AJP - Renal Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Renal Physiol 294: F1232-F1237, 2008. First published March 5, 2008; doi:10.1152/ajprenal.00025.2007
0363-6127/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/5/F1232    most recent
00025.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bezerra, C. N. A.
Right arrow Articles by Rebouças, N. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bezerra, C. N. A.
Right arrow Articles by Rebouças, N. A.

Mechanisms underlying the long-term regulation of NHE3 by parathyroid hormone

Camila Nogueira Alves Bezerra, Adriana Castello Costa Girardi, Luciene Regina Carraro-Lacroix, and Nancy Amaral Rebouças

Department of Physiology and Biophysics, Institute of Biomedical Sciences, University of São Paulo, São Paulo, Brazil

Submitted 15 January 2007 ; accepted in final form 27 February 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The activity of the Na+/H+ exchanger NHE3 is regulated by a number of factors including parathyroid hormone (PTH). In the current study, we used a renal epithelial cell line, the opossum kidney (OKP) cell, to elucidate the mechanisms underlying the long-term effects of PTH on NHE3 transport activity and expression. We observed that NHE3 activity was reduced 6 h after addition of PTH, and this reduction persisted almost unaltered after 24 h. The decrease in activity was associated with diminished NHE3 cell surface expression at 6, 16, and 24 h after PTH addition, total cellular NHE3 protein at 16 and 24 h, and NHE3 mRNA abundance at 24 h. The lower levels of NHE3 mRNA were associated to a small, but significant, decrease in mRNA stability. Additionally, by analyzing the rat NHE3 gene promoter activity in OKP cells, we verified that the regulatory region spanning the segment –152 to +55 was mildly reduced under the influence of PTH. This effect was completely abolished by the presence of the PKA inhibitor KT 5720. In conclusion, long-term exposure to PTH results in reduction of NHE3 mRNA levels due to a PKA-dependent inhibitory effect on the NHE3 promoter and a small reduction of mRNA half-life, and decrease in the total amount of protein which is preceded by endocytosis of the apical surface NHE3. The decreased NHE3 expression is likely to be responsible for the reduction of sodium, bicarbonate, and fluid reabsorption in the proximal tubule consistently perceived in experimental models of PTH disorders.

Na+/H+ exchange; proximal tubule; hyperparathyroidism; surface expression; promoter activity

THE HUMAN BODY has a remarkable ability to maintain precise control of its acid-base and volume status. Although multiple mechanisms throughout the body contribute to this process, the renal proximal tubule plays a fundamental role, since it is responsible for reabsorption of the majority of the filtered sodium, bicarbonate, chloride, and water. Two-thirds of the transcellular NaHCO3 reabsorption are mediated by proton secretion through the apical membrane Na+/H+ exchanger, NHE3 (4, 21), and most of NaCl reabsorption is indirectly related to it. This transporter thereby plays an important role in the maintenance of fluid, electrolyte, and acid-base balance, and its activity is regulated in response to a wide variety of acute and chronic changes in physiological parameters (29, 31–33).

The kidney is one of the major target organs for parathyroid hormone (PTH). PTH, the primary regulator of serum calcium and phosphate homeostasis, acts on the proximal tubule, the thick ascending limb, and the distal convoluted tubule to alter urinary electrolyte and fluid excretion (1, 2, 7, 14, 15, 17). PTH has a potent inhibitory effect on NHE3. The acute inhibition of NHE3 by PTH has been consistently reported by several laboratories in experiments in rat proximal tubules in vivo (2, 20, 34, 35) or in cell cultures (25–27). Experiments performed in cultured cell lines provide evidence that the acute inhibition of NHE3 by PTH is mediated by molecular mechanisms including direct phosphorylation of the exchanger followed by a decrement of NHE3 surface expression (6, 36). In addition, in vivo studies carried out by the McDonough laboratory (20) showed that reduction of NHE3 activity in response to acute treatment with PTH is a consequence of NHE3 redistribution from the apical microvilli to the base of the intermicrovillar cleft region.

Chronic hyperparathyroidism affects the proximal tubule H+ secretion and although it is not usually associated with metabolic acidosis due to compensatory H+ extrusion in the distal nephron (2), it might interfere with adaptive mechanisms of renal proximal tubules to changes in volume or acid-base homeostasis (28). We previously described that PTH chronically modulates NHE3 activity and expression in rat kidney (12). To address the molecular mechanisms underlying the long-term modulation of NHE3 by PTH, we used a cell culture model of renal proximal tubule cells from opossum kidney (OKP), in which NHE3, PTH receptor (PTH1R), and other ancillary proteins, such as the Na+/H+ exchanger regulatory factor 1 (NHERF1), known to be important for PTH action (22, 30), have been detected. Consistent with our previous in vivo studies (12), we observed that PTH induces a long-term effect on NHE3 activity in OKP cells. This regulatory control is observed at both protein and mRNA levels in cells exposed to PTH for 24 h. The lower mRNA levels observed 24 h after exposure of OKP cells to PTH were associated to a mild, but significant, decrease in mRNA stability and promoter activity. The inhibitor of PKA, KT 5720, abolished the inhibitory effect of PTH on the promoter, suggesting that this signaling pathway might be involved in this inhibitory process.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We purchased DMEM, heat-inactivated fetal bovine serum, sodium pyruvate, and penicillin/streptomycin from Life Technologies (GIBCO BRL, Gaithersburg, MD); 22Na from New England Nuclear Life Science Products (Boston, MA); 1-34 bovine PTH from Bachem (Torrance, CA); PKA inhibitor KT 5720 and PKC inhibitor GF109203X from TOCRIS Bioscience (Ellisville, MO); monoclonal antibody anti-actin (JLA20) from Calbiochem (San Diego, CA); goat anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibody from Zymed (San Francisco, CA); Lipofectamine Plus Reagent and Platinum Taq DNA Polymerase from Invitrogen (Carlsbad, CA); Dual Luciferase Assay System, pGL3-Basic vector and pRL-CMV vector, and endonuclease restriction enzymes from Promega (Madison, WI); and SYBR GREEN-PCR Core Reagents and other reagents employed for real-time PCR from Applied Biosystems (Foster City, CA). EZ-Link Sulfo-NHS-SS-Biotin and Immunopure Immobilized Streptavidin were from Pierce Biotechnology (Rockford, IL). OKP cells, a clonal subline of the opossum kidney cell line originally described by Cole et al. (5), were provided by Dr. O. W. Moe (University of Texas Southwestern Medical Center, Dallas, TX). Monoclonal antibody directed to opossum NHE3 (3H3) was generously provided by Dr. D. Biemesderfer (Yale University School of Medicine, New Haven, CT). All other reagents and chemicals were obtained from Sigma (St. Louis, MO), unless otherwise specified.

Cell culture. OKP cells were maintained in 75-cm2 tissue culture flasks in DMEM containing 10% heat-inactivated fetal bovine serum, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 µg/ml streptomycin. Cultures were incubated at 37°C in a humidified 5% CO2-air atmosphere. Cells were subcultured by using Ca/Mg-free PBS and 0.25% trypsin/EDTA. For 22Na uptake, and RNA or protein extraction, cells were transferred to 6- or 24-well plates and serum starved for 24 h after confluence before studies. For all experiments, PTH was used at a final concentration of 10–7 M.

Sodium uptake experiments. NHE3 activity was measured after acid-loading by the NH4Cl prepulse technique. After aspiration of the culture medium, the cells were incubated in an isotonic NH4Cl solution containing 30 mM NH4Cl, 90 mM choline chloride, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 5 mM glucose, 20 mM HEPES-Tris, pH 7.4 for 20 min at room temperature. The NH4Cl solution was then removed and cells were incubated for 5 min at room temperature with a NH4+-free solution containing 1 µCi/ml 22Na and 1 mM NaCl, 120 mM choline chloride, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 5 mM glucose, 20 mM HEPES-Tris, pH 7.4. Uptake was terminated by washing cells three times with ice-cold radionuclide-free, NH4+-free buffer, pH 7.4. The cell monolayers were solubilized in 0.2 ml of 0.2 M NaOH and neutralized by addition of 0.2 ml of 0.2 M HCl. Aliquots from each well were aspirated into a scintillation vial and 22Na content was analyzed by liquid scintillation spectroscopy. Nonspecific retention (zero-time value) of 22Na uptake was determined and subtracted from the values for the incubated samples.

SDS-PAGE and immunoblotting. Protein samples were solubilized in SDS sample buffer (2% SDS, 10% glycerol, 100 mM dithiothreitol, 0.1% bromophenol blue, 50 mM Tris, pH 6.8), and proteins were separated by SDS-PAGE using 7.5% polyacrylamide gels according to Laemmli (19). Immunoblotting was performed as described previously (11). The density of protein bands was quantitated using NIH Image.

Cell surface biotinylation. OKP cells were grown to confluence in six-well plates, serum starved for 24 h, and then treated with PTH or vehicle for 6, 16, and 24 h. All the following manipulations were performed at 4°C. Cells were washed twice with PBS containing 0.1 mM CaCl2 and 1.0 mM MgCl2 (PBS-Ca-Mg). The surface membrane proteins were then biotinylated by incubating the cells twice for 25 min with 2 ml of biotinylation buffer (150 mM NaCl, 10 mM triethanolamine; 2 mM CaCl2 and 2 mg/ml of EZ-Link Sulfo-NHS-SS-Biotin). The cells were washed twice for 20 min with a quenching buffer (PBS-Ca-Mg/100 mM glycine) and then solubilized for 1 h by addition of RIPA buffer (150 mM NaCl, 50 mM Tris·HCl, 5 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, pH 7.4) containing protease inhibitors (0.7 µg/ml pepstatin, 0.5 µg/ml leupeptin, 40 µg/ml PMSF) containing 125 mM potassium acetate, 25 mM HEPES, 15 mM sodium pyrophosphate, 1% Triton X-100, 0.7 µg/ml pepstatin A, 0.5 µg/ml leupeptin, 40 µg/ml PMSF, pH 7.4. The samples were centrifuged at 15,000 g for 10 min and 50 µl of streptavidin-coupled agarose were added to the supernatants. After overnight incubation, the beads were washed three times in RIPA buffer, solubilized, and heated in sample buffer for SDS-PAGE and immunoblotting.

RNA extraction. RNA was extracted from OKP cells using TRIzol Reagent (Invitrogen) following the manufacturer's protocol. Subsequently, the RNA was treated with DNAse-RNase free and purified using RNeasy Mini Kit (Quiagen). The extracted RNA was quantified in a GeneQuant spectrophotometer (Pharmacia) at a wave length of 260 nm/280 nm, and the extract was stored at –70°C until analysis.

Real-time quantitative RT-PCR. Real-time quantitative RT-PCR for NHE3-mRNA and β-actin-mRNA, the latter used as internal control, was performed by a two-step method using the SYBR-Green dye to detect double-strand DNAs. Single-strand cDNA was generated by reverse transcription (RT) from DNAse-treated total RNA (2 µg) with Super-Script III Reverse Transcriptase (Invitrogen), using random hexamers as primers. DNA amplification was performed by the Applied Biosystems ABI Prism 7300 Sequence Detection System. We used the SYBR GREEN-PCR Core Reagents kit which contains Applied Biosystems AmpliTaq gold DNA polymerase, AmpErase UNG, dNTPs with UTP, and optimized buffer components. For each PCR reaction, 2 µl of cDNA were added to 11.5 µl of PCR mix containing specific forward (NHE3: 5'-CCACGA-GCTCAACCTGAAG-3', β-actin: 5'-GTGATCACCATTGGCAATGAGAG-3') and reverse primers (NHE3: 5'-GACTGAGGCTTCTACAGTAGATGGACG-3', β-actin: 5'-CGGTATTGGCATACAAATCCTTACG-3'). Thermal cycling conditions were designed as follows: inactivation of possible contaminating amplicons by AmpErase UNG at 50°C for 2 min, initial cDNA denaturation at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and at 60°C for 60 s. All amplification reactions were carried out in duplicate. At the end of each PCR run, a dissociation curve analysis was performed to attest the specificity of the reaction. Data referent to fluorescence measurements obtained during amplification were automatically analyzed by the system to generate the amplification plots and to determine the threshold cycle (Ct) for each sample. Real-time PCR was also used to analyze the NHE3 mRNA stability in the presence of PTH. Total RNA was obtained at time 0, 3, 6, 9, 12, and 24 h after inhibition of transcription by actinomycin D (AcD) in a concentration of 5 µg/ml.

Promoter luciferase constructs. A 2,174-bp fragment including 2,095 bp of the 5' flanking region and 79 bp of the first exon was PCR amplified from rat genomic DNA (forward primer: TCTAGAAAGTAAGCCCCACCTGAG; reverse primer: AGGAGCC-GACACGCATACCGTG). The amplified fragment was inserted into the pGL3-basic vector (Promega). The inserted fragment containing 2,150 bp encompasses 2,095 bp from the 5'-flanking sequence of the rat NHE3 gene and 55 bp from the first exon (3, 16). Subsequent deletions of the NHE3 gene 5'-flanking region with a common termination site at +55 bp were generated using appropriate restriction endonuclease enzymes as follows: Bsu 36I (–2,095/+55), Pvu II (–1,196/+55), Nsi I (–889/+55), Sst II (–467/+55), Apa I (–152/+55), and Bst XI (–140/+55). After digestion, the constructs were purified, blunt ended, and reinserted into the pGL3 vector. Since we observed that the Apa I (–152/+55) construct has the highest activity, we just used it to evaluate the PTH effect.

Plasmid constructs purification and quantification. Plasmids were purified in maxi-prep spin columns (Wizard DNA Purification System, Promega), quantified by spectrometry and by agarose gel electrophoresis. In agarose gels, the DNA bands were dyed with SYBR green I (Molecular Probes) and quantified by a laser densitometer (STORM-Molecular Dynamics), using the software ImageQuant 5.1.

Luciferase reporter gene assay. OKP cells, 70–80% confluent, were transiently cotransfected with 400 ng of pGL-3 basic vector containing chimerical NHE3 promoter gene constructs or pGL-3 basic, and 4 ng of the internal control pRL-CMV vector (Promega), which contains Renilla luciferase downstream of the CMV promoter, using LipofectAMINE Plus Reagent (Invitrogen) according to the manufacturer's protocol. The transfection medium was left for 4 h, and then the cells were incubated in fresh media with serum till confluence. After confluence, the cells were serum starved for more 24 h to get full differentiation. Then, they were incubated in fresh media, without serum, with either vehicle or bovine PTH (1-34) for 3, 6, 16, or 24 h. Luciferase was analyzed using the Dual-Luciferase Reporter Assay System (Promega).

Statistical analysis. Values are presented as means ± SE. Comparison between two groups was performed using unpaired t-tests. If more than two groups were compared, statistical significance was determined by ANOVA followed by Tukey's post hoc test. A P value <0.05 was considered statistically significant.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Sustained effect of PTH on NHE3 activity and expression in OKP cells. The acute effect of PTH on NHE3 in cultured proximal tubule cells has been well investigated, especially by a series of studies accomplished in Orson Moe's laboratory (6, 36). In the present paper, we investigated the sustained effect of PTH on NHE3 activity and expression in OKP cells. Figure 1 shows the time course effect of PTH on NHE3 activity in OKP cells. The EIPA-sensitive 22Na uptake after an acid load is decreased 32.1 ± 1.7% 6 h after addition of 10–7 M PTH to the culture medium, and this reduction persisted practically unaltered after 16 h (39.7 ± 1.6%) and 24 h (36.9 ± 2.8%). As seen in the representative immunoblotting in Fig. 2A, and confirmed by densitometry in Fig. 2B, inhibition of NHE3 activity by PTH seems to be correlated with changes on NHE3 surface expression. The hormone induced a decrease on surface NHE3 of 24.9 ± 1.8, 32.0 ± 2.7, and 31.5 ± 1.7% at 6, 16, and 24 h, respectively, relative to control. Reduction in surface NHE3 precedes reduction in total NHE3 protein abundance (Fig. 3, A and B), which was slightly reduced at 16 h (14.2 ± 1.3%), with further decrement at 24 h (30.8 ± 1.9%), compared with controls.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

  		Fig. 1. Parathyroid hormone (PTH) inhibition of 22Na uptake in opossum kidney (OKP) cells. 22Na uptake was measured in confluent OKP cells treated with 10–7 M PTH or vehicle for 6, 16, and 24 h. Results represent the EIPA-sensitive component of 22Na uptake and are normalized for the amount of protein per well. Each assay was performed in triplicate, and the mean values of 4 assays were calculated. *P < 0.05 vs. control.

 

Figure 2
View larger version (18K):
[in this window]
[in a new window]

  		Fig. 2. Chronic downregulation of surface NHE3 protein expression by PTH in OKP cells. A: confluent OKP cells were treated with 10–7 M PTH or vehicle for 6, 16, and 24 h. Cell surface-biotinylated proteins were subjected to SDS-PAGE and immunoblotting. Western blot analyses were performed using a monoclonal antibody against opossum NHE3 (3H3). B: abundance of NHE3 surface expression was quantitated by densitometry (NIH Image Software), and the combined data from 3 experiments are represented as columns in a bar graph. *P < 0.05 vs. control.

 

Figure 3
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 3. Chronic downregulation of total NHE3 protein by PTH in OKP cells. A: confluent OKP cells were treated with 10–7 M PTH or vehicle for 6, 16, and 24 h. Fifty micrograms of total cellular lysates were subjected to SDS-PAGE and immunoblotting. Western blot analyses were performed using a monoclonal antibody against opossum NHE3 (3H3). Analyses of actin expression were used as an internal control. B: relative abundance of NHE3 antigen was quantitated by densitometry (NIH Image Software), and the combined data from 3 experiments are represented as columns in a bar graph. *P < 0.05 vs. control.

 
PTH effect on NHE3 mRNA level. We also evaluated the effect of PTH on NHE3 mRNA levels by real-time RT-PCR. As depicted in Fig. 4, the relative amount of NHE3 mRNA was significantly reduced (26 ± 2%) 24 h after addition of PTH, which is consistent with the decrease in NHE3 total protein levels. The NHE3 mRNA stability was also evaluated by using 5 µg/ml AcD to stop new transcriptions. Remnant levels of NHE3 mRNA were then measured 3, 6, 9, 12, and 24 h after AcD addition to the culture media. By means of run-off assays, we verified that inhibition of transcription was higher than 90% under our experimental conditions (data not shown). Figure 5A shows that PTH induced a small, but significant, decrease in NHE3 mRNA half-life from 11.53 ± 0.73 to 9.36 ± 0.42 h. The stability of the β-actin mRNA was unchanged in the presence of PTH (Fig. 5B).


Figure 4
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 4. Effect of PTH on NHE3 mRNA levels in OKP cells. Real-time quantitative RT-PCR for NHE3 mRNA and β-actin mRNA was performed by a 2-step method using SYBR-GREEN dye to label the double-strand cDNAs. The relative abundance of NHE3 mRNA to β-actin in the presence or absence of 10–7 M PTH was calculated. Combined data from 4 different experiments are represented as columns in a bar graph. Data are expressed as means ± SE. *P < 0.05 vs. control.

 

Figure 5
View larger version (8K):
[in this window]
[in a new window]

  		Fig. 5. Effect of PTH on NHE3 mRNA half-life OKP cells. OKP cells were treated for 3, 6, 9, 12, or 24 h with 5 µg of actinomycin in the presence or absence of 10–7 M PTH. NHE3 and β-actin mRNA levels were determined by quantitative real-time RT-PCR as described in MATERIALS AND METHODS. NHE3 (A) and β-actin mRNA (B) half-lives were calculated by using one phase exponential decay equation ("Graph Pad Prism 4," Graph Pad Software, San Diego, CA).

 
NHE3 promoter activity in OKP cells. To further investigate the transcriptional step, we analyzed the effect of PTH on NHE3 promoter activity. Rat NHE3 promoter has been previously employed in studies performed in OKP cells (3, 16). The 5'- flanking sequence (5'FS) of NHE3 rat gene was PCR amplified in our laboratory and inserted into the pGL3-basic Firefly luciferase reporter system. We noted that the regulatory region of the rat NHE3 gene extending from –2,095 to +55 induces an expression of Firefly luciferase that was five times higher than the basal expression. We analyzed different segments of the regulatory region and we observed that the segment –152 to +55 was the most active among them, with an activity 150- to 200-fold higher than pGL3-basic. This fragment was then used to investigate the effect of PTH on the NHE3 promoter activity. We observed a significant decrease in the –152/+55 promoter activity 24 h after exposure with PTH (Fig. 6). The effect of PTH on the –152/+55 promoter fragment activity was also evaluated in the presence of the PKA inhibitor KT 5720, which was added to the media 1 h before PTH. As shown in Fig. 6, the presence of the PKA inhibitor completely abolished the inhibitory effect of PTH on the NHE3 promoter.


Figure 6
View larger version (9K):
[in this window]
[in a new window]

  		Fig. 6. Effect of PTH on the NHE3 promoter activity in OKP cells. Firefly luciferase reporter constructs containing the NHE3 promoter segment –152/+55 were generated and cotransfected into OKP cells along with the pRL-CMV plasmid, which provides constitutive expression of Renilla luciferase. Cells were harvested after 24 h of treatment with 10–7 M PTH or vehicle, either in the presence or absence of the PKA inhibitor KT 5720 (10–8 M), and Firefly and Renilla luciferase activity was measured. Data represent means ± SE for n = 8. *P < 0.05 vs. control.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Clinical conditions associated with persistent elevated plasma concentration of PTH or PTH-related peptides (PTHrP) are relatively frequent. They include not only primary hyperparathyroidism but also hyperparathyroidism secondary to chronic hypocalcemia in end-stage renal disease, as well as excess of PTHrP in malignancies. Long-term effect of PTH might result in lower plasticity of NHE3 expression in response to excess of acids and disturbances of the extracellular volume or blood pressure. Hence, further elucidation of the mechanisms underlying the chronic effect of PTH on NHE3 transport activity may be of both scientific and clinical interest.

We previously documented the chronic inhibitory effect of PTH on Na+-dependent H+ secretion at the apical membrane of renal proximal tubules by means of in vivo microperfusion and 22Na uptake experiments. These studies, performed in rats treated with supraphysiological doses of PTH for 8 days, also showed that long-term PTH modulation of sodium bicarbonate reabsorption at renal proximal tubules is correlated with significant changes in the amount of NHE3 protein and NHE3-specific message (12).

In the present study, we elucidated the mechanisms underlying the chronic effects of PTH on NHE3 expression in OKP cells. Consistent with our previous in vivo studies, we verified that PTH induces a persistent inhibition of NHE3 activity. By examining the time course of the PTH effect on NHE3 surface expression, and its relationship with inhibition of NHE3 activity, we found that there exists a reasonable agreement between inhibition of OKP-Na+/H+ exchange and the availability of the transporter at the apical membrane surface at 6, 16, and 24 h.

The decrement in NHE3 activity in response to chronic exposure to PTH was also accompanied by changes in NHE3 expression. However, reduction of transport activity preceded the reduction in both total NHE3 protein and NHE3 mRNA, which was observed 16 and 24 h after the cell exposure to PTH, respectively. The reduction in NHE3 mRNA at 24 h was closely related to the observed level of NHE3 protein.

To evaluate whether the lower level of NHE3 mRNA was due to lower stability of the transcript, we evaluated the influence of PTH on the half-life of the NHE3 message. We found that NHE3 mRNA half-life was slightly (from 11.5 to 9.4 h), but significantly, reduced in the presence of PTH. This lower mRNA half-life might be one of the determinants of the reduced NHE3 message observed 24 h after addition of PTH.

By measuring the rat NHE3 promoter activity in OKP cells, we detected a significant decrease in its activity 24 h after addition of PTH, when we analyzed the promoter segment –152/+55. This fragment contains three putative binding sites for early growth response 1. In addition, it also presents putative sites for Sp1, AP2, and NF-Y, which seem to be essential for NHE3 gene transcription (24). The high level of similarity between the human and rat sequences at this region suggests that this fragment may also be conserved in the opossum. If this is true, the results obtained with the –152/+55 promoter would be even more relevant, since the interacting cis elements responsible for the observed effect in our experiments are encoded in the opossum genome. Experiments aiming to define the 5'FS sequence of opossum NHE3 gene are currently being performed at our laboratory.

Binding of PTH or PTHrp to PTH1R results in a very complex signaling pathway activation that includes not only activation of adenylyl cyclase and phospholipase C (PLC) beta (23), but also activation of PLA2 (9), increase in intracellular calcium, activation of PI3 kinase, and mitogen-activated protein kinases ERK1/2 (10, 18). The NHE3 promoter response to PTH was analyzed in the presence of either PKA (KT 5720) or PKC (GF109203X) inhibitor. The PKA inhibitor, added to the OKP cells 1 h before incubation with PTH, abolished the mild inhibitory effect of this hormone on the promoter. This observation suggests that the PTH effect on the NHE3 promoter is PKA dependent, as observed on the promoters of genes such as 1-{alpha} hydroxylase (8) and osteoprotegerin (13). PKC inhibitors induced a strong inhibition of the promoter (not shown), which was observed even in the absence of PTH and was not modified by the hormone.

In summary, our results indicate that PTH induces a chronic inhibition of NHE3 activity in cells of renal proximal tubules. Sustained PTH treatment also decreases the amount of surface and total NHE3 protein expression. The amount of NHE3 message is reduced at 24 h, and it is due to lower mRNA half-life and inhibition of transcription. This mechanism may be relevant to volume and acid-base homeostasis during conditions associated with increases in circulating PTH or PTHrP.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP) Grant 2004/01683-5 and Conselho Nacional de Desenvolvimento Científico e Tecnológico. A. C. C. Girardi and L. R. Carraro-Lacroix were supported by fellowship awards from FAPESP.


   ACKNOWLEDGMENTS
 
We thank Dr. G. Malnic for the careful revision of the manuscript.


   FOOTNOTES
 

Address for reprint requests and other correspondence: N. Amaral Rebouças, Departamento de Fisiologia e Biofísica, Instituto de Ciências Biomédicas, Universidade de São Paulo, Avenida Professor Lineu Prestes, 1524, 05508-000 São Paulo, SP, Brazil (e-mail: nancy{at}icb.usp.br)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Arruda JA, Nascimento L, Westenfelder C, Kurtzman NA. Effect of parathyroid hormone on urinary acidification. Am J Physiol Renal Fluid Electrolyte Physiol 232: F429–F433, 1977.[Abstract/Free Full Text]
  2. Bank N, Aynedjian HS. A micropuncture study of the effect of parathyroid hormone on renal bicarbonate reabsorption. J Clin Invest 58: 336–344, 1976.[Web of Science][Medline]
  3. Cano A. Characterization of the rat NHE3 promoter. Am J Physiol Renal Fluid Electrolyte Physiol 271: F629–F636, 1996.[Abstract/Free Full Text]
  4. Choi JY, Shah M, Lee MG, Schultheis PJ, Shull GE, Muallem S, Baum M. Novel amiloride-sensitive sodium-dependent proton secretion in the mouse proximal convoluted tubule. J Clin Invest 105: 1141–1146, 2000.[Web of Science][Medline]
  5. Cole JA, Forte LR, Krause WJ, Thorne PK. Clonal sublines that are morphologically and functionally distinct from parental OK cells. Am J Physiol Renal Fluid Electrolyte Physiol 256: F672–F679, 1989.[Abstract/Free Full Text]
  6. Collazo R, Fan L, Hu MC, Zhao H, Wiederkehr MR, Moe OW. Acute regulation of Na+/H+ exchanger NHE3 by parathyroid hormone via NHE3 phosphorylation and dynamin-dependent endocytosis. J Biol Chem 275: 31601–31608, 2000.[Abstract/Free Full Text]
  7. Ellsworth R, Nicholson WM. Further observations upon the changes in the electrolytes of the urine following the injection of parathyroid extract. J Clin Invest 14: 823–827, 1935.[CrossRef][Web of Science][Medline]
  8. Gao XH, Dwivedi PP, Choe S, Alba F, Morris HA, Omdahl JL, Ma BK. Basal and parathyroid hormone induced expression of the human 25-hydroxyvitamin D 1{alpha}-hydroxylase gene promoter in kidney AOK-B50 cells: role of Sp1, Ets and CCAAT box protein binding sites. Int J Biochem Cell Biol 34: 921–930, 2002.[CrossRef][Web of Science][Medline]
  9. Gentili C, Morelli S, De Boland AR. 1{alpha},25(OH)2D3 and parathyroid hormone (PTH) signaling in rat intestinal cells: activation of cytosolic PLA2. J Steroid Biochem Mol Biol 89–90(1–5): 297–301, 2004.
  10. Gentili C, Morelli S, Russo De Boland A. Involvement of PI3-kinase and its association with c-Src in PTH-stimulated rat enterocytes. J Cell Biochem 86: 773–783, 2002.[CrossRef][Web of Science][Medline]
  11. Girardi AC, Knauf F, Demuth HU, Aronson PS. Role of dipeptidyl peptidase IV in regulating activity of Na+/H+ exchanger isoform NHE3 in proximal tubule cells. Am J Physiol Cell Physiol 287: C1238–C1245, 2004.[Abstract/Free Full Text]
  12. Girardi ACC, Titan SMO, Malnic G, Rebouças NA. Chronic effect of parathyroid hormone on NHE3 expression in rat renal proximal tubules. Kidney Int 58: 1623–1631, 2000.[CrossRef][Web of Science][Medline]
  13. Halladay DL, Miles RR, Thirunavukkarasu K, Chandraekhar S, Martin TJ, Onyia JE. Identification of signal transduction pathways and promoter sequences that mediate parathyroid hormone 1-38 inhibition of osteoprotegerin gene expression. J Cell Biochem 84: 1–11, 2002.[CrossRef]
  14. Hellman DE, Au WY, Bartter FC. Evidence for a direct effect of parathyroid hormone on urinary acidification. Am J Physiol 209: 643–650, 1965.[Abstract/Free Full Text]
  15. Iino Y, Burg MB. Effect of parathyroid hormone on bicarbonate absorption by proximal tubules in vitro. Am J Physiol Renal Fluid Electrolyte Physiol 236: F387–F391, 1979.[Abstract/Free Full Text]
  16. Kandasamy RA, Orlowski J. Genomic organization and glucocorticoid transcriptional activation of the rat Na+/H+ exchanger Nhe3 gene. J Biol Chem 271: 10551–10559, 1996.[Abstract/Free Full Text]
  17. Karlinsky ML, Sager DS, Kurtzman NA, Dillay VKG. Effect of parathormone and cyclic adenosine monophosphate on renal bicarbonate reabsorption. Am J Physiol 227: 1226–1231, 1974.[Free Full Text]
  18. Kawane T, Mimura J, Yanagawa T, Fujii-Kuriyama Y, Horiuchi N. Parathyroid hormone (PTH) downregulates PTH/PTH-related protein receptor gene expression in UMR-106 osteoblast-like cells via a 3',5'-cyclic adenosine monophosphate-dependent, protein kinase A-independent pathway. J Endocrinol 178: 247–256, 2003.[Abstract]
  19. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nat Biotechnol 227: 680–685, 1970.[CrossRef]
  20. Leong PK, Yang LE, Lin HW, Holstein-Rathlou NH, McDonough AA. Acute hypotension induced by aortic clamp vs. PTH provokes distinct proximal tubule Na+ transporter redistribution patterns. Am J Physiol Regul Integr Comp Physiol 287: R878–R885, 2004.[Abstract/Free Full Text]
  21. Lorenz JN, Schultheis PJ, Traynor T, Shull GE, Schnermann J. Micropuncture analysis of single-nephron function in NHE3-deficient mice. Am J Physiol Renal Physiol 277: F447–F453, 1999.[Abstract/Free Full Text]
  22. Mahon MJ, Donowitz M, Yun CC, Segre GV. Na+/H+ exchanger regulatory factor 2 directs parathyroid hormone 1 receptor signalling. Nature 417: 858–861, 2002.[CrossRef][Medline]
  23. Mahon MJ, Segre GV. Stimulation by parathyroid hormone of a NHERF-1-assembled complex consisting of the parathyroid hormone I receptor, phospholipase Cbeta, and actin increases intracellular calcium in opossum kidney cells. J Biol Chem 279: 23550–23558, 2004.[Abstract/Free Full Text]
  24. Malakooti J, Sandoval R, Amin MR, Clark J, Dudeja PK, Ramaswamy K. Transcriptional stimulation of the human NHE3 promoter activity by PMA: PKC independence and involvement of the transcription factor EGR-1. Biochem J 396: 327–336, 2006.[CrossRef][Web of Science][Medline]
  25. Mrkic B, Forgo J, Murer H, Helmle-Kolb C. Apical and basolateral Na/H exchange in cultured murine proximal tubule cells (MCT): effect of parathyroid hormone (PTH). J Membr Biol 130: 205–217, 1992.[Web of Science][Medline]
  26. Mrkic B, Tse CM, Forgo J, Helmle-Kolb C, Donowitz M, Murer H. Identification of PTH-responsive Na/H-exchanger isoforms in a rabbit proximal tubule cell line (RKPC-2). Pflügers Arch 424: 377–384, 1993.[CrossRef][Web of Science][Medline]
  27. Pollock AS, Warnock DG, Strewler GJ. Parathyroid hormone inhibition of Na+/H+ antiporter activity in a cultured renal cell line. Am J Physiol Renal Fluid Electrolyte Physiol 250: F217–F225, 1986.[Abstract/Free Full Text]
  28. Rodman JS, Heinemann HO. Parathyroid hormone and the regulation of acid-base balance. Am J Med Sci 270: 481–489, 1975.[CrossRef][Web of Science][Medline]
  29. Vallon V, Schwark JR, Richter K, Hropot M. Role of Na+/H+ exchanger NHE3 in nephron function: micropuncture studies with S3226, an inhibitor of NHE3. Am J Physiol Renal Physiol 278: F375–F379, 2000.[Abstract/Free Full Text]
  30. Wang B, Bisello A, Yang Y, Romero GG, Friedman PA. NHERF1 regulates parathyroid hormone receptor membrane retention without affecting recycling. J Biol Chem 282: 36214–36222, 2007.[Abstract/Free Full Text]
  31. Wang T, Hropot M, Aronson PS, Giebisch G. Role of NHE isoforms in mediating bicarbonate reabsorption along the nephron. Am J Physiol Renal Physiol 281: F1117–F1122, 2001.[Abstract/Free Full Text]
  32. Wang T, Yang CL, Abbiati T, Schultheis PJ, Shull GE, Giebisch G, Aronson PS. Mechanism of proximal tubule bicarbonate absorption in NHE3 null mice. Am J Physiol Renal Physiol 277: F298–F302, 1999.[Abstract/Free Full Text]
  33. Wu MS, Biemesderfer D, Giebisch G, Aronson PS. Role of NHE3 in mediating renal brush border Na+-H+ exchange. Adaptation to metabolic acidosis. J Biol Chem 271: 32749–32752, 1996.[Abstract/Free Full Text]
  34. Yang LE, Maunsbach AB, Leong PK, McDonough AA. Differential traffic of proximal tubule Na+ transporters during hypertension or PTH: NHE3 to base of microvilli vs. NaPi2 to endosomes. Am J Physiol Renal Physiol 287: F896–F906, 2004.[Abstract/Free Full Text]
  35. Zhang Y, Norian JM, Magyar CE, Holstein-Rathlou NH, Mircheff AK, McDonough AA. In vivo PTH provokes apical NHE3 and NaPi2 redistribution and Na-K-ATPase inhibition. Am J Physiol Renal Physiol 276: F711–F719, 1999.[Abstract/Free Full Text]
  36. Zhao H, Wiederkehr MR, Fan L, Collazo RL, Crowder LA, Moe OW. Acute inhibition of Na/H exchanger NHE-3 by cAMP. Role of protein kinase a and NHE-3 phosphoserines 552 and 605. J Biol Chem 274: 3978–3987, 1999.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/5/F1232    most recent
00025.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bezerra, C. N. A.
Right arrow Articles by Rebouças, N. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bezerra, C. N. A.
Right arrow Articles by Rebouças, N. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.