Am J Physiol Renal Physiol 294: F840-F849, 2008.
First published January 23, 2008; doi:10.1152/ajprenal.00180.2007
0363-6127/08 $8.00
Novel regulatory function for NHERF-1 in Npt2a transcription
Syed Jalal Khundmiri,1,*
Aamir Ahmad,1,*
Ryan Everett Bennett,1
Edward J. Weinman,2,3
Deborah Steplock,3
Judith Cole,4
Patrick D. Baumann,1
John Lewis,1
Saurabh Singh,5
Barbara J. Clark,6 and
Eleanor D. Lederer1,7
1Department of Medicine, University of Louisville, Louisville, Kentucky; 2Department of Veterans Affairs and 3Department of Medicine, University of Maryland, Baltimore, Maryland; 4Department of Biology, University of Memphis, Memphis, Tennessee; 5Department of Molecular, Cellular, and Craniofacial Biology, University of Louisville Birth Defects Center, School of Dentistry, and 6Department of Biochemistry and Molecular Biology, University of Louisville, Louisville, Kentucky; and 7Department of Veterans Affairs, Louisville, Kentucky
Submitted 16 April 2007
; accepted in final form 12 January 2008
 |
ABSTRACT
|
|---|
Several lines of evidence show that sodium/hydrogen exchanger regulatory factor 1 (NHERF-1) regulates the expression and activity of the type IIa sodium-dependent phosphate transporter (Npt2a) in renal proximal tubules. We have previously demonstrated that expression of a COOH-terminal ezrin binding domain-deficient NHERF-1 in opossum kidney (OK) cells decreased expression of Npt2a in apical membranes but did not affect responses to parathyroid hormone. We hypothesized that NHERF-1 regulates apical membrane expression of Npt2a in renal proximal tubule cells. To address this hypothesis, we compared regulation of Npt2a expression and function in NHERF-deficient OK cells (OK-H) and wild-type cells (OK-WT). In OK-H cells, phosphate uptake and expression of Npt2a protein in apical membranes were significantly lower than in OK-WT cells. Transient transfection of green fluorescent protein-tagged Npt2a cDNA into OK-H cells resulted in aberrant localization of an Npt2a fragment to the cytosol but not to the apical membrane. OK-H cells also exhibited a marked decrease in Npt2a mRNA expression. As demonstrated by luciferase assay, Npt2a promoter activity was significantly decreased in OK-H cells compared with that shown in OK-WT cells. Transfection of OK-H cells with human NHERF-1 restored Npt2a expression at both the protein and mRNA levels and regulation by parathyroid hormone. Expression of NHERF-1 constructs with mutations in the PDZ domains or the ezrin binding domain in OK-H cells suggested that the PDZ2 domain is critical for apical translocation of Npt2a and for expression at the mRNA level. Our data demonstrate for the first time that NHERF-1 regulates Npt2a transcription and membrane insertion.
parathyroid hormone; sodium/hydrogen exchanger regulatory factor; type IIa sodium-dependent phosphate cotransporter; low phosphate; opossum kidney cell
MAINTENANCE OF PHOSPHATE HOMEOSTASIS is critical for health. Excessive urinary losses can lead to nephrolithiasis (32) or crippling bone disease (2). Conversely, failure to excrete excess dietary phosphate results in vascular calcification, a risk factor for premature cardiovascular morbidity and accelerated mortality (15). The type IIa sodium-dependent phosphate cotransporters (Npt2a), located on the apical membrane of proximal renal tubule cells, are essential for the maintenance of phosphate homeostasis. The Npt2 (Npt2a) knockout mouse exhibits phosphaturia, elevated vitamin D, hypercalcemia, hypercalciuria, and significant skeletal abnormalities (1). The expression of Npt2a is regulated by a variety of agonists involved in mineral homeostasis, bone metabolism, and growth, including dietary phosphate, parathyroid hormone (PTH), dopamine, and growth factors (29, 30).
The amino acid sequence of Npt2a shows the presence of a PDZ binding domain at the extreme COOH terminus: TRL (10, 17). This motif for protein-protein interactions is a commonly used mechanism for anchoring proteins within cell membranes or within signaling complexes (3, 8, 31, 33). Previous studies suggest that PDZ domain proteins play a significant role in the apical membrane localization of Npt2a. Using a yeast 2 hybrid assay, Gisler et al. (7) demonstrated that the COOH terminus of the rat Npt2a was capable of binding several PDZ proteins, one of which was NHERF-1, the sodium/hydrogen exchanger regulatory factor 1 (5, 26, 35). Hernando et al. (11) demonstrated that NHERF-1 and Npt2a colocalized in clustered structures in the apical membranes of cultured opossum kidney (OK) cells, a model for the renal proximal tubule. Introduction into the cells of a competing peptide specific for the first PDZ domain of NHERF resulted in loss of Npt2a from the apical membrane. In the NHERF-1 knockout mouse model, Weinman and colleagues (36) demonstrated decreased brush-border membrane (BBM) Npt2a expression and increased expression of Npt2a in intracellular vesicles of proximal renal tubules. These structural changes were accompanied by phosphate wasting, decreased bone mineral content, and failure to adapt to phosphate deprivation (4, 36). Mahon et al. (23), using a model of NHERF-1-deficient OK cells (OK-H), showed an abnormal pattern of diffuse and unclustered apical membrane staining for Npt2a that was restored to normal when full-length murine NHERF-1 was transfected into these cells.
Previous studies from our laboratory (20) showed that expression of a NHERF-1 construct lacking the ezrin binding domain in OK cells resulted in diminished basal expression of the transporter compared with cells expressing the full-length NHERF construct, suggesting a role for this domain of NHERF in regulating apical membrane expression of the protein. Our group (20) has also demonstrated by glutathione S-transferase pulldown analysis that NHERF physically associated with both the full-length sodium phosphate cotransporter and with a COOH-terminal deletion mutant, suggesting that NHERF's interaction with the transporter involves more than the COOH-terminal classic PDZ domain binding motif of Npt2a. From these previous studies, we hypothesized that NHERF regulates the apical membrane anchoring of Npt2a. To test this hypothesis, we compared the expression and function of Npt2a in wild-type OK cells (OK-WT), in OK cells lacking expression of NHERF, and in NHERF-deficient OK cells transfected with NHERF-1 constructs.
 |
MATERIALS AND METHODS
|
|---|
Materials.
PTH(1-34) was purchased from Bachem Biosciences (King of Prussia, PA). Antibodies against ezrin were purchased from Sigma (St. Louis, MO). Geneporter transfection and Genesilencer small interfering RNA (siRNA) transfection reagents were purchased from Gene Therapy Systems (San Diego, CA). All other chemicals were purchased from Sigma, unless otherwise specified. OK cell green fluorescent protein (GFP)-tagged Npt2a plasmid was provided by Dr. Nicholas Barry (University of Colorado, CO). OK cell Npt2a promoter constructs were provided by Dr. Nati Hernando (Geneva, Switzerland).
Cell culture.
OK cells, a continuous cell line derived from Virginia opossum (19), and OK-H cells, a clonal subline of the parental OK cell line that lacks the expression of NHERF (27, 23–24), were cultured as previously described (20). Vector (pcDNA 3.1Hygro+)-transfected OK-WT and OK-H cells and OK-H cells stably transfected with NHERF-1 constructs were maintained at 37°C in a humidified atmosphere with 5% CO2 in DMEM-F-12 medium (1:1) supplemented with 10% vol/vol FCS, 100 U/ml penicillin, and 100 µg/ml streptomycin in the presence of 600 U/ml hygromycin. The cells were fed twice per week and split once per week at 1:4 ratio. All experiments were carried out using cells at 90–95% confluence. Cells grown on six-well culture plates were washed with serum-free medium 24 h before use.
Phosphate uptake.
Phosphate transport was measured by determination of radiolabeled phosphate uptake as previously described (21). Each assay was performed in triplicate and averaged, and the mean was considered as a single data point.
Membrane preparation.
Crude membrane preparations were performed as previously described (18, 20).
BBM preparation.
BBMs were prepared at 4°C using MgCl2 precipitation method. OK cells grown on semi-permeable membrane inserts were homogenized in 50 mM mannitol and 5 mM Tris-HEPES (pH 7.0) by high-speed homogenizer (20,500 rpm). MgCl2 was added at 10 mM and stirred for 20 min. The homogenate was centrifuged at 2,000 g. The supernatant was recentrifuged at 35,000 g for 30 min; the pellet was then resuspended in 300 mM mannitol and 5 mM Tris-HEPES (pH 7.4) and centrifuged at 35,000 g for 20 min. The membrane pellet was washed three times. These membranes demonstrate a sixfold increase in the expression of Npt2a cotransporter and the BBM enzyme
-glutamyl transpeptidase.
Immunoblot assay.
Immunoblots of membrane preparations were performed as previously described (20). The films were scanned with a personal densitometer (Molecular Dynamics).
Preparation and purification of NHERF siRNA.
NHERF siRNA sense and antisense oligonucleotides were designed by using Ambion's Web-based siRNA converter software (www.ambion.com/techlib/misc/siRNA_finder.html) (6), as previously described (18). For transfection of siRNA, 1 µg NHERF siRNA was transfected into OK cells with the use of Genesilencer Transfection reagent according to the manufacturer's protocol as previously described (18).
GFP-Npt2a plasmid transfection.
GFP-Npt2a plasmid was transfected into OK-WT and OK-H cells using lipofectamine (Invitrogen) according to the manufacturer's protocol and as described previously (18).
NHERF cDNA transfection.
Vector (pcDNA 3.1Hygro+), human NHERF-1, or mutant NHERF-1 constructs expressing mutations in PDZ domains 1 (PDZ1) and 2 (PDZ2) and both PDZ domains (PDZB) in pcDNA 3.1Hygro+ were transfected into OK-H cells using Geneporter transfection reagent according to the manufacturer's protocol as previously described (18). These mutations render the PDZ domains (and therefore the NHERF proteins) unable to interact with PDZ proteins.
Confocal imaging.
Confocal imaging was performed as previously described (18). NHERF-1 was identified with 1:100 rabbit anti-human NHERF antibody in PBS-saponin, and Npt2a was identified with 1:100 chicken anti-OK cell Npt2a antibody diluted 1:1 in glycerol in PBS-saponin and incubated with appropriate Alexa fluor secondary antibody (1:1,000) conjugated to different fluorescent tags, Alexa fluor 488 for identification of NHERF, and Alexa fluor 555 for identification of Npt2a. Using computer interface software (Meridian), we conducted z-scan analyses on single cells by coronal scanning at 1-µm intervals and three-dimensionally reconstructed the fluorescent images. The images for NHERF and Npt2a were merged in a single image to compare the cellular distribution of the two proteins.
RT-PCR.
Total RNA from OK cells was isolated by RNA-STAT method (Tel-test Texas). To a 3.5-cm tissue culture plate of OK cells, 1 ml of RNA-STAT reagent was added and the cell lysate was passed through a pipette several times. Next, 0.2 ml of chloroform was added and mixed vigorously for 5 min and incubated for 10 min at room temperature. The mixture was centrifuged at 12,000 g for 20 min at 4°C. The upper layer was taken into another tube, and 0.5 ml of ice-cold isopropanol per 1 ml of RNA-STAT was added, incubated at room temperature for 10 min, and centrifuged at 12,000 g for 20 min at 4°C. The pellet was washed once with 75% ice-cold ethanol and centrifuged for 20 min at 12,000 g at 4°C. The pellet was air dried and dissolved in 10 µl of nuclease-free water per 1 ml of RNA-STAT used and 2 µl of RNasin (Promega). The RNA was reverse transcribed using the Im-Prom-II RT kit (Promega) according to the manufacturer's protocol. Briefly, 200 ng of RNA were added to 18 µl of RT mixture containing 5 mM MgCl2 , 2 µl of 10x RT buffer, 2 µl of 1 mM dNTPs, 1 U RNasin, 15 U Im-Prom-II RT, 1 µl of oligo(dT), and 7.5 µl of nuclease-free water. The reaction mixture was incubated at 42°C for 2 h. The resulting cDNA was used for amplification of the OK cell Npt2a by PCR using TTAAGGCCAGCCAGGATGATG (forward primer) and GAGCCTAGTGGCGTTGTGCTG (reverse primer). Control mouse GAPDH primers were purchased from Invitrogen. PCR was performed with the PCR kit from Promega. Briefly, 10 µl of cDNA were added to PCR mixture containing 14.6 µl of nuclease-free water, 4 µl of 10x buffer, 5 mM MgCl2, 1 mM dNTPs, 200 nM each of forward and reverse primers, and 1 U Taq DNA polymerase. The reaction was incubated at 95°C for 2 min followed by 30 cycles at 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min, followed by an elongation cycle at 72°C for 10 min. The PCR samples were separated by agarose gel electrophoresis and visualized under UV light. The image was captured by a charge-coupled device camera attached with a UV filter.
Quantitative RT-PCR.
Total RNA was isolated as described above. RNA was reverse transcribed using primers from Applied Biosystems according to the manufacturer's protocol. Quantitative PCR was performed with Npt2a or 18S RNA primers designed and supplied by Applied Biosystems using Applied Biosystems 7500 quantitative PCR thermocycler according to the manufacturer's protocol. Expression was quantified by the manufacturer's protocol as change (in fold) relative to 18S RNA expression.
Transfection of OK cell Npt2a promoter luciferase constructs and β-galactosidase cDNA.
Npt2a no activity (from –86 bp), medium activity (from –154), and full activity (from –4400 bp) promoter sequences (12) cloned into pGL3 vector (Promega) and β-galactosidase vector (Promega) were cotransfected into OK-WT or OK-H cells using Geneporter (GTS Technologies) as previously described (18). Briefly, 20 µg of cDNAs were mixed with Geneporter reagent in OPTI-MEM (Invitrogen) and allowed to incubate at room temperature for 30 min. One milliliter of the mixture was then poured onto cells in culture and incubated for 6 h after which 1 ml of OPTI-MEM with 20% FCS was added. Cells were allowed to grow for another 36 h.
β-Galactosidase activity.
β-Galactosidase activity was measured with the β-galactosidase assay system (Promega) according to the manufacturer's protocol. Briefly, 50 µl of diluted cell lysates (20 µl of cell lysate in 30 µl of reporter lysis buffer) was added to 50 µl of assay reagent in each well of a 96-well ELISA plate, and the samples were mixed by pipetting two or three times. The assay mixture was incubated at 37°C for 30 min, and the reaction was stopped with 150 µl of 1 M Tris (pH 7.4). A standard curve was simultaneously prepared using different concentrations of β-galactosidase enzyme. The absorbance values were measured at 420 nm in an ELISA plate reader, and the activity (mU/30 min) was calculated from the standard curve. All experiments were repeated in duplicate at least four times, and the values are expressed as means ± SE.
Luciferase activity.
Luciferase activity was determined using luciferase assay and β-galactosidase assay systems (Promega) according to the manufacturer's protocol. Briefly, cells were washed three times with 1x PBS (pH 7.1) and lysed using cell culture lysis reagent provided with the luciferase assay system. The cell lysates were transferred to 1.5-ml tubes, vortexed, and centrifuged at 15,000 g for 5 min at 4°C, and the supernatants were used for enzyme assays. For determination of luciferase activity, 100 µl of luciferase assay reagent were dispensed into a manual luminometer tube. The luminometer was programmed for a 2-s measurement delay followed by a 10-s reading for luciferase activity. Cell lysate (20 µl) was added to the tube containing luciferase assay reagent and mixed by pipetting two or three times. The tube was then placed into luminometer for activity measurement. Geneporter reagent control, pGL3 basic, and pGL3 enhancer constructs were used as controls. Luciferase activity is expressed as units per milligram protein (luciferase activity relative to β-galactosidase activity/mg protein).
Protein concentration was measured by bicinchoninic acid method (Sigma) using BSA as standard.
Statistics.
Data are shown as means ± SE. All experiments were repeated at least three times unless otherwise stated to document reproducibility. P value is calculated using SigmaStat software utilizing paired t-test. P < 0.05 was a priori considered statistically significant.
 |
RESULTS
|
|---|
Npt2a function and expression in OK-H cells.
To determine the effect of NHERF deficiency on regulation of phosphate uptake by PTH or low phosphate (4, 11, 23, 36), OK-WT and OK-H cells were treated with 100 nM PTH for 2 h or allowed to grow in low-phosphate medium for 72 h. Baseline phosphate transport was significantly lower in OK-H (1.2 pmol·mg protein–1·min–1) than in OK-WT (5.4 pmol·mg protein–1·min–1) cells (Fig. 1, control). Treatment with PTH resulted in 30% inhibition of phosphate uptake in OK-WT cells. In contrast, PTH caused a small but insignificant decrease in OK-H cells compared with vehicle-treated OK-H cells (Fig. 1). OK-H cells did respond to low-phosphate medium with an appropriate increase in phosphate uptake,
2- to 2.5-fold increase from control levels for both WT and OK-H cells (Fig. 1). However, the magnitude of the response in OK-H cells did not approach the absolute level of phosphate uptake seen in OK-WT cells.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 1. Effect of sodium/hydrogen exchanger regulatory factor (NHERF) deficiency on type IIa sodium-dependent phosphate transporter (Npt2a) regulation. Wild-type opossum kidney cells (OK-WT; top) and NHERF-deficient opossum kidney cells (OK-H; bottom) were treated with 100 nM parathyroid hormone (PTH) for 2 h or were grown in low-phosphate medium for 72 h. Phosphate transport was measured by determination of radioactive phosphate uptake for 10 min. Results are expressed as pmol Pi·mg protein–1·min–1. *Significant change between control and PTH-treated or low-phosphate medium cells (P < 0.05).
|
|
In agreement with our phosphate transport findings, expression of Npt2a in BBM preparations, crude membranes, or cytosol of OK-H cells was markedly decreased compared with the expression levels in OK-WT cells and increased only marginally after growth of the cells in a low-phosphate medium (Fig. 2). Expression of β-actin did not change in OK-WT or OK-H cells (Fig. 2, bottom). The expression of ezrin and the Na+-K+-ATPase
1-subunit in OK-H cells was comparable to that shown in OK-WT cells (20).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2. Effect of NHERF deficiency on Npt2a expression. Cells were grown on filter inserts to allow maximum polarization of apical and basolateral membranes. Npt2a expression was determined in crude membranes (C), brush-border membranes (B), and cytosol (L) from OK-WT and OK-H cells under control conditions, after treatment with 100 nM PTH for 2 h, or after growth in low-phosphate medium for 72 h. Nitrocellulose membranes were blotted with a horseradish peroxidase-linked β-actin antibody to show equal loading of proteins (bottom blot). Representative immunoblots from 4 independent experiments are shown. WB, Western blot. Bar graphs show quantitative data as arbitrary densitometry units (ratio of Npt2a band density to actin band density) ± SE from 4 individual experiments. *Significant difference from vehicle-treated group (P < 0.05).
|
|
To confirm that the decrease in Npt2a expression in OK-H cells could be attributed to the diminished NHERF expression, we created NHERF-deficient OK cells by introduction of NHERF siRNA into OK-WT cells, effectively knocking down NHERF-1 expression by
75–80% while leaving the expression of other proximal tubule cell proteins such as ezrin and the
-subunit of Na+-K+-ATPase intact (18). The expression of Npt2a in these cells was decreased, as shown in crude membrane preparations of OK-H cells (Fig. 3, top). Baseline phosphate uptake in OK cells treated with NHERF siRNA also decreased significantly relative to OK-WT cells, although the decrease in baseline phosphate uptake was not as marked as was seen with the OK-H cells, and PTH was able to significantly inhibit phosphate uptake in both control and siRNA transfected cells (Fig. 3, bottom). Variabilities in baseline phosphate uptake and Npt2a expression were attributed to variabilities in the degree of NHERF knockdown by siRNA. In a batch of OK cells obtained from American Type Culture Collection that lack PTH-regulated phosphate transport were also found to lack NHERF-1 expression (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3. Effect of NHERF-1 small interfering RNA (siRNA) on Npt2a expression and phosphate uptake. OK-WT cells were transfected with siRNA for NHERF-1 or control siRNA. Top: expression of NHERF-1 and Npt2a in crude membrane preparation was determined by immunoblot analysis. Expression of NHERF was under vehicle, control siRNA, and NHERF siRNA conditions. Expression of Npt2a was in vehicle-treated and NHERF siRNA-treated cells in the absence or presence of PTH. Bottom: OK cell monolayers transfected with NHERF-1 siRNA were treated with vehicle or 100 nM PTH for 2 h. Phosphate transport was measured as radiolabeled phosphate uptake for 10 min. Results are expressed as pmol Pi·mg protein–1·min–1. *Significant change between vehicle- and PTH-treated cells (P < 0.05). #Significant change between OK-WT control and siRNA-transfected cells.
|
|
We considered the possibility that improper processing of the protein produced by NHERF deficiency would result in faulty trafficking and/or accelerated degradation. To examine this possibility, we transiently transfected OK-WT and OK-H cells with GFP-tagged Npt2a cDNA and performed an immunoblot for GFP and Npt2a in cytosol and crude membrane fractions. As shown in Fig. 4A, the GFP immunoblot (top) showed a 60- to 65-kDa band in OK-H cells, which was mostly in the cytosolic fraction. In contrast, the GFP-positive band appeared at a considerably higher molecular size (125 kDa) and was predominantly seen in the membrane fraction in OK-WT cells. The blot for Npt2a (Fig. 4A, bottom) almost exclusively localized to the membrane fraction in OK-WT cells, whereas, in OK-H cells, the Npt2a antibody identified very faint cytosolic bands at approximately the same molecular size and no signal corresponding to the GFP-positive band. To confirm that Npt2a is confined to the cytosol of OK-H, OK-WT and OK-H cells transfected with GFP-tagged Npt2a were visualized by confocal microscopy. As shown in Fig. 4B (coronal view) and Fig. 4C (z scan), GFP-Npt2a was expressed in the apical membrane in OK-WT cells. However, GFP fluorescence was restricted to intracellular regions in OK-H cells, and the protein did not traffic to the apical membrane.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 4. Effect of Npt2a cDNA transfection in OK-H cells. A: OK-WT and OK-H cells were transfected with green fluorescent protein (GFP)-tagged Npt2a cDNA as described in MATERIALS AND METHODS. Npt2a expression in cytosol and crude membranes was determined by immunoblot analysis in transiently transfected (GFP-Npt2a) or reagent control (control) cells. Representative Western blots from 4 independent experiments are shown. B: OK-WT and OK-H cells were transfected with GFP-tagged Npt2a plasmid. Expression of GFP-linked Npt2a was analyzed by confocal microscopy. A representative experiment is shown from 4 independent experiments. C: z-scan representation comparing expression of GFP-linked Npt2a in OK-WT and OK-H cells.
|
|
We next incubated OK-WT and OK-H cells in an inhibitor of vacuolar ATPase, bafilomycin (100 nM), or an inhibitor of proteasomal degradation, lactacystin (30 nM). As shown in Fig. 5, although both inhibitors increased Npt2a expression in crude membrane preparations from OK-WT, neither increased expression in OK-H, suggesting that the decreased expression of Npt2a in OK-H cells is not due to accelerated degradation of the protein through lysosomal or proteasomal pathways.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 5. Effect of bafilomycin and lactacystin on Npt2a expression. OK-WT and OK-H cell monolayers were treated for 30 min with 100 nM bafilomycin (top) or 30 nM lactacystin (bottom). Expression of Npt2a was determined by immunoblot analysis. A representative immunoblot from 4 independent experiments is shown.
|
|
Rescue of wild-type phenotype in OK-H cells by NHERF transfection.
To determine whether restoration of the expression of NHERF would rescue the OK-H phenotype, we examined Npt2a expression and function in stable transfectants of OK-H cells expressing full-length human NHERF. Figure 6 shows the comparison of phosphate uptake and Npt2a expression under basal conditions and after treatment with PTH in OK-WT cells, OK-H cells transfected with vector alone, and OK-H cells transfected with full-length NHERF-1. Transfection of full-length NHERF restored Npt2a expression and phosphate uptake in OK-H cells to
80% of the OK-WT cells. PTH decreased the membrane expression of Npt2a and phosphate uptake to an extent similar in OK-WT and OK-H cells transfected with full-length NHERF-1 (Fig. 6A). To confirm expression of Npt2a in apical membranes, confocal microscopy was performed. As shown in Fig. 6B, Npt2a was present in the apical membranes in OK-WT cells. However, both NHERF-1 expression and Npt2a expression were markedly diminished in OK-H cells. Transfection of full-length NHERF restored the apical membrane expression of Npt2a and NHERF-1.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 6. Effect of NHERF-1 expression in OK-H cells on Npt2a expression and regulation. OK-H cells were transfected with either pcDNAHygro3.1+ vector (OK-H V) or full-length human NHERF-1 cloned in pcDNAHygro3.1+ (OK-H NF) as described in MATERIALS AND METHODS. A: OK-WT, OK-H, and OK-H NF cells were treated for 2 h with 100 nM PTH. Expression of Npt2a was determined by immunoblot analysis (top). A representative immunoblot from 4 independent experiments is shown. Phosphate transport (bottom) was measured as radiolabeled phosphate uptake for 10 min. Results are expressed as pmol Pi·mg protein–1·min–1. *Significant change between vehicle- and PTH-treated cells (P < 0.05). #Significant change between vehicle-treated OK-WT and OK-H or OK-H NF cells. B: expression of NHERF (green fluorescence) and Npt2a (red fluorescence) was determined in OK-WT, OK-H, and OK-H NF cells. Right panels show z-axis images of Npt2a (red fluorescence), NHERF (green fluorescence), and merged image of Npt2a and NHERF (yellow staining) with the apical side on the top and the basal side on the bottom.
|
|
Effect of NHERF deficiency on transcriptional regulation of Npt2a.
To determine whether the impaired Npt2a expression in OK-H cells was a result of impaired transcriptional regulation, we performed RT-PCR in OK-WT and OK-H cells. Figure 7 demonstrates the near absence of the message for Npt2a in OK-H cells. Immunoblot for NHERF in OK-WT nuclear extracts revealed strong expression of NHERF, suggesting that NHERF could play a role in regulation of gene expression. Expression of Npt2a mRNA appeared to be restored equally well by transfection with full-length NHERF or NHERF constructs expressing mutations in PDZ1, PDZ2, and PDZB. However, real-time RT-PCR studies showed that OK-H cells expressing mutation in the PDZ2 domain had mRNA expression similar to that shown in OK-H cells, whereas cells expressing all other constructs regained Npt2a mRNA expression similar to that shown in OK-WT cells (Fig. 8).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 7. Effect of NHERF transfection on Npt2a mRNA expression. Total RNA was extracted from OK-WT, OK-H, or OK-H cells transfected with full-length NHERF or mutated PDZ1 domain, PDZ2 domain, or both PDZ1 and PDZ2 domains, as described in MATERIALS AND METHODS. Left: RNA was reverse transcribed, and cDNA was amplified by RT-PCR using Npt2a-specific primers (top) or GAPDH (bottom) as described in MATERIALS AND METHODS. Right: expression of NHERF-1 in nuclear pellet from the OK-WT was determined by immunoblot analysis. Representative immunoblot from 3 individual experiments is shown.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8. Effect of NHERF transfection on Npt2a mRNA expression by quantitative RT-PCR (qRT-PCR). Total RNA was extracted from OK-WT, OK-H, or OK-H cells transfected with full-length NHERF (NF) or mutated PDZ1 domain (Z1), PDZ2 (Z2), or both PDZ1 and PDZ2 domains (ZB) as described in MATERIALS AND METHODS. RNA was reverse transcribed, and cDNA was amplified by qRT-PCR using Npt2a-specific primers or 18S RNA (Applied Biosystems) as described in MATERIALS AND METHODS. Quantitative data (Npt2a mRNA expression relative to 18S RNA expression) is shown as percent difference (means ± SE, n = 4) from OK-WT. EBD, ezrin binding domain deficient.
|
|
Previous investigators have suggested that the major mechanism for regulation of Npt2a mRNA expression is through changes in the Npt2a mRNA stability (25, 28), although others have also demonstrated evidence for changes in the rate of transcription (14, 34). To determine whether the absence of NHERF had an effect on transcription, we transfected three OK cell Npt2a promoter constructs of different lengths linked to a luciferase reporter gene into OK-H and OK-WT cells. These constructs [121 (low-activity promoter), 208 (medium-activity promoter), and 4.7 kb (maximum-activity promoter)] were previously described by Hilfiker et al. (12) and shown to exhibit increasing promoter activity with increasing length of promoter region. Figure 9 shows that reporter activity for the Npt2a promoter was significantly lower in OK-H cells than in OK-WT cells. Transfection in OK-H cells with full-length NHERF significantly increased the promoter activity. Data from the 4.7-kb construct are shown as relative luciferase activity (relative to β-galactosidase activity).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 9. Effect of NHERF deficiency on Npt2a promoter activity. Npt2a low activity (–121), medium activity (–208), or maximum activity (–4.7 kb) promoters cloned in pGL3 luciferase expression vector were cotransfected with control β-galactosidase expression vector in OK-WT and OK-H cells. Luciferase and β-galactosidase activities were measured as described in MATERIALS AND METHODS. Data from medium and maximum promoter activity constructs are represented as luciferase activity (units/mg protein; means ± SE from 4 independent experiments). One unit of luciferase activity is luciferase activity relative to β-galactosidase activity.
|
|
The above data suggested that NHERF-1 irrespective of the mutations in PDZ domains restored Npt2a mRNA expression. Therefore, we next determined the expression of Npt2a and regulation of phosphate uptake by PTH in OK-H cells transfected with full-length NHERF-1 and PDZ-null-mutated or ezrin binding domain-deficient NHERF. As shown in Fig. 10A, transfection of full-length NHERF or the mutated NHERF restored Npt2a expression in crude membrane preparations to a variable degree, with notably less expression in the cells transfected with the mutated PDZ2 domain. Npt2a expression in BBM preparations mimicked the expression pattern in crude membrane (Fig. 10B, top). OK-H cells lacked NHERF-1 expression in BBM, which was restored by transfection (Fig. 10B, bottom). Expression of NHERF-1 or PDZ1-mutated, PDZB-mutated, and ezrin binding domain-deficient NHERF-1 in OK-H cells restored basal phosphate uptake. However, phosphate uptake was not restored in OK-H cells transfected with PDZ2-mutated NHERF-1 (Fig. 10C). Furthermore, a decrease in phosphate uptake in response to PTH was restored in OK-H cells expressing full-length NHERF-1, PDZ1-mutated, PDZB-mutated, or ezrin binding domain-deficient NHERF-1 but not in OK-H cells expressing mutated PDZ2 NHERF-1 (Fig. 10D).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 10. Effect of NHERF mutation on Npt2a expression and regulation. Npt2a expression was determined by immunoblot analysis in crude membrane (A) and brush-border membrane (B, top) preparations from OK-WT, OK-H, or OK-H cells transfected with pcDNA 3.1Hygro+ vector (pcDNA-V) full-length NHERF (NF) or mutated PDZ1 domain (Z1), PDZ2 (Z2), both PDZ1 and PDZ2 domains (ZB) or ezrin binding domain-deficient (EBD) NHERF. A representative immunoblot from 4 independent experiments is shown. Results of baseline phosphate uptake (C, n = 4) or PTH-regulated phosphate uptake (D, as percent of vehicle-treated controls, n = 4) in OK-WT, OK-H, or OK-H cells transfected with full-length NHERF or mutated PDZ1 domain, PDZ2, or both PDZ1 and PDZ2 domains or EBD NHERF are also presented. *P < 0.05 from respective controls.
|
|
 |
DISCUSSION
|
|---|
The present study demonstrates novel aspects of regulation of the expression and trafficking of Npt2a by NHERF-1. Specifically, absence of NHERF-1 profoundly diminishes Npt2a protein expression, possibly through interference with exocytosis, and diminishes mRNA expression at least in part due to changes in transcriptional activity. The domain on NHERF-1 responsible for both of these functions appears to be the PDZ2 domain.
There is now considerable evidence in OK cells and in proximal tubule cells from the kidney indicating that the major sodium-dependent phosphate transporter, Npt2a, interacts with a number of PDZ domain proteins localized in the BBM of these cells. Specific interest has focused on NHERF-1 because expression of NHERF-1-interfering peptides in OK cells disrupts apical targeting of Npt2a and the NHERF-1 knockout mouse demonstrates phosphaturia and decreased BBM abundance of the transporter (4, 11, 36). The mechanism by which NHERF-1 regulates Npt2a, however, is not completely understood. The present study examined the effects of NHERF-1 expression in a derived OK cell line expressing minimal NHERF-1. These results parallel emerging data from cultured mouse proximal tubule cells from the NHERF-1-null mouse. OK cells and primary cultures of mouse proximal tubules demonstrate some significant differences that are of potential importance to the understanding of the regulation of phosphate transport. OK cells express NHERF-1 (37, 38) but not NHERF-2 (13), whereas mouse proximal tubule cells routinely express both isoforms. In yeast, both NHERF isoforms interact with Npt2a. In the mouse kidney, on the other hand, NHERF-2 may form a tertiary complex with Npt2a by heterodimerizing with NHERF-1. Thus the kinetics of interaction between NHERF-1 in OK cells and mouse proximal tubule cells may not be identical. In addition, the PTH signal pathways used by these cells may not be identical. NHERF-1 and NHERF-2 are both capable of functioning as the molecular switch for the PTH1 receptor. In both OK cells and mouse proximal tubule cells, PTH generates cAMP and activates protein kinase C. An important pathway in OK cells appears to be activation of ERK1/2 (22). By contrast, ERK1/2 is not activated by PTH on mouse proximal tubule cells in culture. Despite these differences, there appears to be remarkable agreement on the role of NHERF-1 in both experimental models. OK-H cells, like proximal tubule cells from NHERF-1-null mice, demonstrate decreased basal sodium-dependent phosphate transport, a blunted response to the inhibitory effect of PTH, and decreased stimulation of phosphate transport in response to incubation in low-phosphate media. The conclusion that the abnormalities in phosphate regulation in OK-H cells are due to NHERF-1 deficiency is strengthened by the demonstration of similar defects in wild-type cells where NHERF-1 is knocked down by siRNA and in another OK cell line lacking NHERF (OK cells from American Type Culture Collection). Moreover, rescue of OK-H cells with NHERF-1 increases basal phosphate transport and restores the response to PTH. Published and preliminary results in proximal tubule cells from the NHERF-1-null mouse indicate similar changes when the cells are rescued using viral-mediated gene transfer (4). Thus NHERF-1 appears to be critical to the basal and regulated phosphate transport mediated by Npt2a. In the OK-H cells, the lack of response to PTH can be explained by the near absence of Npt2a expression; thus the role of NHERF-1 in regulation of Npt2a expression by PTH cannot really be assessed by the present data.
PTH-associated retrieval of Npt2a from the BBM is not associated with parallel changes in NHERF-1 abundance, suggesting that the movement of Npt2a on and off the BBM is not obligated to the movement of NHERF-1 (20). Rather, this suggests NHERF-1 and Npt2a bind in the plane of the BBM. The present experiments, however, suggest two additional interactions between NHERF-1 and Npt2a that have not previously been considered. First, transfection of OK-H cells with Npt2a cDNA results in the expression of very small amounts of protein in the cytosol of a variety of molecular sizes ranging from normal to much smaller. The GFP-tagged protein in the OK-H cells appeared at the approximate molecular size of the core unmodified protein, suggesting that some posttranslational modification of Npt2a is impaired in the NHERF-deficient cells. This finding is of potential importance given the results of Murer and colleagues (9), who showed that mutations of the glycosylation sites on Npt2a diminish apical membrane expression of the protein. Npt2a also exhibits several consensus sequences for phosphorylation by PKC, the significance of which has not been determined. The role of NHERF-1 in mediating the processing of Npt2a is unknown at present. Of note, our Npt2a antibody did not identify the GFP-tagged protein in OK-H cells. Because the antibody is directed against the COOH terminal, this finding suggests that the protein may be truncated or otherwise altered in OK-H cells, resulting in loss of the antigenic domain. Interestingly, the domain of NHERF-1 involved in this function appears to be the PDZ2 domain. Previous studies have shown an association between the COOH terminus of Npt2a and the PDZ1 domain that appears to mediate localization to the BBM. The present study suggests that the PDZ2 domain may also play a role in apical membrane localization, although through a different mechanism.
Second, in OK-H cells, there was a marked decrease in expression of the mRNA for Npt2a. Transfection of NHERF-1 into the NHERF-deficient OK cells restores mRNA expression. Previous studies have shown that regulation of Npt2a mRNA involves predominantly regulation of its stability rather than regulation of the rate of transcription. Using nuclear run-on assays, Moz et al. (28) showed that phosphate depletion in rats resulted in enhanced binding of cytosolic proteins to the 5'-UTR of the Npt2a mRNA, thereby increasing the half-life of the message. This study shows that the absence of NHERF also decreases promoter activity, suggesting that NHERF may also play a role in regulation of the rate of transcription. The mechanism for this effect is not known. Immunoblot of nuclear fractions of OK cells demonstrates the presence of NHERF, suggesting the possibility that NHERF could regulate gene transcription either by direct interaction with the gene or indirectly through interaction with other proteins. Kanai et al. (16) demonstrated that the transcriptional coactivator TAZ (transcriptional coactivator with PDZ-binding motif) expresses a PDZ binding domain and can bind to NHERF-2. In preliminary experiments, immunoprecipitation of nuclear extracts with a NHERF antibody showed association of NHERF with two transcription factors, TAZ and SRY (data not shown). Additional studies will be required, however, to determine whether these factors play a role in NHERF regulation of Npt2a mRNA. Quantitative PCR data suggest that this function of NHERF-1 may also reside in the PDZ2 domain. Of note, OK-H cells expressing the NHERF-1 construct with mutations in both PDZ1 and PDZ2 domains showed restoration of mRNA expression, similar to that shown in OK-WT cells. The reason for this apparent discrepancy is not clear and cannot be deduced from our present data. Further studies are needed to determine the significance of this finding.
In summary, the present experiments document the requirement for NHERF-1 in both basal and regulated phosphate transport in OK cells. Whereas NHERF-1 plays a role in the targeting and/or retention of Npt2a in the BBM, the present experiments suggest that the relation between these proteins is more complex. NHERF-1 may play a role in early protein processing of Npt2a. In addition, NHERF-1 is involved in the regulation of the expression of Npt2a mRNA. These finding may provide an explanation for the increase in the urinary excretion of phosphate in NHERF-1-deficient animals.
 |
ACKNOWLEDGMENTS
|
|---|
We acknowledge the technical assistance of Nina Lesousky. This work was supported by the Department of Veterans Affairs (E. D. Lederer, E. J. Weinman), the American Heart Association (S. J. Khundmiri), and the National Institutes of Health (E. J. Weinman).
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: E. D. Lederer, Univ. of Louisville, Kidney Disease Program, 570 S. Preston St, Suite 102, Louisville, KY 40202 (e-mail: e.lederer{at}louisville.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* S. J. Khundmiri and A. Ahmad contributed equally to this work. 
 |
REFERENCES
|
|---|
- Beck L, Karaplis AC, Amizuka N, Hewson AS, Ozawa H, Tenenhouse HS. Targeted inactivation of Npt2 in mice leads to severe renal phosphate wasting, hypercalciuria, and skeletal abnormalities. Proc Natl Acad Sci USA 95: 5372–5377, 1998.[Abstract/Free Full Text]
- Berndt TM, Schiavi S, Kumar R. "Phosphatonins" and the regulation of phosphorus homeostasis. Am J Physiol Renal Physiol 289: F1170–F1182, 2005.[Abstract/Free Full Text]
- Brône B, Eggermont J. PDZ proteins retain and regulate membrane transporters in polarized epithelial cell membranes. Am J Physiol Cell Physiol 288: C20–C29, 2005.[Abstract/Free Full Text]
- Cunningham R, Xiaofei E, Steplock D, Shenolikar S, Weinman EJ. Defective PTH regulation of sodium-dependent phosphate transport in NHERF-1–/– renal proximal tubule cells and wild-type cells adapted to low-phosphate media. Am J Physiol Renal Physiol 289: F933–F938, 2005.[Abstract/Free Full Text]
- Donowitz M, Cha B, Zachos NC, Brett CL, Sharma A, Tse CM, Li X. NHERF family and NHE3 regulation. J Physiol 567: 3–11, 2005.[Abstract/Free Full Text]
- Elbashir SM, Harborth J, Weber K, Tuschl T. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 26: 199–213, 2002.[CrossRef][Web of Science][Medline]
- Gisler GM, Stagljar I, Traebert M, Bacic D, Biber J, Murer H. Interaction of the type IIa Na/Pi cotransporter with PDZ proteins. J Biol Chem 276: 9206–9213, 2001.[Abstract/Free Full Text]
- Glynne PA, Evans TJ. Role of the PDZ scaffolding protein in tubule cells in maintenance of polarised function. Exp Nephrol 10: 307–312, 2002.[CrossRef][Web of Science][Medline]
- Hayes G, Busch A, Loetscher M, Waldegger S, Lang F, Verrey F, Biber J, Murer H. Role of N-linked glycosylation in rat renal Na/Pi-cotransport. J Biol Chem 269: 24143–24149, 1994.[Abstract/Free Full Text]
- Hernando N, Jimenez ZK, Biber J, Murer H. Molecular determinants for apical expression and regulatory membrane retrieval of the type IIa Na/Pi cotransporter. Kidney Int 60: 431–435, 2001.[CrossRef][Web of Science][Medline]
- Hernando N, Déliot N, Gisler SM, Lederer E, Weinman EM, Biber J, Murer H. PDZ-domain interactions and apical expression of type IIa Na/Pi cotransporters. Proc Natl Acad Sci USA 99: 11957–11962, 2002.[Abstract/Free Full Text]
- Hilfiker H, Hartmann CM, Stange G, Murer H. Characterization of the 5'-flanking region of OK cell type II Na-Pi cotransporter gene. Am J Physiol Renal Physiol 274: F197–F204, 1998.[Abstract/Free Full Text]
- Hryciw JH, Ekberg J, Ferguson C, Lee A, Wang D, Parton RG, Pollock CA, Yun CC, Poronnik P. Regulation of albumin endocytosis by PSD95/Dlg/ZO-1 (PDZ) scaffolds. Interaction of Na+-H+ exchange regulatory factor-2 with ClC-5. J Biol Chem 281: 16068–16077, 2006.[Abstract/Free Full Text]
- Jehle AW, Hilfiker H, Pfister MF, Biber J, Lederer E, Krapf R, Murer H. Type II Na-Pi cotransport is regulated transcriptionally by ambient bicarbonate/carbon dioxide tension in OK cells. Am J Physiol Renal Physiol 276: F46–F53, 1999.[Abstract/Free Full Text]
- Jono S, Shioi A, Ikari Y, Nishizawa Y. Vascular calcification in chronic kidney disease. J Bone Miner Metab 24: 176–181, 2006.[CrossRef][Web of Science][Medline]
- Kanai F, Marignani PA, Sarbassova D, Yagi R, Hall RA, Donowitz M, Hisaminato A, Fujiwara T, Ito Y, Cantley LC, Yaffe MB. TAZ: a novel transcriptional co-activator regulated by interactions with 14-3-3 and PDZ domain proteins. EMBO J 19: 6778–6791, 2000.[CrossRef][Web of Science][Medline]
- Karim-Jimenez Z, Hernando N, Biber J, Murer H. Molecular determinants for apical expression of the renal type IIa Na+/Pi-cotransporter. Pflügers Arch 442: 782–790, 2001.[CrossRef][Web of Science][Medline]
- Khundmiri SJ, Weinman EJ, Steplock D, Cole J, Ahmad A, Baumann PD, Barati M, Rane MJ, Lederer E. Parathyroid hormone regulation of Na+,K+-ATPase requires the PDZ 1 domain of sodium hydrogen exchanger regulatory factor-1 in opossum kidney cells. J Am Soc Nephrol 16: 2598–2607, 2005.[Abstract/Free Full Text]
- Koyama H, Goodpasture C, Miller MM, Teplitz RL, Riggs AD. Establishment and characterization of a cell line from the American opossum (Didelphys virginiana). In Vitro 14: 239–246, 1978.[Web of Science][Medline]
- Lederer ED, Khundmiri SJ, Weinman EJ. Role of NHERF-1 in regulation of the activity of Na-K ATPase and sodium-phosphate co-transport in epithelial cells. J Am Soc Nephrol 14: 1711–1719, 2003.[Abstract/Free Full Text]
- Lederer ED, Sohi SS, Mathiesen JM, Klein JB. Regulation of expression of type II sodium-phosphate cotransporters by protein kinases A and C. Am J Physiol Renal Physiol 275: F270–F277, 1998.[Abstract/Free Full Text]
- Lederer ED, Sohi SS, McLeish KR. Parathyroid hormone stimulates extracellular signal-regulated kinase (ERK) activity through two independent signal transduction pathways: role of ERK in sodium-phosphate cotransport. J Am Soc Nephrol 11: 222–231, 2000.[Abstract/Free Full Text]
- Mahon MJ, Cole JA, Lederer ED, Segre GV. Na+/H+ exchanger-regulatory factor 1 mediates inhibition of phosphate transport by parathyroid hormone and second messengers by acting at multiple sites in opossum kidney cells. Mol Endocrinol 17: 2355–2364, 2003.[Abstract/Free Full Text]
- Mahon MJ, Segre GV. Stimulation by parathyroid hormone of a NHERF-1-assembled complex consisting of the parathyroid hormone I receptor, phospholipase Cβ, and actin increases intracellular calcium in opossum kidney cells. J Biol Chem 279: 23550–23558, 2004.[Abstract/Free Full Text]
- Markovich D, Verri T, Sorribas V, Forgo J, Biber J, Murer H. Regulation of opossum kidney (OK) cell Na/Pi cotransport by Pi deprivation involves mRNA stability. Pflügers Arch 430: 459–563, 1995.[CrossRef][Web of Science][Medline]
- Minkoff C, Shenolikar S, Weinman EJ. Assembly of signaling complexes by the sodium-hydrogen exchanger regulatory factor family of PDZ-containing proteins. Curr Opin Nephrol Hypertens 8: 603–608, 1999.[CrossRef][Web of Science][Medline]
- Miyauchi A, Dobre V, Rickmeyer M, Cole J, Forte L, Hruska KA. Stimulation of transient elevations in cytosolic Ca2+ is related to inhibition of Pi transport in OK cells. Am J Physiol Renal Fluid Electrolyte Physiol 259: F485–F493, 1990.[Abstract/Free Full Text]
- Moz Y, Silver J, Naveh-Many T. Characterization of cis-acting element in renal NaPi-2 cotransporter mRNA that determines mRNA stability. Am J Physiol Renal Physiol 284: F663–F670, 2003.[Abstract/Free Full Text]
- Murer H, Hernando N, Forster I, Biber J. Regulation of Na/Pi transporter in the proximal tubule. Annu Rev Physiol 65: 531–542, 2003.[CrossRef][Web of Science][Medline]
- Murer H, Hernando N, Forster I, Biber J. Proximal tubular phosphate reabsorption: molecular mechanisms. Physiol Rev 80: 1373–1409, 2000.[Abstract/Free Full Text]
- Murer H, Hernando N, Forster I, Biber J. Molecular mechanisms in proximal tubular and small intestinal phosphate reabsorption (plenary lecture). Mol Membr Biol 18: 3–11, 2001.[Web of Science][Medline]
- Prie D, Huart V, Bakouh N, Planelles G, Dellis O, Gerard B, Hulin P, Benque-Blanchet F, Silve C, Grandchamp B, Friedlander G. Nephrolithiasis and osteoporosis associated with hypophosphatemia caused by mutations in the type 2a sodium-phosphate cotransporter. N Engl J Med 347: 983–991, 2002.[Abstract/Free Full Text]
- Rongo C. Disparate cell types use a shared complex of PDZ proteins for polarized protein localization. Cytokine Growth Factor Rev 12: 349–359, 2001.[CrossRef][Web of Science][Medline]
- Saxena S, Allon M. The role of cytosolic calcium in chronic adaptation to phosphate depletion in opossum kidney cells. J Biol Chem 271: 3902–3906, 1996.[Abstract/Free Full Text]
- Shenolikar S, Weinman EJ. NHERF: targeting and trafficking membrane proteins. Am J Physiol Renal Physiol 280: F389–F395, 2001.[Abstract/Free Full Text]
- Shenolikar S, Voltz JW, Minkoff CM, Wade JB, Weinman EJ. Targeted disruption of the mouse NHERF-1 gene promotes internalization of proximal tubule sodium-phosphate cotransporter type IIa and renal phosphate wasting. Proc Natl Acad Sci USA 99: 11470–11475, 2002.[Abstract/Free Full Text]
- Wade JB, Liu J, Coleman RA, Cunningham R, Steplock DA, Lee-Kwon W, Pallone TL, Shenolikar S, Weinman EJ. Localization and interaction of NHERF isoforms in the renal proximal tubule of the mouse. Am J Physiol Cell Physiol 285: C1494–C1503, 2003.[Abstract/Free Full Text]
- Wade JB, Welling PA, Donowitz M, Shenolikar S, Weinman EJ. Differential renal distribution of NHERF isoforms and their colocalization with NHE3, ezrin, and ROMK. Am J Physiol Cell Physiol 280: C192–C198, 2001.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
Y.-C. Chen, R. K. Meier, S. Zheng, S. J. Khundmiri, M. T. Tseng, E. D. Lederer, P. N. Epstein, and B. J. Clark
Steroidogenic acute regulatory-related lipid transfer domain protein 5 localization and regulation in renal tubules
Am J Physiol Renal Physiol,
August 1, 2009;
297(2):
F380 - F388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Levi and S. Breusegem
Renal Phosphate-Transporter Regulatory Proteins and Nephrolithiasis
N. Engl. J. Med.,
September 11, 2008;
359(11):
1171 - 1173.
[Full Text]
[PDF]
|
 |
|
Copyright © 2008 by the American Physiological Society.