Physiol 270: F518–F530, 1996.[Abstract/Free Full Text]
  40. Weiner ID, Weill AE, New AR. Distribution of Cl/HCO3 exchange and intercalated cells in rabbit cortical collecting duct. Am J Physiol Renal Fluid Electrolyte Physiol 267: F952–F964, 1994.[Abstract/Free Full Text]
  41. Weiner ID, Wingo CS, Hamm LL. Regulation of intracellular pH in two cell populations of inner stripe of rabbit outer medullary collecting duct. Am J Physiol Renal Fluid Electrolyte Physiol 265: F406–F415, 1993.[Abstract/Free Full Text]
  42. Wingo CS. Active proton secretion and potassium absorption in the rabbit outer medullary collecting duct. Functional evidence for proton-potassium-activated adenosine triphosphatase. J Clin Invest 84: 361–365, 1989.[Web of Science][Medline]
  43. Wingo CS. Potassium transport by medullary collecting tubule of rabbit: effects of variation in K intake. Am J Physiol Renal Fluid Electrolyte Physiol 253: F1136–F1141, 1987.[Abstract/Free Full Text]
  44. Wingo CS, Armitage FE. Rubidium absorption and proton secretion by rabbit outer medullary collecting duct via H-K-ATPase. Am J Physiol Renal Fluid Electrolyte Physiol 263: F849–F857, 1992.[Abstract/Free Full Text]
  45. Wingo CS, Madsen KM, Smolka A, Tisher CC. H-K-ATPase immunoreactivity in cortical and outer medullary collecting duct. Kidney Int 38: 985–990, 1990.[Web of Science][Medline]
  46. Zhou X, Lynch IJ, Xia SL, Wingo CS. Activation of H+-K+-ATPase by CO2 requires a basolateral Ba2+-sensitive pathway during K restriction. Am J Physiol Renal Physiol 279: F153–F160, 2000.[Abstract/Free Full Text]
  47. Zhou X, Nakamura S, Xia SL, Wingo CS. Increased CO2 stimulates K/Rb reabsorption mediated by H-K-ATPase in CCD of potassium-restricted rabbit. Am J Physiol Renal Physiol 281: F366–F373, 2001.[Abstract/Free Full Text]
  48. Zhou X, Wingo CS. H-K-ATPase enhancement of Rb efflux by cortical collecting duct. Am J Physiol Renal Fluid Electrolyte Physiol 263: F43–F48, 1992.[Abstract/Free Full Text]
  49. Zhou X, Wingo CS. Stimulation of total CO2 flux by 10% CO2 in rabbit CCD: role of an apical Sch-28080- and Ba-sensitive mechanism. Am J Physiol Renal Fluid Electrolyte Physiol 267: F114–F120, 1994.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Yu, M. Li, D. Zhang, W. Xu, and B. C. Kone
Sp1 trans-activates the murine H+-K+-ATPase {alpha}2-subunit gene
Am J Physiol Renal Physiol, July 1, 2009; 297(1): F63 - F70.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/F621    most recent
00412.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lynch, I. J.
Right arrow Articles by Wingo, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lynch, I. J.
Right arrow Articles by Wingo, C. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.