AJP - Renal Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Renal Physiol 294: F1465-F1472, 2008. First published March 26, 2008; doi:10.1152/ajprenal.00012.2008
0363-6127/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/6/F1465    most recent
00012.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foutz, R. M.
Right arrow Articles by Sansom, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foutz, R. M.
Right arrow Articles by Sansom, S. C.

Insulin increases the activity of mesangial BK channels through MAPK signaling

Ruth M. Foutz, P. Richard Grimm, and Steven C. Sansom

Department of Cellular and Integrative Physiology, University of Nebraska Medical Center, Omaha, Nebraska

Submitted 9 January 2008 ; accepted in final form 19 March 2008


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Glomerular hyperfiltration and mesangial expansion have been described in mouse models of a hyperinsulinemic early stage of type 2 diabetes mellitus (DM). Large-conductance Ca2+-activated K+ channels (BK) have been linked to relaxation of human mesangial cells (MC) and may contribute to MC expansion and hyperfiltration. We hypothesized that high insulin levels increase BK activity in MC by increasing the number and/or open probability (Po) of BK in the plasma membrane. With the use of the patch-clamp technique, BK activity was analyzed in cultured MC exposed to normal insulin (1 nM) and high insulin (100 nM) for a 48-h period. The mean Po and the percentage of patches (cell attached) with detected BK increased by 100% in the insulin-treated cells. Real-time PCR revealed that insulin increased mRNA of BK-{alpha}. Western blot revealed an insulin-stimulated increase in BK-{alpha} from both total cellular and plasma membrane protein fractions. The mitogen-activated protein kinase (MAPK) inhibitors PD-098059 and U-0126 attenuated the insulin-induced increase in BK-{alpha} expression. PD-098059 inhibited insulin-stimulated phosphorylation of extracellular signal-regulated kinase 1/2 in MC. An insulin-stimulated increase also was found for total cellular BK-β1, the accessory subunit of BK in MC. A similar increase in BK-{alpha} mRNA and protein was evoked by an insulin-like growth factor I analog. Glomeruli, isolated from hyperinsulinemic early stage type 2 DM mice, exhibited increased BK-{alpha} mRNA by real-time PCR and protein by immunohistochemical staining and Western blot. These results indicate that insulin activates BK in the plasma membrane of MC and stimulates, via MAPK, an increase in cellular and plasma membrane BK-{alpha}.

insulin-like growth factor I; insulin-like growth factor I receptor; maxi k; potassium channel; β-subunit; mouse; high-fat diet


GLOMERULAR MESANGIAL CELLS (MC) are specialized, contractile pericytes that support the glomerular capillaries and undergo extensive morphological changes in glomerular diseases such as diabetic nephropathy (16, 43). MC exhibit a contraction-relaxation phenotype that is similar to vascular smooth muscle cells (VSMC) (1, 23, 43). An agonist-initiated contraction results from releasing Ca2+ stored within the endoplasmic reticulum. The released Ca2+ activates Cl channels, which depolarize the cellular membrane potential and activate voltage-operated Ca2+ channels (VOCC) (30, 43). The increase in intracellular Ca2+ concentration, along with depolarization of the cell membrane potential, activates large-conductance Ca2+-activated K+ channels (BK). The activation of BK hyperpolarizes the cell membrane potential, thereby shutting off VOCC and completing a negative feedback loop (43).

BK are abundantly expressed in MC where they contribute to the relaxation of the cell and, consequently, an elevated glomerular filtration rate (14, 43). In MC, BK are composed of pore-forming {alpha}- and accessory β1-subunits (24). The β1-subunits increase Ca2+ and voltage sensitivity of BK (7, 29).

Previously, we described hyperfiltration and mesangial expansion in a high-fat diet mouse model of early stage type 2 diabetes mellitus (DM) (45). Although mildly hyperglycemic, the DM mice exhibited profound hyperinsulinemia. Considering the functional role that BK have in MC, we hypothesized that high plasma insulin levels increase the activity of BK by either increasing their open probability (Po) or protein expression in the plasma membrane. The increased activity of BK could account for the relaxation of MC, providing a possible mechanism for the hyperfiltration in the type 2 DM model.

MC possess both insulin receptors (IR) and insulin-like growth factor I receptors (IGF-IR) (13). Both are tyrosine kinase receptors that share amino acid sequence homology and mutual intracellular signaling pathways (2). The amount of IR in MC is low compared with IGF-IR (13); however, elevated levels of insulin are sufficient to activate IGF-IR (2, 4) and stimulate mesangial proliferation (22). Insulin-like growth factor I (IGF-I) is elevated in glomeruli of type 2 DM models, and infusion of IGF-I increases glomerular filtration rate in rats (19).

Activating BK may also be partly responsible for the mesangial expansion noted in the hyperinsulinemic stage of type 2 DM (11, 45). Activation of BK hyperpolarizes the membrane potential and results in an enhanced driving force for Ca2+ cell entry. Activation of BK increases proliferation of breast cancer cells in vitro (12). Moreover, Ca2+ channel blockers inhibit MC proliferation (36).

A recent study described activation of BK in hippocampal cells via the mitogen-activated protein kinase (MAPK) pathway (31), which is stimulated via IGF-IR in many types of cells (39). We therefore explored whether insulin evoked an increase in mesangial BK activity, possibly by stimulating the MAPK pathway.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture. Human MC (Cambrex, East Rutherford, NJ), passages 6–11, were grown in 5 mM glucose DMEM (Sigma, St. Louis, MO) supplemented with 10 mM HEPES, 2.0 mM glutamine, 1.0 mM sodium pyruvate, 0.1 mM nonessential amino acids, 100 U/ml penicillin, 100 µg/ml streptomycin, and 20% FBS. In a blind study, human MC were either further supplemented with 100 nM human insulin (Sigma) or 5 nM IGF-I analog (Novozymes Gropep) in 2% FBS, to mimic hyperinsulinemia, or incubated with standard 1 nM insulin DMEM with 20% FBS over a 48-h period. In separate experiments, cells were preincubated with MAPK inhibitors, 10 µM PD-098059 (Sigma) or 1 µM U-0126 (Sigma), for 2 h and then treated with insulin. Cells were cultured on 22 x 22 mm glass cover slips (Fisher, Pittsburgh, PA) for patch-clamp experiments and in 75-cm2 flasks (90–95% confluencey) for protein and RNA isolation.

Patch-clamp experiments. Single-channel patch-clamp experiments were performed at 23°C as previously described (18). Experiments began in the cell-attached configuration. Seals maintained throughout the experiment were eventually excised to the inside-out configuration to confirm the number of BK in the patch. The pipette solution was (in mM): 140 KCl, 1.0 CaCl2, 2.0 MgCl2, 1.4 EGTA, and 10 HEPES (pH 7.4). The bath solution contained standard physiological saline solution [(in mM) 135 NaCl, 5 KCl, 2 MgCl2, 1 CaCl2, and 10 HEPES, pH 7.4].

Pipettes were manufactured to a 3-mm taper and a 1-µm tip diameter using a model P-97 horizontal pipette puller (Sutter Instrument, Novato, CA). The patch pipette, filled with solution and in contact with a Ag-AgCl wire, was connected to a model CV 203BU head stage attached to an Axopatch 200B amplifier (Molecular Devices, Sunnyvale, CA). The cells, grown on cover slips, were mounted on an imaging platform and visualized with an Olympus (OMT2) inverted microscope. The pipette was lowered on the cell membrane. Once contact was established, suction was applied to form a high-resistance (>5 G{Omega}) seal. Multiple current tracings were recorded at 20-mV increments to establish BK identification, activity, and single-channel conductance.

Single-channel events were acquired with pCLAMP 10.0 software (Molecular Devices) and analyzed using Clampfit software (Molecular Devices). The Po, percentage of time a channel remains in the open state divided by the total time of the analyzed record, was calculated for each BK observed in a patch. The channel activity was initially calculated as NPo = EnPn, where Pn is the probability of finding n channels open. The N was determined by observing the maximum number of current levels in the patch after excision in the bathing solution containing 1 mM Ca2+. Therefore, the Po was determined by dividing the NPo by N. Only seals containing distinguishable BK that could be identified by a current-voltage (I-V) plot were evaluated.

Protein isolation and Western blotting. Standard cellular protein isolation and Western blot procedure was performed. The isolated protein concentration was determined with a standard curve using Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA). To isolate membrane protein, a 1-h centrifugation at 100,000 g was performed as previously described (40). The supernatant (cytosolic protein) was collected, and the pellet was resuspended in RIPA buffer, briefly sonicated, and centrifuged. The supernatant (membrane protein) was collected and analyzed. PhosphoSafe Extraction Buffer (Novagen, Gibbstown, NJ) was used to isolate protein from human MC to detect phosphorylated proteins. All isolated protein was stored at –80°C until analyzed.

Western blotting was performed as previously described (42). The primary antibodies included anti-BK-{alpha} (rabbit; APC-107 and APC-021; Alamone), anti-BK-β1 (goat; Santa Cruz Biotechnology, Santa Cruz, CA), anti-β-actin (rabbit; Santa Cruz), anti-caveolin-1 (rabbit; Affinity Bioreagents, Golden, CO), anti-phosphorylated extracellular signal-regulated kinase (ERK) 1/2 (rabbit; no. 9101; Cell Signaling Technology, Danvers, MA), or ERK1/2 (rabbit; no. 9102; Cell Signaling Technology) diluted 1:1,000 in Tris-buffered saline supplemented with 0.05% Tween 20 (TBST) and 3% BSA. The following day the blot was washed and incubated with a horseradish peroxidase (HRP) conjugated secondary antibody diluted 1:5,000 in TBST and 1% BSA. The blot was washed and the HRP labeling was developed with SuperSignal West Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL). The blots were analyzed using UVP Imager and Labworks software.

RNA isolation and real-time PCR. RNA was isolated from human MC with TRI REAGENT (Molecular Research Center, Cincinnati, OH) per the manufacturer's protocol. The isolated RNA was reverse-transcribed with Superscript III (Invitrogen, Carlsbad, CA) and oligo(dT) primers using the manufacturer's protocol. All real-time PCR experiments were performed with iQ SYBR Green Supermix (Bio-Rad). Each reaction mix consisted of 12.5 µl iQ SYBR Green Supermix, 1 µl of 10 mM sense primer, 1 µl of 10 mM anti-sense primer, 0.5 µg of cDNA template, and water for a total volume of 25 µl. The nucleotide sequence for BK-{alpha} is sense AAGGGCTGTCAACATCAACC, antisense GATGTTGAGTGACGCCAAGA; for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), sense AACAGCCTCAAGATCATCAGC, antisense GGATGATGTCCTGGAGAGCC. All reaction volumes were adjusted to run each sample in triplicate. The relative expression of BK-{alpha} in control and insulin-treated cells was determined using the equation of Pfaffl et al. (33).

In vivo experiments. Male C57Bl/6 mice (Jackson Laboratory, Bar Harbor, ME) were supported in the animal facility of the University of Nebraska Medical Center. All experiments were performed under conditions reviewed and approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Center.

Animals (9 wk old) were placed on a normal diet (7012; Harlan Teklad) or high-fat diet (45% kcal fat-irradiated; Research Diet, New Brunswick, NJ), given water ad libitum, and exposed to a 12:12-h day-night rhythm for a period of 13 wk. The animals were weighed each week. At the end of the 13-wk period, the animals were injected with anesthetic (Inactin; Sigma), a blood sample was taken from the saphenous vein, and a urine sample was collected. The blood sample was spun [12,000 revolutions/min (rpm), 10 min, 4°C] to separate plasma from the red blood cells, and the plasma was transferred to a clean Eppendorf tube. All samples were stored at –80°C for later analysis.

Glomeruli were isolated from the left kidney as previously described (9). After a 1-h centrifugation at 8,000 rpm at 4°C, the supernatant was aspirated, and the glomeruli (pellet at the bottom) were resuspended in protease-inhibiting RIPA buffer. To isolate glomerular protein, the glomerular tissue was sonicated and centrifuged at 12,500 rpm. The supernatant (glomerular protein) was collected and stored at –80°C until further analysis.

RNA was isolated from the cortical tissue via TRI REAGENT, reverse transcribed, and analyzed by real-time PCR (described above). The mouse nucleotide sequences used for the real-time PCR experiments were BK-{alpha} sense GACGTTCTGAGCGTGACTG and antisense TGGTGGAGCAATCATTAACAGAG and GAPDH sense AGGTCGGTGTGAACGGATTTG and antisense TGTAGACCATGTAGTTGAGGTCA.

Plasma insulin concentration was determined using an Ultra Sensitive Rat Insulin ELISA kit (Crystal Chem, Downers Grove, IL). The manufacturer's protocol was precisely followed. Each unknown sample was determined using the standard curve.

Statistical analysis. Expression of BK-{alpha} and BK-β1 proteins was quantified by densitometry measured from the Western blots using Labworks software. The mean value for both proteins was normalized by dividing each by the mean densitometry values of β-actin for total cell protein or caveolin-1 for membrane protein. Phosphorylated-ERK1/2 expression was similarly normalized to ERK1/2. The mean and SE of multiple samples were calculated and compared with the control values using a two-tailed t-test (SigmaStat 3.0). Differences were considered statistically significant at values with P < 0.05.

The mean Po values at pipette potentials that showed clear channel activity in control cells were compared with those treated with insulin using a Mann-Whitney Rank Sum Test (SigmaStat 3.0). The appearance of BK openings was inconsistent at different potentials. Therefore, the total number of tracings (n) analyzed at each potential varied. Statistical analysis was performed on at least n = 6. Differences were considered statistically significant at values with P < 0.05. Comparisons plotted on vertical bar graphs represent means ± SE (SigmaPlot 2001).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Effects of insulin by single channel analysis. Figure 1 shows the results of insulin application on BK in cell-attached patches of cultured human MC. BK were identified by the magnitude of the currents and the increased NPo on depolarizing holding potentials. The Po could be determined by counting the current levels in a patch after excision in 1 mM Ca2+ solution and varying the holding potential. As shown by the representative tracings (Fig. 1A), the application of insulin increased the BK activity at a holding potential of –40 mV. Although this same relative increase in Po was observed at all holding potentials, most data for comparison were accumulated at –Vp = –40 mV, Vp is pipette potential. The bar plots of Fig. 1, B and C, illustrate that insulin treatment increased the Po and the overall percentage of seals (>5 G{Omega}) that contained BK, respectively. As shown by the I-V relations for BK in Fig. 1D, the extrapolated reversal potential for BK shifted to the right in the insulin-treated cells, indicating that membrane potential hyperpolarized with insulin treatment. A hyperpolarizing membrane potential is consistent with a global increase in BK activity in the plasma membrane. The slopes of the I-V relations for BK in insulin-treated and control cells were 140 and 159 pS, respectively.


Figure 1
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 1. Effects of insulin on large-conductance Ca2+-activated K+ channels (BK) in cell-attached patches of cultured human mesangial cells (MC). A: representative tracings of BK in cell-attached patches (–Vp = –40 mV) from control (top) and insulin-treated (bottom) human MC. B: bar plot illustrating the summary of open probabilities (Po) for BK in control (n = 7) and insulin-treated (n = 7) cells. C: bar plot illustrating the percentage of cell-attached patches with detectable BK in control and insulin-treated cells. *Significance at P < 0.05 using t-test for unpaired data. D: current-voltage (I-V) relations for BK detected in cell-attached patches from control and insulin-treated cells (n = 4–7). The slope and reversal potential for BK in control cells was 159 pS and 32.0 mV, respectively. The slope and reversal potential for BK in insulin-treated cells was 140 pS and 47.0 mV, respectively.

 
Effects of insulin on BK RNA and protein expression. Real-time PCR was used to determine whether BK-{alpha} transcript was increased with insulin treatment. As shown in Fig. 2, the mRNA for BK-{alpha} increased by more than fivefold in the cells treated with insulin.


Figure 2
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 2. Real-time PCR determination of relative mRNA for BK-{alpha} in control (n = 3) and insulin-treated (n = 3) human MC. *Significance at P < 0.05 using t-test for unpaired data.

 
As shown in Fig. 3A with representative immunoblots and the bar plots summarizing the densitometry of the protein, the relative expression of total cellular BK-{alpha} increased substantially in the insulin-treated cells. The membrane fraction (Fig. 3B) exhibited an insulin-evoked increase of ~35% in BK-{alpha} expression. The ratio of the membrane to cytosolic fraction with insulin treatment was 0.26 ± 0.02, a value that was not significantly different from control, which was 0.23 ± 0.02.


Figure 3
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 3. Representative experiments with summary bar plots of immunoblot determinations of effects of insulin on BK-{alpha} protein in total cellular (A; n = 3) and membrane (B; n = 3) fractions. *Significance at P < 0.05 using t-test for unpaired data.

 
It was demonstrated previously by RT-PCR and Western blot in this laboratory that human MC in culture express BK-β1-subunits (24). As shown by the immunoblots and the summary bar plot of Fig. 4, the relative expression of BK-β1 increased in the insulin-treated cells. Thus the relative expression of both BK-{alpha} and BK-β1 was increased by approximately fourfold.


Figure 4
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 4. Representative immunoblots (A) and summary bar plots (B) illustrating the relative quantity of total cellular BK-β1 protein expressed in control (n = 3) and insulin-treated (n = 3) cells. *Significance at P < 0.05 using t-test for unpaired data.

 
Role of MAPK signaling. We used the MAPK inhibitors PD-098059 and U-0126 to determine the effects of MAPK signaling on the insulin-stimulated increase in BK-{alpha}. As shown in Fig. 5A, neither PD-098059 nor U-0126 affected the basal levels of BK-{alpha} expressed in total cellular protein. However, when cells were insulin treated, the insulin-induced increase in BK-{alpha} expression was significantly attenuated by both PD-098059 and U-0126 (Fig. 5B). Figure 6 compares the basal and insulin-stimulated effects of MAPK inhibitors on BK-{alpha} expression in the membrane fraction. Neither PD-098059 nor U-0126 affected the basal levels of BK-{alpha} expression in the membrane fraction (Fig. 6A). However, both MAPK-inhibiting agents attenuated the insulin-induced increase in BK-{alpha} expression in the membrane fraction (Fig. 6B).


Figure 5
View larger version (22K):
[in this window]
[in a new window]

 
Fig. 5. Effects of mitogen-activated protein kinase (MAPK) inhibitors PD-098059 and U-0126 on the basal (A; n = 3) and insulin-induced (B; n = 3) expression of BK-{alpha} in the total cellular fraction. *Significance at P < 0.05 using t-test for unpaired data.

 

Figure 6
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 6. Effects of MAPK inhibitors PD-098059 and U-0126 on the basal (A; n = 3) and insulin-induced (B; n = 3) expression of BK-{alpha} in the membrane fraction.

 
The Western blot of Fig. 7 shows the effects of insulin and insulin with PD-098059 on the phosphorylation of ERK1/2 in human MC. As shown by the summary bar plots of the relative densitometry values, insulin evoked an 82% increase in ERK1/2 phosphorylation. PD-098059 significantly reduced phosphorylated (p)-ERK1/2 to a relative value below control and insulin-treated levels. The quantity of p-ERK1/2 expression was normalized to unphosphorylated ERK1/2, which did not change with insulin treatment. It is concluded that the insulin-induced increase in BK-{alpha} expression is at least partially due to activating the MAPK pathway.


Figure 7
View larger version (24K):
[in this window]
[in a new window]

 
Fig. 7. Western blots (A) and summary bar plots (B) showing the effects of insulin and insulin with PD-098059 on expression of phosphorylated (p) extracellular signal-regulated kinase (ERK) 1/2 normalized to ERK1/2. P < 0.05 compared with control (*) and compared with control and insulin treatment (**) (ANOVA plus Holm-Sidak test).

 
Effects of IGF-I. We determined whether IGF-I also increased BK-{alpha} mRNA and protein expression. The dissociation constant for IGF-I binding to IGF-IR on MC is between 2 and 3.2 nM (2). Figure 8 shows that 5 nM of IGF-I analog increased significantly both BK-{alpha} mRNA (Fig. 8A) and protein (Fig. 8B) expression in human MC.


Figure 8
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 8. A: effects of insulin-like growth factor I (IGF-I) analog on mesangial BK-{alpha} mRNA expression (n = 3). B: immunoblots with summary bar plots illustrating the effects of IGF-I analog on BK-{alpha} protein expression (n = 4).

 
Expression of BK-{alpha} in an in vivo hyperinsulinemic model. Previously, we showed that C57Bl/6 mice fed a high-fat diet exhibited profound obesity and hyperinsulinemia (46). We used this model to determine whether glomeruli from the hyperinsulinemic mice exhibit increased BK-{alpha} expression. After providing mice a high-fat diet for 13 wk, the plasma insulin concentration increased significantly (P < 0.05) from 0.53 ± 0.26 (n = 4) to 4.4 ± 2.1 (n = 5) ng/100 ml. As shown by the immunohistochemical stainings of Fig. 9A, BK-{alpha} was expressed with greater intensity in glomerular cells of kidneys harvested from the obese mice. Although positive identification of the glomerular cell types was not made, it appeared as though both podocytes and MC exhibited increased staining of BK-{alpha}. Figure 9B, a bar plot summary of real-time PCR experiments, reveals a significant increase in BK-{alpha} mRNA in the glomeruli from mice on a high-fat diet. As shown by the representative Western blot and summary of the densitometry measurements (Fig. 9C), BK-{alpha} was expressed in a significantly greater quantity in the glomeruli from the mice fed the high-fat diet.


Figure 9
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 9. A: immunohistochemical staining revealed increased BK-{alpha} expression in the glomeruli of mice fed a high-fat diet (right) compared with control animals (left). B: summary bar plots reveal an increase in BK-{alpha} mRNA. C: representative Western blot with summary bar plots show an increase in BK-{alpha} protein in the mice fed a high-fat diet.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The results of this study showed that insulin, via stimulation of the MAPK pathway, increased the activity of BK in the plasma membrane of human MC. The abundance of BK in the plasma membrane was elevated due to increased protein synthesis of BK-{alpha} and BK-β1. Stimulation of BK by insulin hyperpolarizes the plasma membrane and could partially explain the hyperfiltration and mesangial expansion in the early stages of type 2 DM (6, 8, 10, 45).

Consequences of an insulin-evoked increase in mesangial BK. An insulin-evoked increase in BK activity agrees with a previous study that demonstrated an attenuation by insulin of ANG II- and endothelin-1-evoked mesangial contraction with Ca2+ transients (20). In that study, the reduction of the Ca2+ transients by insulin was eliminated on removal of extracellular Ca2+, suggesting that the Ca2+ increase was the result of Ca2+ entering the cell via plasmalemmal Ca2+ channels. MC contain at least two types of plasmalemmal Ca2+ channels, store-operated Ca2+ channels comprised of canonical transient receptor potential ion channel, subtype 4 (TRPC4) (43, 44) and TRPC1 (35) and Ca2+ channels that are dihydropyridine and voltage sensitive (16, 17). The inhibition of mesangial contraction and Ca2+ transients can be explained by insulin activating BK, which would hyperpolarize the plasma membrane potential and reduce Ca2+ influx via voltage-gated Ca2+ channels.

We did not investigate the role of the BK-β1-subunit in the insulin-evoked activation of BK. It is known that BK-β1, which was upregulated by insulin in this study, enhances the Ca2+/voltage sensitivity of BK-{alpha} (26, 29). It is possible that the increased Po of BK in insulin-treated cells could be explained by the notion that, under control conditions, human MC express BK-{alpha} without the BK-β1-subunit, and insulin induces the association of BK-β1 with the BK-{alpha} in the plasma membrane. However, Toro et al. (41) observed increased endocytic retrieval of BK-{alpha} from the plasma membrane of HEK 293 cells when coexpressed with the BK-β1-subunit.

Activation of BK by insulin resulted in a shift in reversal potential in the I-V relation from 32 to 47 mV, demonstrating that activation of BK hyperpolarized the membrane potential by 15 mV. A hyperpolarizing membrane potential would increase a driving force for Ca2+ entry via TRPC4/TRPC1 channels. Cell Ca2+ entry could further activate BK, completing a positive feedback loop. An increased driving force for Ca2+ entry could stimulate mesangial hypertrophy via calcineurin-stimulated nuclear factor of activated T cells transcription factor (15).

Stimulation of BK via IGF-IR and MAPK. The principal role of insulin is to control intracellular metabolism, whereas IGF-I mediates growth and differentiation. However, insulin stimulation of IGF-IR causes mitogenesis of VSMC (4), and both insulin and IGF-I stimulate growth of hepatic stellate cells (37). Insulin and IGF-I have similar mitogenic properties because their respective receptors have very similar protein structures. However, MC have a minimal quantity of IR but synthesize IGF-I and have a large quantity of IGF-IR (2, 3). Therefore, glucose metabolism in MC is normally independent of basal or even postfeeding levels of insulin. In type 2 DM, plasma insulin is often elevated to levels that are 20-fold more than the normal range (38). Thus 100 nM is not outside the realm of pathophysiological concentrations of insulin, particularly because the exposure to insulin in type 2 DM is for a much longer duration than in the cultured cell model system. It should be mentioned that Abrass et al. (2) found that a much higher concentration of insulin (1 µM) was required to achieve the same effect as 1 nM IGF-I to stimulate proliferation of rat MC. However, human and rat MC may be different with respect to insulin sensitivity.

Although several pathways downstream of IGF-IR are potentially activated by insulin, we focused on the MAPK pathway. In neuronal hippocampal cells, insulin stimulated BK via MAPK signaling, which enhances the Ca2+ sensitivity of BK but does not increase the basal intracellular Ca2+ concentration (32, 46). Schrader et al. (34) demonstrated that ERK/MAPK directly activated Kv4.2 by phosphorylating T607. Interestingly, phosphorylation of Kv4.2 by MAPK required the presence of the associated accessory subunit, KChIP (34).

Although MAPK stimulation did not increase the basal intracellular Ca2+ concentration in hippocampal cells (32), there may be an insulin-induced increase in MAPK that results in a subplasmalemmal Ca2+ concentration that is high enough to activate BK. In support of this notion, IGF-I stimulated the translocation of an expressed TRP cation channel to the plasma membrane of Chinese hamster ovary cells (21). Moreover, both insulin and IGF-I upregulated stably expressed vanilloid transient receptor potential ion channel, subtype 1 in neuroblastoma cells by mechanisms involving both phosphatidylinositol 3-kinase and MAPK (25). Therefore, it is possible that activation of BK by insulin is the indirect result of increasing expression of plasmalemmal TRP channels, which deliver undetected quantities of subplasmalemmal Ca2+ to BK.

In vivo evidence for insulin-stimulated BK. Plasma insulin is one of several molecules that are elevated in association with metabolic syndrome and early stage type 2 DM. We have shown with a type 2 DM mouse model that elevated insulin is associated with an increase in glomerular BK-{alpha}. However, this increase could be the result of other compounds, like aldosterone, which is elevated in type 2 DM mice (27). Indeed, a previous study has shown that renal BK-{alpha} mRNA (28) and BK-mediated K+ secretion in the distal nephron (5) is upregulated by a high-K+ diet, which stimulates aldosterone in mammals. Therefore, aldosterone may independently increase BK activity in MC in vivo.

In summary, we have found that high plasma levels of insulin increase BK activity in human MC in vitro, in part, by stimulating the MAPK pathway. The effects of insulin may explain the increased BK-{alpha} observed in glomeruli from type 2 DM mice and may partly explain the hyperfiltration observed in the early stages of type 2 DM.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institutes of Diabetes and Digestive and Kidney Diseases Grants RO1 DK-49461 and RO1 DK-73070 (to S. C. Sansom) and a fellowship (no. 0610059Z) from the American Heart Association-Heartland Affiliate (P. R. Grimm).


    ACKNOWLEDGMENTS
 
Parts of this study was presented at the American Society of Nephrology 40th Annual Meeting and Scientific Exposition, November 2007.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. C. Sansom, Dept. of Cellular and Integrative Physiology, Univ. of Nebraska Medical Center, 985850 Nebraska Medical Center, Omaha, NE 68198-5850 (e-mail: ssansom{at}unmc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Abrass CK. Diabetic nephropathy. Mechanisms of mesangial matrix expansion. West J Med 162: 318–321, 1995.[Web of Science][Medline]
  2. Abrass CK, Raugi GJ, Gabourel LS, Lovett DH. Insulin and insulin-like growth factor I binding to cultured rat glomerular mesangial cells. Endocrinology 123: 2432–2439, 1988.[Abstract/Free Full Text]
  3. Arnqvist HJ, Ballermann BJ, King GL. Receptors for and effects of insulin and IGF-I in rat glomerular mesangial cells. Am J Physiol Cell Physiol 254: C411–C416, 1988.[Abstract/Free Full Text]
  4. Avena R, Mitchell ME, Carmody B, Arora S, Neville RF, Sidaway AN. Insulin-like growth factor-1 receptors mediate infragenicular vascular smooth muscle cell proliferation in response to glucose and insulin not by insulin receptors. Am J Surg 178: 156–161, 1999.[CrossRef][Web of Science][Medline]
  5. Bailey MA, Cantone A, Yan Q, MacGregor GG, Leng Q, Amorim JB, Wang T, Hebert SC, Giebisch G, Malnic G. Maxi-K channels contribute to urinary potassium excretion in the ROMK-deficient mouse model of Type II Bartter's syndrome and in adaptation to a high-K diet. Kidney Int 70: 51–59, 2006.[CrossRef][Web of Science][Medline]
  6. Bak M, Thomsen K, Christiansen T, Flyvbjerg A. Renal enlargement precedes renal hyperfiltration in early experimental diabetes in rats. J Am Soc Nephrol 11: 1287–1292, 2000.[Abstract/Free Full Text]
  7. Bao L, Cox DH. Gating and ionic currents reveal how the BKCa channel's Ca2+ sensitivity is enhanced by its beta1 subunit. J Gen Physiol 126: 393–412, 2005.[Abstract/Free Full Text]
  8. Bruce R, Rutland M, Cundy T. Glomerular hyperfiltration in young Polynesians with type 2 diabetes. Diabetes Res Clin Pract 25: 155–160, 1994.[CrossRef][Web of Science][Medline]
  9. Butkowski RJ, De A. Preparation and composition of mouse tubular and glomerular basement membranes. Prep Biochem 12: 209–227, 1982.[CrossRef][Web of Science][Medline]
  10. Chaiken RL, Eckert-Norton M, Bard M, Banerji MA, Palmisano J, Sachimechi I, Lebovitz HE. Hyperfiltration in African-American patients with type 2 diabetes. Cross-sectional and longitudinal data. Diabetes Care 21: 2129–2134, 1998.[Abstract]
  11. Chen LM, Li XW, Huang LW, Li Y, Duan L, Zhang XJ. The early pathological changes of KKAy mice with type 2 diabetes. Zhongguo Yi Xue Ke Xue Yuan Xue Bao 24: 71–75, 2002.[Medline]
  12. Coiret G, Borowiec AS, Mariot P, Ouadid-Ahidouch H, Matifat F. The antiestrogen tamoxifen activates BK channels and stimulates proliferation of MCF-7 breast cancer cells. Mol Pharmacol 71: 843–851, 2007.[Abstract/Free Full Text]
  13. Conti FG, Striker LJ, Lesniak MA, Mackay K, Roth J, Striker GE. Studies on binding and mitogenic effect of insulin and insulin-like growth factor I in glomerular mesangial cells. Endocrinology 122: 2788–2795, 1988.[Abstract/Free Full Text]
  14. Dalla VM, Saller A, Mauer M, Fioretto P. Role of mesangial expansion in the pathogenesis of diabetic nephropathy. J Nephrol 14, Suppl 4: S51–S57, 2001.[Web of Science][Medline]
  15. Gooch JL, Tang Y, Ricono JM, Abboud HE. Insulin-like growth factor-I induces renal cell hypertrophy via a calcineurin-dependent mechanism. J Biol Chem 276: 42492–42500, 2001.[Abstract/Free Full Text]
  16. Goppelt-Struebe M, Stroebel M. Mechanisms of serotonin-induced Ca2+ responses in mesangial cells. Naunyn Schmiedebergs Arch Pharmacol 356: 240–247, 1997.[CrossRef][Medline]
  17. Hall DA, Carmines PK, Sansom SC. Dihydropyridine-sensitive Ca2+ channels in human glomerular mesangial cells. Am J Physiol Renal Physiol 278: F97–F103, 2000.[Abstract/Free Full Text]
  18. Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch 391: 85–100, 1981.[CrossRef][Web of Science][Medline]
  19. Hirschberg R, Kopple JD. Evidence that insulin-like growth factor I increases renal plasma flow and glomerular filtration rate in fasted rats. J Clin Invest 83: 326–330, 1989.[Web of Science][Medline]
  20. Inishi Y, Okuda T, Arakawa T, Kurokawa K. Insulin attenuates intracellular calcium responses and cell contraction caused by vasoactive agents. Kidney Int 45: 1318–1325, 1994.[Web of Science][Medline]
  21. Kanzaki M, Zhang YQ, Mashima H, Li L, Shibata H, Kojima I. Translocation of a calcium-permeable cation channel induced by insulin-like growth factor-I. Nat Cell Biol 1: 165–170, 1999.[CrossRef][Web of Science][Medline]
  22. Knight SF, Imig JD. Obesity, insulin resistance, and renal function. Microcirculation 14: 349–362, 2007.[CrossRef][Web of Science][Medline]
  23. Kreisberg JI, Ayo SH. The glomerular mesangium in diabetes mellitus. Kidney Int 43: 109–113, 1993.[Web of Science][Medline]
  24. Kudlacek PE, Pluznick JL, Ma R, Padanilam B, Sansom SC. Role of hbeta1 in activation of human mesangial BK channels by cGMP kinase. Am J Physiol Renal Physiol 285: F289–F294, 2003.[Abstract/Free Full Text]
  25. Lilja J, Laulund F, Forsby A. Insulin and insulin-like growth factor type-I up-regulate the vanilloid receptor-1 (TRPV1) in stably TRPV1-expressing SH-SY5Y neuroblastoma cells. J Neurosci Res 85: 1413–1419, 2007.[CrossRef][Web of Science][Medline]
  26. McManus OB, Helms LMH, Pallanck L, Ganetzky B, Swanson R, Leonard RJ. Functional role of the β subunit of high conductance calcium- activated potassium channels. Neuron 14: 645–650, 1995.[CrossRef][Web of Science][Medline]
  27. Nagase M, Yoshida S, Shibata S, Nagase T, Gotoda T, Ando K, Fujita T. Enhanced aldosterone signaling in the early nephropathy of rats with metabolic syndrome: possible contribution of fat-derived factors. J Am Soc Nephrol 17: 3438–3446, 2006.[Abstract/Free Full Text]
  28. Najjar F, Zhou H, Morimoto T, Bruns JB, Li HS, Liu W, Kleyman TR, Satlin LM. Dietary K+ regulates apical membrane expression of maxi-K channels in rabbit cortical collecting duct. Am J Physiol Renal Physiol 289: F922–F932, 2005.[Abstract/Free Full Text]
  29. Nimigean CM, Magleby KL. The beta subunit increases the Ca2+ sensitivity of large conductance Ca2+-activated potassium channels by retaining the gating in the bursting states. J Gen Physiol 113: 425–440, 1999.[Abstract/Free Full Text]
  30. Okuda T, Yamashita N, Kurokawa K. Angiotensin II and vasopressin stimulate calcium-activated chloride conductance in rat mesangial cells. J Clin Invest 78: 1442–1448, 1986.
  31. O'Malley D, Harvey J. Insulin activates native and recombinant large conductance Ca(2+)-activated potassium channels via a mitogen-activated protein kinase-dependent process. Mol Pharmacol 65: 1352–1363, 2004.[Abstract/Free Full Text]
  32. O'Malley D, Shanley LJ, Harvey J. Insulin inhibits rat hippocampal neurones via activation of ATP-sensitive K+ and large conductance Ca2+-activated K+ channels. Neuropharmacology 44: 855–863, 2003.[CrossRef][Web of Science][Medline]
  33. Pfaffl M, Meyer HH, Sauerwein H. Quantification of insulin-like growth factor-1 (IGF-1) mRNA: development and validation of an internally standardised competitive reverse transcription-polymerase chain reaction. Exp Clin Endocrinol Diabetes 106: 506–513, 1998.[Web of Science][Medline]
  34. Schrader LA, Birnbaum SG, Nadin BM, Ren Y, Bui D, Anderson AE, Sweatt JD. ERK/MAPK regulates the Kv4.2 potassium channel by direct phosphorylation of the pore-forming subunit. Am J Physiol Cell Physiol 290: C852–C861, 2006.[Abstract/Free Full Text]
  35. Sours S, Du J, Chu S, Ding M, Zhou XJ, Ma R. Expression of canonical transient receptor potential (TRPC) proteins in human glomerular mesangial cells. Am J Physiol Renal Physiol 290: F1507–F1515, 2006.[Abstract/Free Full Text]
  36. Sugiura T, Imai E, Moriyama T, Horio M, Hori M. Calcium channel blockers inhibit proliferation and matrix production in rat mesangial cells: possible mechanism of suppression of AP-1 and CREB activities. Nephron 85: 71–80, 2000.[CrossRef][Web of Science][Medline]
  37. Svegliati-Baroni G, Ridolfi F, Di Sario A, Casini A, Marucci L, Gaggiotti G, Orlandoni P, Macarri G, Perego L, Benedetti A, Folli F. Insulin and insulin-like growth factor-1 stimulate proliferation and type I collagen accumulation by human hepatic stellate cells: differential effects on signal transduction pathways. Hepatology 29: 1743–1751, 1999.[CrossRef][Web of Science][Medline]
  38. Szybinski Z, Szurkowska M. Insulinemia–a marker of early diagnosis and control of efficacy of treatment of type II diabetes. Pol Arch Med Wewn 106: 793–800, 2001.[Medline]
  39. Tack I, Elliot SJ, Potier M, Rivera A, Striker GE, Striker LJ. Autocrine activation of the IGF-I signaling pathway in mesangial cells isolated from diabetic NOD mice. Diabetes 51: 182–188, 2002.[Abstract/Free Full Text]
  40. Tao Y, Howlett A, Klein C. Nitric oxide regulation of glyceraldehyde-3-phosphate dehydrogenase activity in Dictyostelium discoideum cells and lysates. Eur J Biochem 224: 447–454, 1994.[Web of Science][Medline]
  41. Toro B, Cox N, Wilson RJ, Garrido-Sanabria E, Stefani E, Toro L, Zarei MM. KCNMB1 regulates surface expression of a voltage and Ca2+-activated K+ channel via endocytic trafficking signals. Neuroscience 142: 661–669, 2006.[CrossRef][Web of Science][Medline]
  42. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76: 4350–4354, 1979.[Abstract/Free Full Text]
  43. Wang X, Pluznick JL, Settles DC, Sansom SC. Association of VASP with TRPC4 in PKG-mediated inhibition of the store-operated calcium response in mesangial cells. Am J Physiol Renal Physiol 293: F1768–F1776, 2007.[Abstract/Free Full Text]
  44. Wang X, Pluznick JL, Wei P, Padanilam BJ, Sansom SC. TRPC4 forms store-operated Ca2+ channels in mouse mesangial cells. Am J Physiol Cell Physiol 287: C357–C364, 2004.[Abstract/Free Full Text]
  45. Wei P, Lane PH, Lane JT, Padanilam BJ, Sansom SC. Glomerular structural and functional changes in a high-fat diet mouse model of early-stage Type 2 diabetes. Diabetologia 47: 1541–1549, 2004.[CrossRef][Web of Science][Medline]
  46. Yu JZ, Bondy GP, Allard MF, Thompson CR, Levin A, McManus BM. Serum from patients with chronic renal insufficiency alters growth characteristics and ANP mRNA expression of adult rat cardiac myocytes. J Mol Cell Cardiol 28: 2429–2441, 1996.[CrossRef][Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/6/F1465    most recent
00012.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foutz, R. M.
Right arrow Articles by Sansom, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foutz, R. M.
Right arrow Articles by Sansom, S. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.