AJP - Renal AJP citation statistics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Renal Physiol 294: F1174-F1184, 2008. First published February 13, 2008; doi:10.1152/ajprenal.00320.2007
0363-6127/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/5/F1174    most recent
00320.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Câmpean, V.
Right arrow Articles by Amann, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Câmpean, V.
Right arrow Articles by Amann, K.

Angiopoietin 1 and 2 gene and protein expression is differentially regulated in acute anti-Thy1.1 glomerulonephritis

Valentina Câmpean,1 Britta Karpe,1 Christian Haas,2 Akram Atalla,1 Harm Peters,3 Harald Rupprecht,4 Stefan Liebner,5 Till Acker,5 Karl Plate,5 and Kerstin Amann1

1Department of Pathology, University of Erlangen-Nürnberg, Erlangen; 2Department of Cardiology, University of Tübingen, Tübingen; 3Department of Nephrology, Charité, Humboldt University, Berlin; 4Department of Internal Medicine, Bayreuth; and 5Edinger Institute, University Frankfurt/Main, Frankfurt, Germany

Submitted 12 July 2007 ; accepted in final form 8 February 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Capillary neoformation is important in repair of glomerular injury of various origins. VEGF was shown to be crucial for glomerular capillary repair in glomerulonephritis (GN). We reasoned that other angiogenic factors are likewise involved in glomerular capillary remodeling and found angiopoietin 1 and -2 (ANG1 and ANG2) mRNA to be upregulated in cDNA microarrays of microdissected glomeruli of anti-Thy1.1 GN of the rat. We then studied glomerular in situ gene and protein expression of ANG1 and ANG2 and their receptor Tie-2 in the course of anti-Thy1.1 GN, which was induced by injection of OX-7 antibody. Animals were perfusion fixed at days 6 and 12 after GN induction and compared with nonnephritic controls receiving PBS. Capillary damage and repair were quantitatively analyzed using stereological techniques. Gene and protein expression of ANG1 and ANG2 and their receptor Tie-2 was analyzed using real-time quantitative PCR from microdissected glomeruli, nonradioactive in situ hybridization, double immunofluorescence, and Western blot analysis. Glomerular capillarization assessed as length density was significantly lower at day 6 of anti-Thy1.1 GN than in controls; it was back to normal values at day 12. ANG1 and ANG2 gene expression was markedly upregulated at day 6 of the disease compared with controls. Protein expression of ANG1 and ANG2 was confined to podocytes and that of Tie-2 to endothelial cells. At day 12 of anti-Thy1.1 GN when capillary restoration was nearly completed, ANG1 and ANG2 gene expression returned to basal levels, whereas Tie-2 expression was still high. With the use of a combined molecular and in situ approach, the spatial and temporal gene and protein expression of the angiopoietins and their receptor was analyzed in anti-Thy1.1 GN. The results indicate that glomerular expression of ANG1 and ANG2 and Tie-2 is differentially regulated and may contribute to healing and endothelial cell stabilization in experimental GN.

vascular endothelial growth factor; microarrays; glomerular injury; repair

SEVERAL FORMS OF GLOMERULONEPHRITIS (GN) are accompanied by damage of glomerular endothelial (EC) or mesangial (MC) cells with subsequent loss of the capillary architecture. After glomerular destruction, ECs play an active role in the recovery process of the glomerular architecture by formation of new capillaries from the glomerular vascular poles and capillary sprouting from the remaining ECs (21, 39). The anti-Thy1.1 GN is a well-characterized model of mesangioproliferative GN, induced by a complement-fixing antibody to the Thy1 antigen present on MCs. As a consequence of severe complement-dependent mesangiolysis, i.e., destruction and dissolution of MCs and the mesangial matrix, capillary dilatation and microaneurysms formation occur. Thereafter, MC proliferation, extracellular matrix production, and capillary repair lead to complete structural and functional recovery of the affected glomeruli (6, 7, 17, 21, 36). VEGF was shown to play a crucial role in capillary repair of damaged glomeruli (30). The glomerular expression pattern suggests that VEGF acts as a physiological stimulus for EC differentiation and proliferation, leading to capillary formation and maintenance of the vascular phenotype (16, 22, 41). As EC growth factors, the angiopoietins function in close concert with VEGF. Angiopoietin 1 (ANG1) plays a role in maintenance of the glomerular endothelium, modulating Tie-2 receptor activity and regulating VEGF actions on glomerular permeability (37). Angiopoietin 2 (ANG2) is a natural antagonist of ANG1, inducing vessel regression and EC proliferation dependent on the presence of low or high VEGF levels (28, 34). In mice and humans, ANG2 is expressed at sites of vascular remodeling, i.e., during development (1) or under pathological conditions when angiogenesis becomes reactivated (9). In vitro, hypoxia induces synthesis of VEGF and ANG2 in cultured ECs and increases production of extracellular matrix proteins in MCs (29, 35, 47).

We hypothesized that in addition to VEGF other angiogenic factors like ANG1, ANG2, and Tie-2 are likewise involved in glomerular vascular remodeling. Therefore, we studied quantitative changes of glomerular capillaries in parallel with gene and protein expression of ANG1, ANG2, and Tie-2 during injury and repair in anti-Thy1.1 GN. Our data argue for a coordinated spatial and temporal expression of these angiogenic factors during glomerular injury and repairs.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal Model

The rat anti-Thy1.1 model of mesangioproliferative GN was induced by intravenous injection of OX-7 antibody (1 mg/kg body wt), a monoclonal antibody against the Thy1.1 antigen (European Collection of Animal Cell Cultures, Salisbury, UK) into 180- to 220-g male Sprague-Dawley rats (Charles River, Sulzfeld, Germany), as described previously (33). Rats receiving similar volumes PBS served as controls (n = 7). All animal experiments were approved by local authorities and performed according to the German guidelines on animal experimentation. The animals were killed at days 6 and 12 after induction of the GN (n = 7 animals per time point) and compared with the nonnephritic control rats. Before perfusion, animals were placed in metabolic cages for 24 h for collection of urine. Albuminuria was measured in triplicate using a microplate technique and a rabbit anti-rat albumin peroxidase conjugate (38). Retrograde perfusion via the abdominal aorta was performed with 10% dextran solution containing 0.5 g/l procain-hydrochloride for 2 min to relax the vasculature and to prevent from interstitial edema and afterwards with ice-cold 0.9% saline solution (38). Immediately afterwards, one kidney was removed and weighed and one-half was frozen in liquid nitrogen for preparation of cryosections used for in situ hybridization. The other half was fixed in methyl-Carnoy solution, processed for paraffin embedding, and used for light microscopy and immunohistochemistry. Then, retrograde perfusion was continued using 3% glutaraldehyde for 10 min. The second kidney was taken out and weighed and dissected in a plane perpendicular to the interpolar axis into 1-mm-thick slices. Ten small pieces of one kidney were selected by area weighted sampling for embedding in Epon-Araldite. Semithin sections (1 µm) were prepared and stained with methylene blue/basic fuchsin. The remaining tissue slices were embedded in paraffin; 4-µm sections were prepared and stained with hematoxylin and eosin and periodic acid-Schiff (38) staining.

Morphologic and Stereologic Investigations

Analysis of capillary dilatation and aneurysm formation as an index of initial glomerular injury. Mesangiolysis, i.e., dissolution or disappearance of the mesangial matrix due to necrosis and apoptosis of MCs, is the hallmark of anti-Thy1.1 GN. It is associated with loss of MCs, capillary dilatation, and finally formation of capillary aneurysms. Presence and degree of these changes were determined semiquantitatively on periodic acid-Schiff-stained paraffin sections and graded in 100 systematically subsampled glomeruli per animal using light microscopy at x400 magnification and the following scoring system: score 0: no changes of capillaries; score 1: capillary dilatation <25% of glomerular tuft area; score 2: capillary dilatation >25% of glomerular tuft area or capillary aneurysm <50% of glomerular tuft area; score 3: capillary aneurysm comprising 50–75% of glomerular tuft area; and score 4: capillary aneurysm comprising >75% of glomerular tuft area (15).

Analysis of glomerular geometry. Area (AA) and volume density (VV) of the renal cortex and medulla as well as the number of glomeruli per area (NA) were measured using a Zeiss eyepiece (Integrationsplatte II; Zeiss, Oberkochen, Germany) and the point counting method (PP = AA = VV) at a magnification of x400. The number of glomeruli per area (NA) was then corrected for tissue shrinkage (1.082). Total cortex volume (Vcortex) was derived from kidney mass divided by specific weight of the kidney (1.04 g/cm3) times the volume density of the cortex. Glomerular geometry was analyzed as follows: volume density (VV) of glomeruli and area density of glomerular tuft (AAT) were measured by point counting according to PP = AA = VV (43, 44) at a magnification of x400 on hematoxylin and eosin sections. Total area of glomerular tuft (AT) was then determined as AT = AAT x Acortex. The number of glomeruli per volume (NV) was derived from glomerular area density (NA) and the volume density (VV) of glomerular using the formula: NV = k/β x NA1.5/VV0.5, where k = 1.1 (size distribution coefficient) and β =1.382 (shape coefficient for spheres). The total number of glomeruli was derived from the total volume of the renal cortex and the number of glomeruli per cortex volume: Nglom = NV x VCortex. The mean glomerular tuft volume was determined according to v = β/k x AT1.5, where β = 1.382 and k = 1.1 (2, 38).

Analysis of glomerular capillary length density as an index of capillary loss and neoformation. Within five semithin sections per animal, glomerular capillary density and volume were analyzed using the point counting method and a 100 point eyepiece (Integrationplatte II, Zeiss) at a magnification of x1,000 (oil immersion) as described previously (4). Briefly, glomerular capillary volume density (VV) and length density (LV), i.e., total capillary length per volume of the glomerulus, were calculated in at least 30 glomeruli per animal according to VV = PP and LV = 2 QA, where QA is capillary density, i.e., the number of capillary transects per area of the capillary convolute (4). Total capillary length per glomerulus (Ltot) was determined according to LV x mean glomerular volume (4).

Western Blotting

To detect changes in protein expression of ANG1, ANG2, Tie-2, and VEGF, standard Western immunoblotting techniques were used. Whole kidney homogenates were lysed in sample buffer (1% Nonidet P-40, 50 mmol/l Tris, 150 mmol/l NaCl, 1 mmol/l EGTA, 1 mmol/l Na-orthovanadate, and 1 mmol/l PMSF). Protein content was measured using Bradford protein assay reagent (Pierce, Rockford, IL). Before gel analysis, the protein samples were heated for 10 min at 70°C. For one-dimensional Western blot analysis, the proteins (25 µg) were separated by electrophoresis using a 12% SDS-PAGE. After electrophoresis, the proteins were transferred to Hybond C-extra nitrocellulose membrane (Amersham Biosciences, Freiburg, Germany). Nonspecific binding sites were blocked for 1 h [5% nonfat milk and 0.05% Tween 20 in Tris-buffered saline (TBS)]. Then, the membranes were exposed to the respective primary antibodies overnight at 4°C and washed four times. Afterwards, they were incubated with peroxidase-labeled secondary antibodies (Dako, Hamburg, Germany) for 1 h and again washed four times. For negative controls, antibodies were incubated with equal amounts of immunizing peptide or preimmune serum at the same concentration. The blots were then detected using super signal (Pierce). The bands corresponding to ANG1 (55 and 75 kDa), ANG2 (75 kDa; Rockland, Gilbertsville, PA), VEGF (28 kDa), and Tie-2 (140 kDa; Santa Cruz Biotechnology, Heidelberg, Germany) were detected according to the enhanced chemiluminiscence protocol (Pierce) with Fugi-Film LAS-1,000 and quantified using AIDA software (Raytest, Straubenhardt, Germany). Coomassie blue staining (Invitrogen, Karlsruhe, Germany) or β-actin (Sigma-Aldrich, Deisenhofen, Gemany) was used to confirm an equal amount of protein load in each lane. For absorption control experiments, the membrane was stripped of bound antibody, and the first antibody was incubated with the blocking peptide overnight before reprobing.

Laser Capture Microdissection and RNA Isolation

Ten-micrometer-thick cryosections were placed on special slides covered with a clear polyethylene membrane (MMI AG, Glottbrugg, Switzerland). In three animals per group (day 6 of anti-Thy1.1 GN and controls), 30 mesangiolytic and normal glomeruli were microdissected for real-time PCR. From one representative animal per group (day 6 of anti-Thy1.1 GN and controls), 150–200 glomeruli were microdissected under visual control for microarray analysis. In anti-Thy1.1 GN, only those glomeruli were dissected that showed either mesangiolysis or capillary aneurysms. The target structures were dissected from adjacent tubulointerstitial tissue at x200 magnification with the µCut Laser Microdissection System (MMI AG). Subsequently, dissected glomeruli were transferred into "adhesive caps" (MMI) on RNAse-free conditions. For RNA extraction, the glomeruli were transferred into a reaction tube containing 1 µl β-mercaptoethanol and 1 µl ExpressArt RNA Care N-Carrier in 100 µl RLT-buffer (Qiagen RNeasy Micro kit, Hilden, Germany). The reaction tubes were inverted and incubated (15 min, room temperature). Then, total RNA from laser capture microdissected glomeruli was isolated as described previously (15). Quality and quantity of total-RNA were checked using the Agilent Lab-on-a-Chip system (RNA 6000 Nano LabChip kit, Agilent Technologies).

RNA Preparations for Microarray

The mRNA amplification by in vitro transcription of cDNA (42) maintains relative mRNA levels when starting with 1 µg of poly(A)+ or 10 µg of total RNA (11, 27). The standard protocol for the 10-µg amplifications used a 20 µl reverse transcription (RT) reaction with 200 U SuperScript II (Invitrogen Life Technologies, Carlsbad, CA) and 0.5 µg (dT)-T7 primer. Briefly, for the first round of the 10- or 2-ng amplifications, RT was performed in 1 µl with 10 ng (dT)-T7 primer [GCATTAGCGGCCGCGAAATTAATACGACTCACTATAGGGAGA(T)21V] and 0.2 µg T4gp32 and incubated for 40 min at 42°C, 10 min at 50°C, and 10 min at 55°C. The reactions were primed by heating to 70°C for 4 min in a thermal cycler (8). Second-strand synthesis (SSS) was carried out in 65 µl with 20 U DNA polymerase I, 1 U Escherichia coli RNase H, and 5 U E. coli DNA ligase in 5x second-strand buffer (Invitrogen Life Technologies) and incubation at 14–15°C for 2 h (19). DNA was purified by phenol/chloroform extraction followed by chromatography on the BioGel P-6 MicroSpin column (Bio-Rad, Munich, Germany). In vitro transcription was performed after ethanol precipitation (AmpliScribe T7 transkriptions kit, Epicentre). RNA from microdissected glomeruli of one control rat and one rat of day 6 of anti-Thy1.1. GN was purified using Qiagen RNeasy mini columns (Qiagen, Hilden, Germany). For the second round of amplification, RT was performed in 10 µl with 0.5 µg random hexamers and ~2.0 µg T4gp32 and incubation for 20 min at 37°C, 20 min at 42°C, 10 min at 50°C, and 10 min at 55°C. For SSS in the second round, 1 U RNase H was first added to the heat-inactivated 10 µl RT reaction followed by incubation at 37°C for 30 min, denaturation at 95°C for 2 min, and snap cooling on ice; 0.1 µg (dT)-T7 primer was added to the cDNA, and the SSS reaction was primed (10 min, 42°C) followed by snap cooling on ice. For microarrays, 2 µg of biotin-labeled aRNA were used in each step of hybridization as described in the Affymetrix Expression Analysis Technical Manual (in cooperation with L. Klein-Hitpass, Institute of Cellbiology, Essen, Germany). Affymetrix microarrays were used to evaluate the transcript levels of 30,000 genes, and the Affymetrix RAE230A Microarray GeneChip was used for identification of differentially expressed genes. With the use of the Affymetrix GeneChip software, three parameters were considered for the analysis, i.e., average difference intensity change, difference call, and fold change. Gene expression levels that varied less than twofold relative to the biological baseline or had a difference call of "no change," as determined by the GeneChip algorithms, were considered unchanged. The "present" vs. "absent" call was based on a detected P value. The analysis indicated whether a transcript is reliably detected (present) or not detected (absent). The score is calculated for each probe pair and is compared with a predefined threshold Tau. Probe pairs with scores higher than Tau vote for the presence of the transcript. Microarray intensity values of mesangiolytic glomeruli from day 6 of GN were compared with the intensity values of glomeruli from undiseased controls.

TaqMan PCR

The microarrays results for ANG1, ANG2, and Tie-2 and three other upregulated genes, i.e., collagen {alpha}1, vimentin, vascular adhesion molecule-1 (VCAM-1), were validated by real-time RT-PCR TaqMan analysis using the ABI Prism 7900 Sequence Detector System (PE Applied Biosystems, Foster City, CA), as described previously (20). One microgram of amplified RNA was reversely transcribed (20 µl RT reaction) using oligo-(dT) primers and RT (Superscript II, Invitrogen). The product was diluted 10 times and used for real-time quantitative PCR. TaqMan probes and primers for the genes were designed using primer design software Primer Expresd (PE Applied Biosystems) and summarized in Table 1. The final optimized concentrations of forward primer, reverse primer, and target genes were 900, 900, and 100 nmol/l, respectively. All PCR assays were performed in duplicate, and the results are given by mean values of copies per 50 ng cDNA. GAPDH was used as a housekeeping gene.


View this table:
[in this window]
[in a new window]

  		Table 1. TaqMan probes and primers for the genes of interest

 
Nonradioactive in Situ Hybridization for Localization of ANG1, ANG2, Tie-2, and VEGF Gene Expression

For direct comparison of ANG1, ANG2, Tie-2, and VEGF gene expression, nonradioactive in situ hybridization using sense and antisense probes was performed as described in detail previously (3, 9). Briefly, 10-µm-thick frozen sections were melted on silanized (3-aminopropyltriethoxysilane; Fluka, Buchs, Switzerland) glass slides, dried at 50°C, and fixed for 15 min in 4% paraformaldehyde/PBS followed by dehydration through ethanol (30, 60, 80, 95, and 100% ethanol, 5 min each). Slides were incubated in 0.2 mol/l HCl (10 min, room temperature) followed by digestion with proteinase K (10 µg/ml; Sigma-Aldrich) and acetylation with 0.1 mol/l triethanolamine (Sigma-Aldrich) mixed with 0.25% acetic anhydride (Fluka) for 10 min at room temperature. Sections were then prehybridized in 4x SSC, 0.02% SDS, 5x Denhardt's solution, 50% ultrapure formamide (Life Technologies), 5% dextran sulfate (Sigma-Aldrich), and 0.5 mg/ml yeast tRNA (Sigma-Aldrich) for 5 h at room temperature. Hybridization was performed with a digoxigenin-labeled cRNA (Boehringer-Mannheim, Mannheim, Germany) generated by in vitro transcription using the following cDNA templates: a 560-bp NotI-EcoRI ANG1 cDNA fragment, a 640-bp EcoRI-XhoI ANG2 cDNA fragment, a 560-bp SacII-NotI Tie-2 cDNA fragment encoding part of the murine Tie-2 extracellular domain, and a 583-bp NotI-EcoRI VEGF cDNA fragment. Labeled cRNA probes were used at a concentration of 0.5 ng RNA/µl. Hybridization with sense probe served as control. Tissue sections were incubated in a humidified chamber under glass coverslips at 70°C (hybridization oven, Biometra, Göttingen, Germany) for 16–18 h. Posthybridization stringency washes included 0.2x SSC (30 min, 70°C), 2x SSC (2 min, room temperature), 0.2x SSC (15 min, 70°C), and 2x SSC (5 min, room temperature). Each wash was performed twice. Hybridized probes were detected by an anti-digoxigenin antibody conjugated to alkaline phosphatase (diluted 1:500, 1 h, room temperature) using nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution as substrate (Boehringer-Mannheim). Color reaction time ranged from 2 h to 2 days, after which slides were rinsed in PBS, counterstained with hematoxylin, finally rinsed in aqua dest, and mounted in elvanol.

Double Immunofluorescence Analysis for Detailed Localization of ANG1, ANG2, Tie-2 and VEGF Protein Expression

Immunolabeling was performed on 5-µm-thick cryosections of control rats and rats at day 6 of anti-Thy1.1 GN using the following antibodies: rabbit polyclonal antibody against ANG1 (1:100, Rockland), rabbit polyclonal antibody against ANG2 (1:100, Rockland), rabbit polyclonal antibody against Tie-2 (1:50, Santa Cruz Biotechnology), mouse monoclonal antibody against VEGF (1:30, Abcam, Cambridge, UK), rabbit polyclonal antibody against podoplanin (1:1,000, Sigma-Aldrich), mouse monoclonal antibody against CD31 (1:100, Serotec, Düsseldorf, Germany), mouse monoclonal antibody against Ox-7 (kindly provided by C. Hugo, Erlangen, Germany), and mouse monoclonal antibody against synaptopodin (1:100, Acris Antibodies, Hiddenhausen, Germany). Briefly, cryosections were washed in TBS (pH 7.6) before and after incubation. Nonspecific binding sites were blocked by incubation in 5% skim milk. Goat anti-rabbit and goat anti-mouse Alexa 488, goat anti-rabbit, and goat anti-mouse Alexa 568 (all from Molecular Probes, Invitrogen) were used as secondary antibodies. For the following double stainings: VEGF and CD31, VEGF and OX-7, ANG1 and podoplanin, ANG2 and podoplanin, and Tie-2 and podoplanin, streptavidin-Alexa 488 antibody was also used. Evaluation of double staining was performed using a fluorescence microscope in a blinded manner. Negative controls were performed by replacing the primary antibodies with TBS.

Immunohistochemical Analysis of Glomerular Proliferation and Apoptosis

To asses glomerular cell proliferation and apoptosis antibodies against the proliferating cell nuclear antigen (PCNA; 1:150, Immunotech 1510, Marseille, France) and activated caspase-3 (anti-caspase-3, 1:100, DCS Innovative Diagnostik-System, Hamburg, Germany) were used (38). The sections were examined by light microscopy at a magnification of x400. The number of PCNA- and caspase-3-positive cells was counted per glomerular area in 50 systematically subsampled glomeruli (38). In addition, to analyze the nature of the apoptotic cells, double immunofluorescence stainings with antibodies against CD31 as endothelial and Ox-7 as mesangial markers (dilutions as above) and caspase-3 were performed and qualitatively analyzed.

Statistics

Data are means ± SD. As testing for normality of distribution failed, a nonparametric test was chosen. Whether differences between expression levels at defined days were significant was assessed using Kolmogorov-Smirnov test. The results were considered significant when the probability of error (P) was <0.05.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Characterization of the Animal Model

Animal data. Body and kidney weights were comparable in all animal groups (data not shown). Albuminuria was negligible in control rats (0.10 ± 0.08 mg/24 h). Significant higher urinary albumin excretion was seen in anti-Thy1.1 GN rats at day 6 (54.1 ± 23.5 mg/24 h) and day 12 (24.6 ± 11.2 mg/24 h).

Capillary aneurysm score and capillary length density as indexes of glomerular injury and repair (Fig. 1, A–C). The typical morphological changes during the course of anti-Thy1.1 GN are illustrated in Fig. 1A. Compared with normal glomeruli in control animals, glomeruli at day 6 of anti-Thy1.1 GN were enlarged with capillary aneurysm formation and initial mesangial matrix expansion. The semiquantitative assessment of capillary dilatation and aneurysm formation revealed a significant increase at days 6 and 12 of the disease compared with controls (Fig. 1B). The score at day 6 of the disease was significantly higher than at day 12. Glomerular capillary length density, i.e., total capillary length per volume capillary tuft, was significantly (P < 0.05) lower at day 6 (2,657 ± 426 mm/mm3) than in controls (7,622 ± 930 mm/mm3), indicating a markedly reduced capillary supply (–65%) presumably due to capillary destruction (Fig. 1C). At day 12 of anti-Thy1.1 GN, the length density of glomerular capillaries was significantly higher than at day 6 and was almost back to control levels (5,321 ± 700 mm/mm3), indicating restoration of the capillary tuft in parallel with glomerular repair.


Figure 1
View larger version (39K):
[in this window]
[in a new window]

  		Fig. 1. Characteristic morphological changes in anti-Thy1.1 glomerulonephritis (GN). A: representative time course of the disease. Glomerular enlargement and capillary aneurysm formation with segmental fibrosis is seen at day 6 of the disease. At day 12, mesangial cell (MC) hyperplasia and less matrix expansion are seen together with restoration of the glomerular capillary tuft. Magnification of semithin sections: x40. B: capillary aneurysm formation during the course of the disease. In anti-Thy1.1 GN, semiquantitative assessment of capillary dilatation and aneurysm formation showed a significant higher score at days 6 and 12 of the disease compared with controls. Value at day 6 was again significantly higher than at day 12. Data are means ± SD (*P < 0.05). C: length density of glomerular capillaries. Glomerular capillary length density as a three-dimensional index of glomerular capillarization was significantly lower at day 6 of anti-Thy1.1 GN than in controls. It was significantly higher again at day 12 when length density of glomerular capillaries almost reached normal values.

 
Results of the cDNA Microarrays

The microarray analysis of microdissected mesangiolytic glomeruli at day 6 of anti-Thy1.1 GN showed that 120 genes were upregulated and 76 genes downregulated more than twofold compared with control glomeruli (Tables 2 and 3). Of note, among the most strongly upregulated genes were ANG1 and ANG2, whereas Tie-2 expression was not markedly altered. Other genes that were upregulated in the microarray analysis (Table 2) were, for example, extracellular matrix genes (i.e., collagen {alpha}I, vimentin, and fibronectin), the adhesion molecule VCAM-1, signal transducer proteins (i.e., interleukin), and protein tyrosine phosphatase. Downregulated genes were, for example, lysophospholipase, cytochrome P450, organic anion transporter 5, and angiotensinogen.


View this table:
[in this window]
[in a new window]

  		Table 2. Genes that were up regulated at day 6 of anti-Thy1.1 of GN by glomerular microarray analysis and RT-PCR

 

View this table:
[in this window]
[in a new window]

  		Table 3. Genes that were downregulated at day 6 of anti-Thy1.1 of GN by glomerular microarray analysis

 
Analysis of Gene and Protein Expression of Angiopoietins, Tie-2, and VEGF in Mesangiolytic Glomeruli of anti-Thy1.1 GN

ANG1 and ANG2 mRNA expression in microdissected glomeruli by real-time PCR. To verify that glomerular ANG1 and ANG2 gene expression is upregulated at day 6 of anti-Thy1.1 GN, real-time PCR analyses using TaqMan were performed. Glomerular ANG1 (Fig. 2A) and ANG2 (Fig. 2B) gene expression was significantly increased at day 6 compared with control. At day 12 of the disease, however, expression was slightly lower than at day 6; the difference to controls, however, was no more statistically significant. In contrast, Tie-2 (Fig. 2C) gene expression in microdissected glomeruli was not significantly changed during the course of anti-Thy1.1 GN.


Figure 2
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 2. Results of gene expression analysis by TaqMan PCR. At day 6 of anti-Thy1.1 GN when glomerular injury was most pronounced, glomerular angiopoietin 1 (ANG1; A) and angiopoietin 2 (ANG2; B) gene expression was significantly higher than in controls (*P < 0.05). In contrast, Tie-2 (C) gene expression was not altered in microdissected glomeruli from anti-Thy1.1 GN rats. Data are expressed as the mean of copy number per 50 ng cDNA normalized against the housekeeping gene GAPDH.

 
To confirm the microarray data, real-time PCR analyses for three other genes that were markedly upregulated at day 6 of anti-Thy1.1 GN, i.e., collagen {alpha}I, vimentin, and VCAM-1 were also performed. For all three genes, mRNA expression was also significantly increased at day 6 of the disease compared with controls, thus confirming the microarray data (Table 2).

In Situ Hybridization for ANG1, ANG2, Tie-2, and VEGF

With the use of nonradioactive in situ hybridization, ANG1 and ANG2 mRNA expression was predominantly seen in podocytes of control and diseased rats at day 6, whereas Tie-2 mRNA was confined to ECs (Fig. 3). In control glomeruli, Tie-2, ANG1, and ANG2 mRNA expression was lower than at day 6 of the disease. VEGF gene expression was already prominent in control glomeruli and was only slightly upregulated at day 6 of the disease.


Figure 3
View larger version (110K):
[in this window]
[in a new window]

  		Fig. 3. In situ hybridization for ANG1, ANG2, Tie-2, and VEGF. In situ hybridization confirmed VEGF mRNA expression in MCs, whereas ANG1 and ANG2 mRNA expression was predominantly seen in podocytes. Tie-2 mRNA expression was localized to ECs. In control glomeruli, ANG1 and ANG2 mRNA expression was lower than at day 6 of anti-Thy1.1 GN, whereas Tie-2 expression was more or less the same. VEGF gene expression was already prominent in control glomeruli and was only slightly upregulated at day 6 of anti-Thy1.1 GN.

 
Western Blotting

By Western blot, VEGF, ANG1, ANG2, and Tie-2 protein expression was present in all kidney samples (Fig. 4). After prereaction with the relevant immunizing peptides, these signals were abolished (data not shown). VEGF gave a 28-kDa band, ANG1 bands were observed at 55 kDa, representing the monomer, and at 75 kDa, representing most likely a dimer. The predicted size of ANG2 was a 55 kDa, but in most cases we also observed a 75-kDa band, which represent a highly glycosylated form of the protein that migrates at a higher molecular mass. Protein expression of ANG1 and ANG2 was higher at day 6 of anti-Thy1.1 GN compared with controls and day 12 of the disease. Due to the glycosylated forms of ANG1 and ANG2, it was difficult to perform densitometry. For Tie-2, we obtained signals at 140 kDa. In contrast to the angiopoietins, at day 6 of anti-Thy1.1 GN, Tie-2 protein expression was decreased compared with controls and was still somewhat lower at day 12 of the disease. At day 6 of anti-Thy1.1 GN, VEGF protein expression tended to be higher compared with control and was also somewhat higher at day 12 compared with day 6 of the disease.


Figure 4
View larger version (45K):
[in this window]
[in a new window]

  		Fig. 4. Western blot analysis of ANG1, ANG2, Tie-2, and VEGF. By Western blot analysis, ANG1 bands were observed at 55 kDa, representing the monomer, and at 75 kDa, representing most likely a dimer. The predicted size of ANG2 was a 55-kDa band, but in most cases we also observed a 75-kDa band representing a highly glycosylated form of the protein that migrates at a higher molecular mass. Bands for ANG1 and ANG2 showed increased protein expression at day (d) 6 of anti-Thy1.1 GN compared with control. Expression was lower again at day 12 of the disease compared with day 6. For Tie-2, the signal was obtained at 140 kDa; it was slightly lower at day 6 of anti-Thy1.1 GN compared with controls and somewhat higher again at day 12 of the disease. VEGF protein expression, represented by a 28-kDa band, tended to be higher at day 6 compared with control and was also higher at day 12 compared with day 6 of the disease.

 
Cellular Localization of ANG1, ANG2, Tie-2, and VEGF Protein Expression as Indicated by Double Immunofluorescence

Protein expression of ANG1, ANG2, their receptor Tie-2, and VEGF was already detectable in glomeruli of normal rats (Fig. 5 –8, a–i). ANG1 and ANG2 protein expression was confined to podocytes, as indicated by colocalization with the podocyte specific marker podoplanin (Figs. 5 and 6, g–i). In control glomeruli, ANG2 protein expression was confined to the podocyte cell membrane and foot processes (Fig. 6, g–i), whereas in nephritic rats the staining was more nuclear (Fig. 6, p–r). In contrast, Tie-2 protein expression was localized to ECs as shown by double staining with the endothelial marker CD31 (Fig. 7, a–c). VEGF expression was confined to MCs, as documented by double immunofluorescence with the MC marker Ox-7 (Fig. 8, d–f). Protein expression of VEGF (Fig. 8), ANG1 (Fig. 5), and ANG2 (Fig. 6) were upregulated at day 6 of anti-Thy1.1 GN (Figs. 5–8, j–r). In contrast, Tie-2 protein expression was slightly lower at day 6 (Fig. 7, j–l) compared with controls (Fig. 7, a–c).


Figure 5
View larger version (86K):
[in this window]
[in a new window]

  		Fig. 5. Immunofluorescence colocalization studies using antibodies against ANG1, CD31, Ox-7, and podoplanin. In control glomeruli (a–i) ANG1 (a, d, g), protein expression is confined to podocytes, as shown by colocalization with the podocyte specific marker podoplanin (Podo: g–i). There was no expression of ANG1 in ECs (a–c) or MCs (d–f). This expression pattern is not changed in anti-Thy1.1 GN (j–r). Magnification: x400.

 

Figure 8
View larger version (84K):
[in this window]
[in a new window]

  		Fig. 8. Immunofluorescence colocalization studies using antibodies against VEGF, CD31, Ox-7, and podoplanin. In control glomeruli (a–i) VEGF (a, d, g) protein expression is confined to MC, as seen by double staining with the MC-specific marker Ox-7 (d–f). There was no expression of VEGF in ECs (a–c) or podocytes (g–i). This expression pattern was not changed in anti-Thy1.1 GN (j–r). Magnification: x400.

 

Figure 6
View larger version (80K):
[in this window]
[in a new window]

  		Fig. 6. Immunofluorescence colocalization studies using antibodies against ANG2, CD31, Ox-7, and podoplanin. In control glomeruli (a–i), ANG2 (a, d, g) protein expression is confined to podocyte cell membrane and foot processes, as shown by double staining with the podocyte specific marker podoplanin (g–i). There was no expression of ANG2 in ECs (a–c) or in MC (d–f). Podocytic expression of ANG2 was even more intense in anti-Thy-1.1 GN (j–r). Magnification: x400.

 

Figure 7
View larger version (78K):
[in this window]
[in a new window]

  		Fig. 7. Immunofluorescence colocalization studies using antibodies against Tie-2, CD31, Ox-7, and podoplanin. In control glomeruli (a–i) Tie-2 (a, d, g) protein expression is confined to ECs as shown by colocalization with the EC marker CD31 (a–c). There was no expression of Tie-2 in MCs (d–f) or podocytes (g–i). This expression pattern was similar in anti-Thy1.1 GN (j–r). Magnification: x400.

 
Analysis of Glomerular Proliferation and Apoptosis

The number of PCNA-positive glomerular cells was significantly higher at days 6 and 12 of anti-Thy1.1 GN than in controls, indicating proliferation of MCs and ECs (Fig. 9A). The number of apoptotic glomerular cells was also significantly higher at days 6 and 12 of the disease compared with controls, indicating ongoing apoptosis of ECs and MCs (Fig. 9B). Double staining with EC and MC markers revealed a high number of apoptotic ECs at day 6 of anti-Thy1.1 GN (Fig. 9Cb) in parallel with a high number of proliferating MCs. In contrast, at day 12 of the disease more MCs than ECs underwent apoptosis (Fig. 9f).


Figure 9
View larger version (78K):
[in this window]
[in a new window]

  		Fig. 9. Analysis of glomerular proliferation and apoptosis. Numbers of proliferating cell nuclear antigen (PCNA)-positive glomerular cells at days 6 and 12 of anti-Thy1.1 GN were significantly higher than in controls (A), indicating marked proliferation of MCs at day 6 and of endothelial cells (ECs) at day 12. In parallel, there was significantly higher number of apoptotic ECs at day 6 and of MCs at day 12 of the disease compared with controls (B). Double staining with EC and MC markers (C) revealed a high number of apoptotic ECs at day 6 of anti-Thy1.1 GN (b) in parallel with a high number of proliferating mesangial cells. In contrast, at day 12 of the disease more MCs than ECs underwent apoptosis (f). a–e: Immunofluorescence colocalization studies with antibodies against CD31 (endothelial cell marker), caspase-3 (apoptotic marker) and OX-7 (mesangial cell marker).

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
The present study investigated the involvement of angiopoietins and their receptor Tie-2 during capillary restoration and glomerular healing in anti-Thy1.1 GN, an animal model of mesangioproliferative GN. In this model, initial mesangiolytic injury is followed by MC proliferation and mesangial matrix accumulation, ultimately leading to complete healing of glomerular injury (24). Using microarrays analysis of microdissected mesangiolytic glomeruli and real-time PCR, we found a significant upregulation of ANG1 and ANG2 mRNA at day 6 of GN when glomerular injury was most marked. In contrast, gene expression of the angiopoietin receptor Tie-2 was not significantly altered during the course of the disease. Changes in gene and protein expression as well as the exact cellular localization of ANG1, ANG2, and Tie-2 in anti-Thy1.1 GN were further analyzed by in situ studies using nonradioactive in situ hybridization and double immunofluorescence. The results of the present study argue for a tightly controlled temporal and spatial expression of ANG1, ANG2, their receptor Tie-2, and VEGF in the repair of mesangiolytic glomerular injury.

Glomerular VEGF expression is increased in anti-Thy1.1 GN, and VEGF is thought to modulate capillary remodeling and glomerular repair (17, 21). VEGF signaling is also essential in glomerular development, maintenance, and repair (22, 31). VEGF acts as a mitogen for ECs in the early phase after injury, thereby stimulating vascular regeneration and glomerular repair (5, 16, 23, 32, 41). In our study, a predominantly mesangial pattern of VEGF gene and protein expression was seen in glomeruli of control and rats at day 6 of anti-Thy1.1 GN. In renal diseases, VEGF may play contradictory roles, i.e., in acute glomerular inflammation it is protective and favors glomerular healing (30, 31), whereas in diabetic nephropathy it is deleterious, inducing increased capillary permeability (14, 40). Other angiogenic factors involved in neoangiogenesis and vascular remodeling are the angiopoietins, i.e., ANG1, ANG2, and their receptor Tie-2. The angiopoietins are known to act in concert with VEGF to preserve vascular endothelium integrity and to not only promote vessel maturation but also vessel regression (18, 25). ANG1 is a known inhibitor of vascular permeability (10), acting in a coordinated and complementary fashion with VEGF (18). In the kidney, ANG1 is supposed to be a regulator of VEGF actions with respect to glomerular permeability (37). ANG1 does not induce vascular proliferation itself but stabilizes an existing vascular network (37). ANG2, the natural antagonist of ANG1, either induces regression of preexisting vessels or EC proliferation, depending on the presence of low or high VEGF levels (28, 34).

As in previous studies in normal rat glomeruli (30, 37), expression of VEGF, ANG1, and ANG2 in anti-Thy1.1 GN was confined to podocytes. Angiopoietin signaling is mediated via Tie-2 receptor located on ECs (10, 13, 37). In our study in anti-Thy1.1 GN, Tie-2 protein expression was also exclusively seen on ECs arguing for a role of this receptor in EC proliferation, survival, and apoptosis in response to angiopoietin signaling from podocytes. This idea is further sustained by increased podocytic expression of ANG1 and ANG2 at day 6 of GN when capillary aneurysm formation and destruction as well as EC apoptosis were highest. As recently shown (24), podocytes constitute the scaffold of the glomerulus during mesangiolytic damage organizing glomerular recovery or death. Therefore, it is conceivable to assume that they also coordinate capillary growth and neoformation via upregulation of angiopoietins in addition to VEGF. In this context, it is tempting to speculate that coordinated and simultaneous expression of ANG1 and ANG2 are necessary to generate the proangiogenic environment that is required for glomerular repair. This is in agreement with studies postulating a growth-modulating role of ANG1 and ANG2 for Tie-2 expressing glomerular ECs (45).

Of note, in a mice model of anti-glomerular basement membrane GN increased ANG2 expression and decreased ANG1 and VEGF immunoreactivity were seen after 14 days and a role of ANG2 in EC apoptosis was postulated (46). In our study in rats with anti-Thy1.1 GN, increased glomerular gene and protein expression of ANG1 and ANG2 at day 6 of the disease was paralleled by enhanced EC apoptosis, as also seen by Davis et al. (12) in mice. The expression pattern of angiopoietins in the present study, however, is somewhat different from other studies in GN (26, 47). However, it is likely that the most important consideration in these experimental models is the ANG1/ANG2 balance. In this regard, the present microarray data document a fourfold upregulation of ANG2 and a twofold upregulation of ANG1, indicating a balance in favor of ANG2 in accordance with the above-mentioned studies (26, 47). Of note, Yuan et al. (47) documented the lack of ANG2 immunostaining in glomerular cells of the mature cortex from 4-wk postnatal mice but found low levels in immature glomeruli. In our study in adult rats a constitutive ANG2 protein expression was found in podocytes of nondiseased glomeruli and this is in agreement with another study (37) showing low levels of ANG2 mRNA in human glomeruli by RT-PCR.

Thus in summary our data argue for different but complementary roles of angiopoietins and Tie-2 during glomerular vascular remodeling in anti-Thy1.1 GN. In particular, a critical role of ANG1 and ANG2 for EC survival and proliferation during glomerular injury and repair is suggested. The stimulation of ANG1 and ANG2 gene and protein expression simultaneously with VEGF at day 6 of GN and the subsequent repair of the glomerular capillary tuft provide circumstantial evidence for an angiopoietin-mediated process of glomerular recovery. We suggest that the temporal and spatial regulation of ANG1, ANG2, and their receptor Tie-2 is also essential for glomerular reconstruction and healing after mesangiolysis in experimental GN. The detailed analysis of other factors involved in glomerular healing may provide further insight into the pathogenesis of human GN and may thus open new therapeutic strategies.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
The work was supported by a Deutsche Forschungsgemeinschaft grant (SFB 423, Project Z2) and IZKF Erlangen (A11).


   ACKNOWLEDGMENTS
 
We thank M. Klewer, M. Ramming, S. Söllner, and S. Thom for excellent technical assistance and M. Sachs for helping with the interpretation of the microarray.


   FOOTNOTES
 

Address for reprint requests and other correspondence: K. Amann, Dept. of Pathology, Univ. of Erlangen-Nürnberg, Krankenhausstr. 12, 91054 Erlangen, Germany (e-mail: kerstin.amann{at}uk-erlangen.de)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Acker T, Beck H, Plate KH. Cell type specific expression of vascular endothelial growth factor and angiopoietin-1 and -2 suggests an important role of astrocytes in cerebellar vascularization. Mech Dev 108: 45–57, 2001.[CrossRef][Web of Science][Medline]
  2. Amann K, Irzyniec T, Mall G, Ritz E. The effect of enalapril on glomerular growth and glomerular lesions after subtotal nephrectomy in the rat: a stereological analysis. J Hypertens 11: 969–975, 1993.[CrossRef][Web of Science][Medline]
  3. Amann K, Münter K, Wessels S, Wagner J, Balajew V, Hergenröder S, Mall G, Ritz E. Endothelin A receptor blockade prevents capillary/myocyte mismatch in the heart of uremic animals. J Am Soc Nephrol 11: 1702–1711, 2000.[Abstract/Free Full Text]
  4. Amann K, Nichols C, Törnig J, Schwarz U, Zeier M, Mall G, Ritz E. Effect of ramipril, nifedipine, and moxonidine on glomerular morphology and podocyte structure in experimental renal failure. Nephrol Dial Transplant 11: 1003–1011, 1996.[Abstract/Free Full Text]
  5. Amaral SL, Linderman JR, Morse MM, Greene AS. Angiogenesis induced by electrical stimulation is mediated by angiotensin II and VEGF. Microcirculation 8: 57–67, 2001.[CrossRef][Web of Science][Medline]
  6. Bagchus WM, Hoedemaeker PJ, Rozing J, Bakker WW. Glomerulonephritis induced by monoclonal anti-Thy1.1 antibodies. A sequential histological and ultrastructural study in the rat. Lab Invest 55: 680–687, 1986.[Web of Science][Medline]
  7. Bagchus WM, Jeunink MF, Elema JD. The mesangium in anti-Thy-1 nephritis. Influx of macrophages, mesangial cell hypercellularity, and macromolecular accumulation. Am J Pathol 137: 215–223, 1990.[Abstract]
  8. Baugh LR, Hill AA, Brown EL, Hunter CP. Quantitative analysis of mRNA amplification by in vitro transcription. Nucleic Acids Res 29: E29, 2001.[CrossRef][Medline]
  9. Beck H, Acker T, Wiessner C, Allegrini PR, Plate KH. Expression of angiopoietin-1, angiopoietin-2, and tie receptors after middle cerebral artery occlusion in the rat. Am J Pathol 157: 1473–1483, 2000.[Abstract/Free Full Text]
  10. Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nat Med 6: 389–395, 2000.[CrossRef][Web of Science][Medline]
  11. Chu S, DeRisi J, Eisen M, Mulholland J, Botstein D, Brown PO, Herskowitz I. The transcriptional program of sporulation in budding yeast. Science 282: 699–705, 1998.[Abstract/Free Full Text]
  12. Davis B, Dei CA, Long DA, White KE, Hayward A, Ku CH, Woolf AS, Bilous R, Viberti G, Gnudi L. Podocyte-specific expression of angiopoietin-2 causes proteinuria and apoptosis of glomerular endothelia. J Am Soc Nephrol 18: 2320–2329, 2007.[Abstract/Free Full Text]
  13. Davis S, Aldrich TH, Jones PF, Acheson A, Compton DL, Jain V, Ryan TE, Bruno J, Radziejewski C, Maisonpierre PC, Yancopoulos GD. Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning. Cell 87: 1161–1169, 1996.[CrossRef][Web of Science][Medline]
  14. De Vriese AS, Tilton RG, Elger M, Stephan CC, Kriz W, Lameire NH. Antibodies against vascular endothelial growth factor improve early renal dysfunction in experimental diabetes. J Am Soc Nephrol 12: 993–1000, 2001.[Abstract/Free Full Text]
  15. Dimmler A, Haas CS, Cho S, Hattler M, Forster C, Peters H, Schocklmann HO, Amann K. Laser capture microdissection and real-time PCR for analysis of glomerular endothelin-1 gene expression in mesangiolysis of rat anti-Thy1.1 and murine habu snake venom glomerulonephritis. Diagn Mol Pathol 12: 108–117, 2003.[CrossRef][Web of Science][Medline]
  16. Ferrara N, Houck K, Jakeman L, Leung DW. Molecular and biological properties of the vascular endothelial growth factor family of proteins. Endocr Rev 13: 18–32, 1992.[Abstract/Free Full Text]
  17. Floege J, Eng E, Lindner V, Alpers CE, Young BA, Reidy MA, Johnson RJ. Rat glomerular mesangial cells synthesize basic fibroblast growth factor. Release, upregulated synthesis, and mitogenicity in mesangial proliferative glomerulonephritis. J Clin Invest 90: 2362–2369, 1992.[Web of Science][Medline]
  18. Gale NW, Yancopoulos GD. Growth factors acting via endothelial cell-specific receptor tyrosine kinases: VEGFs, angiopoietins, and ephrins in vascular development. Genes Dev 13: 1055–1066, 1999.[Free Full Text]
  19. Gubler MC, Levy M. Prenatal diagnosis of nail-patella syndrome by intrauterine kidney biopsy. Am J Med Genet 47: 122–124, 1993.[CrossRef][Web of Science][Medline]
  20. Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res 6: 986–994, 1996.[Abstract/Free Full Text]
  21. Iruela-Arispe L, Gordon K, Hugo C, Duijvestijn AM, Claffey KP, Reilly M, Couser WG, Alpers CE, Johnson RJ. Participation of glomerular endothelial cells in the capillary repair of glomerulonephritis. Am J Pathol 147: 1715–1727, 1995.[Abstract]
  22. Kitamoto Y, Tokunaga H, Miyamoto K, Tomita K. [VEGF is an essential molecule for glomerular endothelial cells and its excretion in urine might be a unique marker of glomerular injury.] Rinsho Byori 48: 485–490, 2000.[Medline]
  23. Kitamoto Y, Tokunaga H, Tomita K. Vascular endothelial growth factor is an essential molecule for mouse kidney development: glomerulogenesis and nephrogenesis. J Clin Invest 99: 2351–2357, 1997.[Web of Science][Medline]
  24. Kriz W, Hahnel B, Hosser H, Ostendorf T, Gaertner S, Kranzlin B, Gretz N, Shimizu F, Floege J. Pathways to recovery and loss of nephrons in anti-Thy-1 nephritis. J Am Soc Nephrol 14: 1904–1926, 2003.[Abstract/Free Full Text]
  25. Lobov IB, Brooks PC, Lang RA. Angiopoietin-2 displays VEGF-dependent modulation of capillary structure and endothelial cell survival in vivo. Proc Natl Acad Sci USA 99: 11205–11210, 2002.[Abstract/Free Full Text]
  26. Lu YH, Deng AG, Li N, Song MN, Yang X, Liu JS. Changes in angiopoietin expression in glomeruli involved in glomerulosclerosis in rats with daunorubicin-induced nephrosis. Acta Pharmacol Sin 27: 579–587, 2006.[CrossRef][Web of Science][Medline]
  27. Mahadevappa M, Warrington JA. A high-density probe array sample preparation method using 10- to 100-fold fewer cells. Nat Biotechnol 17: 1134–1136, 1999.[CrossRef][Web of Science][Medline]
  28. Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wiegand SJ, Radziejewski C, Compton D, McClain J, Aldrich TH, Papadopoulos N, Daly TJ, Davis S, Sato TN, Yancopoulos GD. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 277: 55–60, 1997.[Abstract/Free Full Text]
  29. Marti HH, Risau W. Systemic hypoxia changes the organ-specific distribution of vascular endothelial growth factor and its receptors. Proc Natl Acad Sci USA 95: 15809–15814, 1998.[Abstract/Free Full Text]
  30. Masuda Y, Shimizu A, Mori T, Ishiwata T, Kitamura H, Ohashi R, Ishizaki M, Asano G, Sugisaki Y, Yamanaka N. Vascular endothelial growth factor enhances glomerular capillary repair and accelerates resolution of experimentally induced glomerulonephritis. Am J Pathol 159: 599–608, 2001.[Abstract/Free Full Text]
  31. Noguchi K, Yoshikawa N, Ito-Kariya S, Inoue Y, Hayashi Y, Ito H, Nakamura H, Iijima K. Activated mesangial cells produce vascular permeability factor in early-stage mesangial proliferative glomerulonephritis. J Am Soc Nephrol 9: 1815–1825, 1998.[Abstract]
  32. Ostendorf T, Kunter U, Eitner F, Loos A, Regele H, Kerjaschki D, Henninger DD, Janjic N, Floege J. VEGF(165) mediates glomerular endothelial repair. J Clin Invest 104: 913–923, 1999.[Web of Science][Medline]
  33. Peters H, Border WA, Noble NA. Targeting TGF-beta overexpression in renal disease: maximizing the antifibrotic action of angiotensin II blockade. Kidney Int 54: 1570–1580, 1998.[CrossRef][Web of Science][Medline]
  34. Ramsauer M, D'Amore PA. Getting Tie(2)d up in angiogenesis. J Clin Invest 110: 1615–1617, 2002.[CrossRef][Web of Science][Medline]
  35. Sahai A, Mei C, Pattison TA, Tannen RL. Chronic hypoxia induces proliferation of cultured mesangial cells: role of calcium and protein kinase C. Am J Physiol Renal Physiol 273: F954–F960, 1997.[Abstract/Free Full Text]
  36. Sasaki S, Bao Q, Hughes RC. Galectin-3 modulates rat mesangial cell proliferation and matrix synthesis during experimental glomerulonephritis induced by anti-Thy1.1 antibodies. J Pathol 187: 481–489, 1999.[CrossRef][Web of Science][Medline]
  37. Satchell SC, Harper SJ, Tooke JE, Kerjaschki D, Saleem MA, Mathieson PW. Human podocytes express angiopoietin 1, a potential regulator of glomerular vascular endothelial growth factor. J Am Soc Nephrol 13: 544–550, 2002.[Abstract/Free Full Text]
  38. Schwarz U, Amann K, Orth SR, Simonaviciene A, Wessels S, Ritz E. Effect of 1,25 (OH)2 vitamin D3 on glomerulosclerosis in subtotally nephrectomized rats. Kidney Int 53: 1696–1705, 1998.[CrossRef][Web of Science][Medline]
  39. Shimizu A, Masuda Y, Kitamura H, Ishizaki M, Sugisaki Y, Yamanaka N. Recovery of damaged glomerular capillary network with endothelial cell apoptosis in experimental proliferative glomerulonephritis. Nephron 79: 206–214, 1998.[CrossRef][Web of Science][Medline]
  40. Shulman K, Rosen S, Tognazzi K, Manseau EJ, Brown LF. Expression of vascular permeability factor (VPF/VEGF) is altered in many glomerular diseases. J Am Soc Nephrol 7: 661–666, 1996.[Abstract]
  41. Tufro A, Norwood VF, Carey RM, Gomez RA. Vascular endothelial growth factor induces nephrogenesis and vasculogenesis. J Am Soc Nephrol 10: 2125–2134, 1999.[Abstract/Free Full Text]
  42. Van Gelder RN, von Zastrow ME, Yool A, Dement WC, Barchas JD, Eberwine JH. Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proc Natl Acad Sci USA 87: 1663–1667, 1990.[Abstract/Free Full Text]
  43. Weibel E. Practical methods for biological morphometry. In: Stereological Methods. London: Academic, 1979, vol. 2, 1–139.
  44. Weibel E. Practical methods for biological morphometry. In: Stereological Methods. London: Academic, 1979, vol. 1, 1–161.
  45. Woolf AS, Yuan HT. Angiopoietin growth factors and Tie receptor tyrosine kinases in renal vascular development. Pediatr Nephrol 16: 177–184, 2001.[CrossRef][Web of Science][Medline]
  46. Yuan HT, Tipping PG, Li XZ, Long DA, Woolf AS. Angiopoietin correlates with glomerular capillary loss in anti-glomerular basement membrane glomerulonephritis. Kidney Int 61: 2078–2089, 2002.[CrossRef][Web of Science][Medline]
  47. Yuan HT, Yang SP, Woolf AS. Hypoxia upregulates angiopoietin-2, a Tie-2 ligand, in mouse mesangial cells. Kidney Int 58: 1912–1919, 2000.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
 J. Am. Soc. Nephrol.Home page
A. S. Woolf, L. Gnudi, and D. A. Long
Roles of Angiopoietins in Kidney Development and Disease
J. Am. Soc. Nephrol., February 1, 2009; 20(2): 239 - 244.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/5/F1174    most recent
00320.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Câmpean, V.
Right arrow Articles by Amann, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Câmpean, V.
Right arrow Articles by Amann, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.