AJP - Renal Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Renal Physiol 296: F127-F134, 2009. First published October 29, 2008; doi:10.1152/ajprenal.90479.2008
0363-6127/09 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
296/1/F127    most recent
90479.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jensen, A. M.
Right arrow Articles by Frøkiær, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jensen, A. M.
Right arrow Articles by Frøkiær, J.

Angiotensin II regulates V2 receptor and pAQP2 during ureteral obstruction

Anja M. Jensen,1,2 Eun Hui Bae,4 Robert A. Fenton,1,3 Rikke Nørregaard,1,2 Søren Nielsen,1,3 Soo Wan Kim,4 and Jørgen Frøkiær1,2

1The Water and Salt Research Center, 2Institute of Clinical Medicine, and 3Institute of Anatomy, University of Aarhus, Aarhus, Denmark; and 4Department of Internal Medicine, Chonnam National University Medical School, Gwangju, Korea

Submitted 5 August 2008 ; accepted in final form 24 October 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Release of bilateral ureteral obstruction (BUO) is associated with nephrogenic diabetes insipidus (NDI) and a reduced abundance of the vasopressin-regulated aquaporins. To evaluate the role of the vasopressin type 2 receptor (V2R), we determined V2R abundance in kidneys from rats subjected to 24-h BUO or 24-h unilateral ureteral obstruction (UUO) followed by 48-h release. Because angiotensin II type 1 (AT1) receptor blockade attenuates postobstructive polyuria and aquaporin-2 (AQP2) downregulation, we examined the effect of AT1 receptor blockade on AQP2 phosphorylated at serine 256 (pS256-AQP2) and V2 receptor complex abundance in kidney inner medulla (IM). Furthermore, cAMP generation in sodium fluoride- and forskolin-stimulated inner medullary membrane fractions was studied after release of BUO. V2R was significantly reduced to 12% of sham levels in IM and to 52% of sham levels in cortex and outer stripe of outer medulla (OSOM) from BUO rats. In UUO rats, V2R abundance in the obstructed kidney IM decreased to 35% of sham levels, whereas it was comparable to sham levels in the nonobstructed kidney IM. No significant change was observed in cortex and OSOM. AT1 receptor blockade attenuated V2R, pS256-AQP2, and Gs{alpha} protein downregulation in IM and partially reversed the obstruction-induced inhibition of sodium fluoride- and forskolin-stimulated cAMP generation in inner medullary membrane fractions from BUO rats. In conclusion, V2R downregulation plays a pivotal role in development of NDI after release of BUO. In addition, we have shown that angiotensin II regulates the V2 receptor complex and pS256-AQP2 in postobstructive kidney IM, probably by stimulating cAMP generation.

angiotensin II type 1 receptor blockade; nephrogenic diabetes insipidus; vasopressin receptor type 2; phosphorylated aquaporin-2

ACQUIRED NEPHROGENIC DIABETES INSIPIDUS (NDI) is a well-described complication of bilateral ureteral obstruction (BUO). It is characterized by marked vasopressin-resistant polyuria (46, 49) and a decreased abundance of major aquaporins and sodium transporters along the nephron (9, 19, 27, 28, 39).

The antidiuretic hormone vasopressin is crucial for the kidney's ability to concentrate the urine and, hence, to regulate body fluid homeostasis. Vasopressin is released from the posterior pituitary gland in response to small increases in plasma osmolality or a reduced circulating blood volume. In the kidney, it binds to the type 2 vasopressin receptor (V2R) (3, 29) and promotes water reabsorption in the collecting ducts and NaCl reabsorption in the thick ascending limb (TAL). In the collecting ducts, binding of vasopressin to the G protein-coupled V2R activates adenylyl cyclase and thereby increases intracellular cAMP levels. cAMP activates protein kinase A, which leads to phosphorylation of aquaporin-2 (AQP2) and an increased synthesis of AQP2. Finally, subapical vesicles containing phosphorylated AQP2 (pAQP2) are inserted into the apical membrane of the collecting duct principal cells, leading to an enhanced water reabsorption capacity (for review, see Ref. 21). The effect of vasopressin in the TAL is less well-characterized, but various studies show that it acutely increases the NaCl reabsorption via an adenylate cyclase-dependent mechanism and increases renal Na-K-2Cl transporter (NKCC2) abundance in the TAL (12, 15, 18). Protein abundance of the heterotrimeric G protein Gs {alpha}-subunit (Gs{alpha}) and adenylyl cyclase VI, different parts of the V2R complex, and the intracellular cAMP generation are reduced in the kidney from rats subjected to BUO (19). This is consistent with the decreased abundance of the vasopressin-regulated AQP2 and NKCC2 (9, 28). However, the regulation of the V2R in ureteral obstruction remains unresolved.

It is well-established that ureteral obstruction is associated with activation of the renin-angiotensin-system (8, 37, 50), and recently we demonstrated that blockade of the ANG II receptor type 1 (AT1) with candesartan reduced the vasopressin-resistant polyuria and partly prevented downregulation of the vasopressin-regulated AQP2 and NKCC2 48 h after release of 24-h BUO. AT1 receptor blockade did not affect the abundance of non-vasopressin-regulated aquaporins and sodium transporters in the collecting duct and TAL (17). These findings led us to hypothesize that ANG II influences intracellular cAMP generation and that it possibly changes the abundance of the V2R complex in the postobstructive kidney.

The aims of the present study were therefore 1) to examine whether obstruction changes the V2R mRNA and protein levels in the postobstructive kidney and 2) to examine the effect of AT1 receptor blockade on the V2R complex abundance, pS256-AQP2 abundance, and intracellular cAMP generation in the postobstructive kidney inner medulla from rats subjected to 24-h BUO followed by a 48-h release period.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Experimental animals. The animal protocols were approved by the board at the Institute of Clinical Medicine, University of Aarhus, according to the licenses for use of experimental animal issued by the Danish Ministry of Justice (study 1) and the Institutional Guidelines of Experimental Animal Care and Use, Korea (study 2). Studies were performed in male Munich-Wistar rats (Møllegaard Breeding Center, Eiby, Denmark; study 1) and male Sprague-Dawley rats (study 2) initially weighing 240 ± 10 g, since it was not possible to obtain Münich Wistar rats for the studies in Korea.

The rats were anesthetized with isoflurane (Abbott Scandinavia, Solna, Sweden), and through a midline abdominal incision, a 5-mm-long piece of bisected polyethylene tubing (PE-50) was placed around each ureter. The ureter was then occluded by tightening the tubing with a 5-0 silk ligature, and 24 h later, the ligature and PE tubing were removed.

In study 1, BUO (n = 7) and unilateral ureteral obstruction (UUO; n = 14) were induced for 24 h, followed by a 48-h release period (Fig. 1). Sham-operated controls were prepared in parallel. Kidneys were prepared for quantitative PCR (Q-PCR) and immunoblotting.


Figure 1
View larger version (8K):
[in this window]
[in a new window]

  		Fig. 1. Diagram of the study design. A: study 1: rats were subjected to 24-h bilateral ureteral obstruction (BUO) or 24-h unilateral ureteral obstruction (UUO). After release of the obstruction, the rats were observed for 48 h. Age- and time-matched sham-operated control rats were observed in parallel with the BUO and UUO rats. B: study 2: rats were subjected to 24-h BUO and observed for 48 h after release of the obstruction. The rats were divided into 2 groups: a vehicle-treated group and a candesartan-treated group. Candesartan (1 mg·kg–1·day–1) was administrated in osmotic minipumps. Age- and time-matched sham-operated control rats were observed in parallel.

 
In study 2, BUO was induced for 24 h, followed by 48 h of release (n = 22). Osmotic minipumps (Alzet, Scanbur, Denmark) with saline (n = 10) or candesartan (1 mg·kg–1·day–1; AstraZeneca, Mölndal, Sweden) dissolved in 1 M Na2CO3 (n = 12) were surgically implanted subcutaneously when the obstruction was performed (Fig. 1). Sham-operated controls were prepared in parallel (n = 11). Kidneys were prepared for immunoblotting and, in a subset of animals (total = 13), for membrane preparation. An identical protocol was used for immunohistochemistry (n = 12).

Q-PCR. Total RNA was isolated from rat kidney zones with the RNeasy mini kit, and DNase digestion was routinely performed (Qiagen Nordic, Ballerup, Denmark). RNA was quantitated by spectrophotometry, and cDNA synthesis was performed on 1 µg of RNA with the iScript cDNA synthesis kit (Bio-Rad, Herlev, Denmark). For quantitative PCR, 100 ng of cDNA served as a template for PCR amplification with Brilliant SYBR green QPCR master mix according to the manufacturer's instructions (Stratagene). Serial dilution (1 ng–1 fg/µl) of cDNA was used as template for generation of a standard curve. Primers were used to amplify standards and kidney cDNA samples: V2R NH2 terminal, sense ATGCTCCTGGTGTCTACCGTGTCCG, antisense GCGTCCACGCCGGCCCCGCCGTAT; V2R COOH terminal: sense TGTGTTGCTCATGCTGCTGGCTAGCCTTA, antisense TCAGGAGGGTGTATCCTTCATCAAAGAGGA. Q-PCR was performed as described previously (32).

Membrane fractionation for immunoblotting. After removal, the left kidney was immediately dissected into outer stripe of outer medulla and cortex (cortex + OSOM), inner stripe of outer medulla (ISOM), and inner medulla (IM), and tissue was homogenized (30 s, 1,250 rpm, Ultra-Turrax T8 homogenizer; IKA Labortechnik) in ice-cold isolation solution: 0.3 M sucrose, 25 mM imidazole, and 1 mM EDTA, pH 7.2, and the protease inhibitors 8.5 µM leupeptin (Sigma-Aldrich) and 0.4 mM Pefabloc (Roche). Isolation solution for IM was added containing the phosphatase inhibitors sodium orthovanadate (0.0184 g/100 ml buffer; Sigma-Aldrich), sodium fluoride (0.1052 g/100 ml buffer; Merck, Whitehouse Station, NJ), and okadaic acid (16.4 µl/100 ml buffer; Calbiochem, San Diego, CA). The homogenates were then centrifuged at 1,000 g for 15 min at 4°C to remove whole cells, nuclei, and mitochondria, and gel samples were prepared from the supernatant in Laemmli sample buffer containing 2% SDS and dithiothreitol. The total protein concentration of the homogenate was measured using a Pierce BCA protein assay kit (Roche, Basel, Switzerland).

Electrophoresis and immunoblotting. Samples of membrane fractionation were run on 12% polyacrylamide gels (Mini Protean II; Bio-Rad). To ascertain identical loading and allow for correction, an identical gel was run in parallel and subjected to Coomassie staining. The proteins were transferred to either a polyvinylidene difluoride membrane (Immobilon-P PVDF; Millipore) for V2R antibody or a nitrocellulose membrane (Hybond ECL RPN3032D; Amersham Pharmacia Biotech) for pAQP, Gs{alpha}, and adenylyl cyclase VI antibody. After transfer, the blots were then blocked with 5% milk in PBS-T (80 mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl, and 0.1% Tween 20, pH 7.5) and incubated overnight at 4°C with the following primary antibodies: V2R antibody (no. 7251 AP) previously characterized (7), type VI adenylyl cyclase (Santa Cruz Biotechnology, Santa Cruz, CA), heteromeric G protein subunit Gs{alpha} (Calbiochem-Novabiochem, San Diego, CA), and pS256-AQP2 (KO407), a new antibody raised against the same sequence of immunizing peptide [GRRQ(pS)VELHSPC] as the previously characterized antibody (5). The specificity was evaluated by 1) detection of the immunizing peptide on immunoblot using immune serum and as negative control preimmune serum from the same rabbit, and 2) detection of pS256-AQP2 in a protein sample prepared from rat kidney homogenates on immunoblot using affinity-purified anti-pS256-AQP2 antibody showing 29- and 35- to 50-kDa bands identical to those seen in rat tissue with the previously characterized antibody.

The antigen-antibody complex was visualized with horseradish peroxidase-conjugated secondary antibodies (P448; DAKO, Glostrup, Denmark) using the enhanced chemiluminescence system (Amersham Pharmacia Biotechnology).

Immunohistochemistry. Kidneys were fixed by retrograde perfusion via the abdominal aorta with 4% paraformaldehyde in 0.1 M cacodylate buffer, pH 7.4. After removal, the midregion of the kidney was sectioned into 2- to 3-mm transverse sections and immersion fixed for an additional 1 h, followed by three 10-min washes with 0.1 M cacodylate buffer, pH 7.4. The tissue was dehydrated and embedded in paraffin, and 2-µm sections were cut on a rotary microtome (Leica Microsystems, Herlev, Denmark). For immunolabeling, the sections were deparaffinized and rehydrated, and endogenous peroxidase activity was blocked by 0.5% H2O2 in absolute methanol for 10 min. To expose antigens, kidney sections were boiled in a target retrieval solution (1 mM Tris solution, pH 9.0, with 0.5 mM EGTA) for 10 min. After cooling, nonspecific binding was blocked with 50 mM NH4Cl in PBS for 30 min, followed by three 10-min washes with PBS blocking buffer containing 1% BSA, 0.05% saponin, and 0.2% gelatin. The sections were incubated with primary antibodies diluted in PBS with 0.1% BSA and 0.3% Triton X-100 overnight at 4°C. The sections were washed three times for 10 min with PBS wash buffer containing 0.1% BSA, 0.05% saponin, and 0.2% gelatin and incubated with horseradish peroxidase-conjugated secondary antibodies (P448, goat anti-rabbit immunoglobulin; DAKO) for 1 h at room temperature. After three 10-min rinses with PBS wash buffer, the antibody-antigen reactions were visualized with 0.05% 3,3'-diaminobenzidine tetrachloride (DAB; Kemen Tek, Copenhagen, Denmark) dissolved in distilled water with 0.1% H2O2. Light microscopy was carried out with a Leica DMRE (Leica Microsystems).

Membrane preparation and adenylyl cyclase activity. The membrane preparation and adenylate cyclase measurements have been described previously (20, 22). Briefly, kidney tissue were homogenized in ice-cold buffer (50 mM Tris·HCl, pH 8.0, with 1 mM EDTA, 0.2 mM PMSF, and 250 mM sucrose) and centrifuged at 1,200 g for 15 min at 4°C, followed by ultracentrifugation of the supernatant at 100,000 g for 1 h at 4°C.

Adenylate cyclase activity in response to sodium fluoride and forskolin stimulation was measured in the membrane fractions (the pellet) by using the method of Bar (2), slightly modified. The reaction was initiated by adding membrane fractions to a working solution (50 mM Tris·HCl, pH 7.6, with 1 mM ATP, 20 mM phosphocreatine, 0.2 mg/ml creatine phosphokinase, 6.4 mM MgCl2, 10 mM 3-isobutyl-1-methylxanthine, and 0.02 mM GTP), and after 15 min the reaction was blocked by addition of a cold 50 mM sodium acetate solution (pH 5.0). Finally, the mixture was centrifuged at 20,000 g for 5 min at 4°C, and cAMP was measured in the supernatant by equilibrated radioimmunoassay as previously described (20). Protein concentrations were determined using a bicinchoninic acid assay kit (Bio-Rad, Hercules, CA). Results are expressed as picomoles of cAMP per milligram of protein per minute.

Presentation of data and statistical analyses. Quantitative data are means ± SE. Statistical comparisons were accomplished by unpaired t-test (study 1), and multiple comparisons among the groups were made by one-way ANOVA and post hoc Tukey's honestly significant difference test (study 2). Data were analyzed by Mann-Whitney rank sum test when variables were not normally distributed. P values <0.05 were considered statistically significant.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
V2R abundance was reduced in the postobstructive kidney. The V2R in the collecting duct is essential for the regulation of AQP2 trafficking and synthesis. Therefore, we examined V2R mRNA and protein levels in kidneys from rats subjected to either 24-h BUO followed by 48-h release or 24-h UUO followed by 48-h release. Protein abundance was determined by immunoblotting using a specific antibody against the V2R (7). However, this antibody detects only V2R localized in the collecting ducts and not V2R found in the TAL. Therefore, immunoblotting was only performed on samples from cortex + OSOM and IM, reflecting V2R abundance in the collecting ducts. V2R mRNA expression was significantly reduced in the kidney IM from BUO and UUO rats compared with sham-operated control rats (Figs. 2 and 3, P < 0.01). This finding was confirmed by immunoblotting, demonstrating a significant decrease in V2R abundance to 12% of sham levels in IM from BUO rats (Fig. 2, P < 0.01). In rats subjected to UUO, V2R abundance in the obstructed kidney was reduced to 35% of sham levels in IM (Fig. 3, P < 0.01), whereas V2R abundance was unchanged in the nonobstructed kidney at the time point examined (Fig. 3). In cortex + OSOM, immunoblotting revealed a clear decrease in V2R abundance to 52% of sham levels in BUO rats (Fig. 2, P < 0.01), whereas V2R abundance in the obstructed kidney from UUO rats was 77% of sham levels, showing a trend toward reduction (not significant; Fig. 3). V2R mRNA level in cortex + OSOM from BUO rats was significantly reduced when the COOH-terminal primer was used (Fig. 2, P < 0.05) but was comparable to sham levels when the NH2-terminal primer was used. In UUO rats, V2R mRNA expression in the obstructed kidney decreased significantly with the use of both primer sets (Fig. 3, P < 0.05).


Figure 2
View larger version (26K):
[in this window]
[in a new window]

  		Fig. 2. Vasopressin type 2 receptor (V2R) mRNA level and protein abundance in inner medulla (IM) and cortex + outer stripe of outer medulla (OSOM) from BUO rats (n = 7) and sham-operated control rats (n = 7). A: representative quantitative PCR (Q-PCR) for the V2R [NH2 (N)- and COOH (C)-terminal primers] and TATA box binding protein (TBP). Q-PCR was performed using 100 ng of cDNA. V2R mRNA level was reduced in IM from BUO rats compared with sham-operated control rats. In cortex + OSOM, V2R mRNA level was significantly reduced when the C-terminal primer was used but was comparable to sham levels when the N-terminal primer was used. B: immunoblots were reacted with a specific anti-V2R antibody and revealed a single band at ~47 kDa in IM and a doublet at ~43–47 kDa in cortex + OSOM. Densitometric analysis of all samples from BUO and sham-operated rats (corrected according to loading) revealed a significant decrease in V2R protein abundance in kidney IM and cortex + OSOM from BUO rats. Each column represents the mean ± SE. #P < 0.05; *P < 0.01, statistically significant compared with sham-operated control rats.

 

Figure 3
View larger version (28K):
[in this window]
[in a new window]

  		Fig. 3. V2R mRNA level and protein abundance in IM and cortex + OSOM from the left, obstructed kidney (LK) and the right, nonobstructed kidney (RK) from UUO rats (n = 7) and a control kidney from sham-operated control rats (n = 7). A: representative Q-PCR for the V2R (C-and N-terminal primers; see Fig. 2), and TBP. Q-PCR was performed using 100 ng of cDNA. V2R mRNA level was significantly reduced in obstructed kidney IM compared with nonobstructed kidney IM from UUO rats and control kidney IM from sham-operated rats. In cortex + OSOM, V2R mRNA level was significantly decreased in the obstructed kidney compared with that in the sham-operated control kidney. B: immunoblots were reacted with a specific anti-V2R antibody and revealed a single band at ~47 kDa in IM and a doublet at ~43–47 kDa in cortex + OSOM. Densitometric analysis of all samples from UUO and sham-operated control rats (corrected according to loading) revealed a significant decrease in V2R protein abundance in obstructed kidney IM compared with the nonobstructed kidney IM from UUO rats and the control kidney IM from sham-operated control rats. In cortex + OSOM, V2R abundance was comparable in UUO and sham rats. Each column represents the mean ± SE. *P < 0.01, statistically significant compared with sham-operated control rats. #P < 0.05, statistically significant compared with the nonobstructed kidney.

 
Candesartan attenuated V2R and pS256-AQP2 downregulation in postobstructive kidney IM. AT1 receptor blockade by candesartan attenuates downregulation of vasopressin-regulated transport proteins in the postobstructive kidney (17). Therefore, we determined the effect of candesartan treatment on V2R and pS256-AQP2 protein levels in kidney IM from rats subjected to 24-h BUO followed by 48-h release. We found a significant increase in V2R abundance in IM from candesartan-treated BUO rats to 30% of sham levels compared with 13% of sham levels in vehicle-treated BUO rats (Fig. 4, P < 0.05). Furthermore, immunoblotting demonstrated that 24-h BUO followed by 48-h release caused a significant reduction in pS256-AQP2 protein abundance in IM and that this decrease was attenuated by AT1 receptor blockade (Fig. 4, P < 0.05). Interestingly, we observed a more pronounced decrease in V2R abundance than in pS256-AQP2 abundance in IM from both vehicle- and candesartan-treated BUO rats compared with sham-operated rats. Immunohistochemistry confirmed the immunoblotting and showed a very weak V2R labeling of the collecting duct principal cells in kidney IM from BUO rats compared with sham-operated rats (Fig. 5, A and B). Moreover, pS256-AQP2 labeling was much weaker in the apical plasma membrane domains of the IM collecting duct from BUO rats compared with sham-operated rats (Fig. 5, D and E). Labeling of both the V2R and pS256-AQP2 were stronger in candesartan-treated BUO rats compared with vehicle-treated rats but was still weaker than in sham rats (Fig. 5, C and F).


Figure 4
View larger version (53K):
[in this window]
[in a new window]

  		Fig. 4. V2R and serine 256-phosphorylated aquaporin-2 (pS256-AQP2) protein abundance in IM from vehicle-treated BUO rats (n = 10), candesartan-treated BUO rats (BUO+C; n = 12), and sham-operated control rats (n = 11). (One representative experiment is shown). A: immunoblots were reacted with a specific anti-V2R antibody (top) revealing a single band at ~47 kDa and with an affinity-purified anti-pS256-AQP2 antibody (bottom) revealing 29-kDa and 35- to 50-kDa bands representing nonglycosylated and glycosylated forms of pS256-AQP2. B: densitometric analysis of all samples from BUO, BUO+C, and sham-operated control rats (corrected according to loading) revealed a significant decrease in V2R and pS256-AQP2 protein abundance in kidney IM from BUO rats compared with sham rats. Candesartan treatment significantly attenuated this decrease in V2R and pS256-AQP2 abundance. Each column represents the mean ± SE. *P < 0.05, statistically significant compared with sham-operated rats. #P < 0.05, statistically significant compared with vehicle-treated BUO rats.

 

Figure 5
View larger version (86K):
[in this window]
[in a new window]

  		Fig. 5. Immunoperoxidase labeling of V2R (A–C) and pS256-AQP2 (D–F) in kidney IM from sham-operated control rats (n = 4), BUO rats (n = 4), and BUO+C rats (n = 4). V2R labeling is shown in collecting duct principal cells, and pS256-AQP2 labeling is shown in apical plasma membrane domains of the IM collecting ducts in sham-operated control rats (A and D, respectively). Labeling of both V2R and pS256-AQP2 is very weak in the IM collecting duct in BUO rats (B and E) compared with sham-operated rats. Labeling of the V2R and pS256-AQP2 is stronger in BUO+C rats (C and F) compared with BUO rats, although still weaker than that observed in sham rats.

 
Effect of candesartan on Gs{alpha} and adenylyl cyclase VI abundance in BUO rats. Binding of vasopressin to the V2R leads to activation of other receptor complex proteins, Gs{alpha} and the adenylyl cyclase type VI. As previously demonstrated (19), the Gs{alpha} and adenylyl cyclase VI protein levels were significantly decreased in kidney IM in response to 24-h BUO followed by 48-h release (Fig. 6, P < 0.05). Candesartan treatment attenuated downregulation of the Gs{alpha} protein in the postobstructive kidney IM, whereas AT1 receptor blockade had no effect on adenylyl cyclase VI abundance (Fig. 6).


Figure 6
View larger version (59K):
[in this window]
[in a new window]

  		Fig. 6. Semiquantitative immunoblotting of Gs{alpha} and adenylate cyclase VI using kidney protein isolated from IM from BUO rats (n = 4), BUO+C rats (n = 5), and sham-operated control rats (n = 4). A: immunoblots were reacted with a specific anti-Gs{alpha} antibody (top) revealing a doublet at ~50 and 45 kDa and with an anti-adenylyl cyclase VI antibody (bottom) revealing a single band at ~160 kDa. B: densitometric analysis of all samples from BUO, BUO+C, and sham-operated control rats (corrected according to loading) revealed a significant decrease in Gs{alpha}- and adenylyl cyclase VI abundance in kidney IM from BUO rats compared with sham-operated rats. Candesartan attenuated the decrease in Gs{alpha} abundance but had no effect on adenylyl cyclase VI abundance. *P < 0.05, statistically significant compared with sham-operated controls. #P < 0.05, statistically significant compared with vehicle-treated BUO rats.

 
Candesartan attenuated the reduced sodium fluoride- and forskolin-stimulated cAMP generation in BUO. Sodium fluoride stimulates adenylyl cyclase VI in a V2R receptor-independent but Gs{alpha}-dependent manner (42), leading to increases in intracellular cAMP generation. In the present study cAMP generation was significantly decreased in response to sodium fluoride in inner medullary membrane fractions from BUO rats compared with sham-operated control rats, confirming previous findings (Fig. 7, P < 0.05) (19). Furthermore, AT1 receptor blockade attenuated this decrease in sodium fluoride-stimulated cAMP synthesis in IM from BUO rats (Fig. 7, P < 0.05), although it was still inhibited compared with sham-operated control rats.


Figure 7
View larger version (9K):
[in this window]
[in a new window]

  		Fig. 7. cAMP production in response to sodium fluoride and forskolin stimulation of inner medullary membrane fractions. The cAMP generation in response to both sodium fluoride and forskolin stimulation was significantly inhibited in inner medullary membrane fractions from BUO rats compared with those from sham-operated control rats. Candesartan treatment partly prevented this decrease in cAMP generation. Each data point represents the mean ± SE of 4 experiments. *P < 0.05, statistically significant compared with sham-operated control rats. #P < 0.05, statistically significant compared with vehicle-treated BUO rats.

 
Forskolin activates adenylyl cyclase VI directly by binding to its catalytic unit, leading to enhanced cAMP generation. The present study demonstrated a reduced cAMP generation in inner medullary membrane fractions from BUO rats compared with sham-operated controls rats in response to forskolin stimulation as previously demonstrated (Fig. 7, P < 0.05) (19). Candesartan treatment of BUO rats partly prevented the reduced forskolin-stimulated cAMP synthesis in membrane fractions from postobstructive kidney IM (Fig. 7, P < 0.05).


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In the present study we have clearly demonstrated reduced V2R mRNA and protein levels in the postobstructive kidney IM from BUO and UUO rats. Furthermore, the study revealed a decreased V2R protein abundance in postobstructive kidney cortex + OSOM from BUO rats, whereas it was comparable to sham levels in cortex + OSOM from UUO rats. AT1 receptor blockade by candesartan treatment attenuated downregulation of V2R, pS256-AQP2, and Gs{alpha} protein in postobstructive kidney IM from BUO rats. Moreover, cAMP generation in inner medullary membrane fractions from candesartan-treated BUO rats was significantly enhanced compared with that in vehicle-treated BUO rats.

V2 receptor regulation in postobstructive kidney disease. The markedly reduced V2R abundance in kidney IM and cortex + OSOM from BUO rats can possibly explain the development of NDI and downregulation of vasopressin-regulated transport proteins associated with postobstructive kidney disease (19, 27, 28). Local changes in the renal tissue in response to ureteral obstruction may directly reduce V2R in the kidney. However, previous studies have indicated that dehydration causes a decrease in kidney V2R mRNA and protein level in rats (30, 36, 41), so dehydration due to postobstructive polyuria could also play a role. Release of UUO causes no polyuria and dehydration, since the concentration defect of the obstructed kidney is compensated by the nonobstructed kidney (26). Therefore, an identical protocol was used to determine V2R expression in obstructed kidneys from UUO rats compared with control kidneys from sham-operated control rats to eliminate the effect of dehydration. These experiments demonstrated clearly decreased V2R mRNA and protein levels in IM from obstructed kidneys compared with sham-operated control kidneys, suggesting that dehydration does not play a major role in V2R regulation in the postobstructive kidney IM. However, the V2R abundance was comparable to sham levels in the obstructed kidney cortex + OSOM from UUO rats, although it showed a trend toward reduction. Therefore, we cannot exclude the possibility that dehydration specifically influences V2R abundance in the cortical collecting duct, since previous studies showed a specific decrease in V2R levels in kidney cortex and outer medulla from dehydrated rats (36). However, the V2R mRNA level was markedly reduced in the obstructed kidney cortex + OSOM from UUO rats, further emphasizing that local factors in the renal tissue rather than dehydration may be involved in V2R regulation.

It is well documented that the renin-angiotensin-system is activated in ureteral obstruction, and interestingly, several studies have shown that ANG II stimulates V2R expression in the inner medullary collecting ducts (IMCD) (47, 48) and regulates the abundance and localization of vasopressin-regulated transport proteins in the kidney (23–25). AT1 receptor blockade inhibits the vasopressin analog desmopressin (dDAVP)-induced increase in AQP2 and pAQP2 abundance and decreases AQP2 targeting to the plasma membrane of IMCD (24, 25). In addition, AT1 receptor blockade attenuates the antidiuretic effect of vasopressin and relatively increases the urine output in dDAVP-treated rats. In contrast, we previously showed that AT1 receptor blockade has the reverse effect in the postobstructive kidney, where it reduces postobstructive polyuria and partly prevents downregulation of the vasopressin-regulated AQP2 and NKCC2 (17). The present data are consistent with this trend, suggesting that our previous findings may at least partly be explained by attenuated V2R downregulation in postobstructive kidney IM in response to candesartan treatment. The impact of candesartan on the vasopressin-regulated urinary concentration mechanism in ureteral obstruction is further emphasized by the finding that pS256-AQP2 downregulation was also partly prevented by candesartan treatment. This paradoxical, opposite effect of ANG II on the fluid transport properties of the kidney tubule has previously been described and is suggested to be caused by a biphasic response to ANG II depending on the concentration of the hormone (13, 38). Low, physiological concentrations of ANG II stimulate fluid transport, whereas high, pathological concentrations, as seen in ureteral obstruction, inhibit it. The biphasic regulation is lost in AT1 receptor knockout mice, so involvement of the AT2 receptor in pathological states seems not to be responsible for the phenomenon (16).

Ureteral obstruction also enhances prostaglandin E2 (PGE2) generation in the kidney (10, 33) due to an increased expression of the inducible enzyme cyclooxygenase-2 (COX2) in kidney IM (31). The PGE2 increase may be involved in the V2R downregulation demonstrated in the present study, since it was recently shown that PGE2 inhibits vasopressin-mediated upregulation of the V2R in IMCD (30). Moreover, PGE2 directly influences cAMP generation in the collecting duct via G protein-coupled E-prostanoid (EP) receptors (4, 14, 40). Interestingly, candesartan treatment attenuates COX2 induction and thereby reduces PGE2 generation in ureteral obstruction (17), which may contribute to the effect of candesartan on cAMP generation and pS256-AQP2 abundance in IM observed in the present study. Therefore, the mechanism by which candesartan influences the abundance of vasopressin-regulated transport proteins may be a combination of an attenuated V2R downregulation and a reduced PGE2 generation resulting in higher cAMP levels in the IMCD. This complex regulation of vasopressin-regulated membrane proteins is underscored by the finding that V2R abundance was more severely reduced than pS256-AQP2 abundance in kidney IM from both vehicle- and candesartan-treated BUO rats, indicating either vasopressin-independent pS256-AQP2 regulation in postobstructive kidney IM or excess of V2R in the normal kidney.

Candesartan influences Gs{alpha} protein abundance. The present study confirmed previous findings demonstrating a reduced Gs{alpha} and adenylyl cyclase VI abundance in postobstructive kidney IM (19). Furthermore, AT1 receptor blockade attenuated downregulation of Gs{alpha} protein, whereas it had no effect on adenylate cyclase VI abundance. Several studies have investigated whether ANG II directly influences the Gs{alpha} protein in relation to the vascular system, but the results have been very diverse depending on the animal model. In one study, ANG II administration downregulated Gs{alpha} protein in preglomerular arterioles in spontaneous hypertensive rats and upregulated the protein in control Wistar-Kyoto rats (45). However, other studies have found no interactions between ANG II and Gs{alpha} protein levels in the vascular system (1, 11, 34). The present study indicates that an interaction between ANG II and Gs{alpha} protein may exist in the kidney. Interestingly, ANG II stimulates the expression of the inhibitory G proteins Gi{alpha}-2 and Gi{alpha}-3 (1, 11, 34, 35, 45), suggesting a role for these proteins in ureteral obstruction given that inhibitory Gi{alpha}-2 protein is colocalized with the Gs{alpha} protein in the basolateral membrane of collecting duct principal cells (43).

Sodium fluoride- and forskolin-stimulated cAMP generation is enhanced in candesartan-treated BUO rats. Sodium fluoride- and forskolin-stimulated cAMP generation reflects the activity of Gs{alpha} protein and adenylyl cyclase, respectively (42). Interestingly, AT1 receptor blockade caused enhanced cAMP generation when inner medullary membrane fractions from BUO rats were stimulated with either of these two substances, although it remained suppressed compared with sham-operated control rats. The effect of AT1 receptor blockade on sodium fluoride-stimulated cAMP generation can probably be explained by the attenuated Gs{alpha} protein downregulation in candesartan-treated BUO rats. Because adenylate cyclase VI abundance was unchanged in response to candesartan treatment, the mechanism by which AT1 receptor blockade influences forskolin-stimulated cAMP generation is less clear. Synergistic interactions between Gs{alpha} protein and forskolin activation of adenylate cyclase VI have been reported previously in a study that showed greatly reduced forskolin-stimulated adenylate cyclase activity in the absence of Gs{alpha} protein (6). Thus enhanced Gs{alpha} protein abundance in response to AT1 receptor blockade may indirectly increase the forskolin-stimulated adenylate cyclase VI activity. Finally, the effect of AT1 receptor blockade on forskolin-stimulated cAMP generation could rely on changes in the abundance and/or activity of inhibitory G proteins given that a number of these, including the previously mentioned Gi{alpha}-2 and Gi{alpha}-3, inhibit forskolin-stimulated adenylate cyclase activity (44). It should be emphasized that these pharmacological experiments were performed on IM membranes from Sprague-Dawley rats. Although there are minor differences in the kidney structure between Sprague-Dawley and Münich Wistar rats, this is not regarded to have a significant different influence on renal water handling and the intrarenal renin-angiotensin system. Thus the impact on the cAMP generation in these experiments is regarded to be minor.

In summary, we have shown a severely reduced V2R mRNA level and protein abundance in the postobstructive kidney from BUO and UUO rats demonstrating an important association between acquired NDI and downregulation of V2R. Furthermore, our study revealed that AT1 receptor blockade partly prevents dysregulation of the V2 receptor complex and pS256-AQP2 in postobstructive kidney IM and reverses the obstruction-induced inhibition of forskolin- and sodium fluoride-stimulated cAMP generation in inner medullary membrane fractions from BUO rats. The underlying mechanism as to how ANG II influences the V2R complex proteins and the intracellular pathway leading to pS256-AQP2 regulation remains to be determined.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
The Water and Salt Research Center at the University of Aarhus is established and supported by the Danish National Research Foundation (Danmarks Grundforskningsfond). Support for this study was provided by The Foundation of Rudolph Als, The Danish Medical Research Council, The Nordic Center of Excellence Program in Molecular Medicine, the European Union Marie Curie Training Network Program, The University of Aarhus Research Foundation, The Danish Medical Association Research Fund/Højmosegård-legatet, The A. P. Møller Foundation for the Advancement of Medical Science, Aase and Ejnar Danielsen Fund, a Marie Curie Fellowship to R. A. Fenton, and the University of Aarhus.


   ACKNOWLEDGMENTS
 
We thank Gitte Skou, Gitte Kall, and Inger Merete Paulsen for expert technical assistance.


   FOOTNOTES
 

Address for reprint requests and other correspondence: J. Frøkiær, The Water and Salt Research Center, Institute of Clinical Medicine, Univ. of Aarhus, Dept. of Clinical Physiology and Nuclear Medicine, Aarhus Univ. Hospital-Skejby, Brendstrupgaardsvej, DK-8200 Aarhus N, Denmark (e-mail: jf{at}ki.au.dk)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Anand-Srivastava MB, Palaparti A, Pion J. Differential regulation of G-protein expression by vasoactive peptides. Mol Cell Biochem 176: 21–27, 1997.[Medline]
  2. Bar HP. Measurement of adenyl cyclase and cyclic AMP. Methods Pharmacol 3: 593–611, 1975.
  3. Birnbaumer M, Seibold A, Gilbert S, Ishido M, Barberis C, Antaramian A, Brabet P, Rosenthal W. Molecular cloning of the receptor for human antidiuretic hormone. Nature 357: 333–335, 1992.[CrossRef][Medline]
  4. Breyer MD, Breyer RM. Prostaglandin E receptors and the kidney. Am J Physiol Renal Physiol 279: F12–F23, 2000.[Abstract/Free Full Text]
  5. Christensen BM, Zelenina M, Aperia A, Nielsen S. Localization and regulation of PKA-phosphorylated AQP2 in response to V2-receptor agonist/antagonist treatment. Am J Physiol Renal Physiol 278: F29–F42, 2000.[Abstract/Free Full Text]
  6. Dessauer CW, Scully TT, Gilman AG. Interactions of forskolin and ATP with the cytosolic domains of mammalian adenylyl cyclase. J Biol Chem 272: 22272–22277, 1997.[Abstract/Free Full Text]
  7. Fenton RA, Brond L, Nielsen S, Praetorius J. Cellular and subcellular distribution of the type-2 vasopressin receptor in the kidney. Am J Physiol Renal Physiol 293: F748–F760, 2007.[Abstract/Free Full Text]
  8. Frøkiær J, Knudsen L, Nielsen AS, Pedersen EB, Djurhuus JC. Enhanced intrarenal angiotensin II generation in response to obstruction of the pig ureter. Am J Physiol Renal Fluid Electrolyte Physiol 263: F527–F533, 1992.[Abstract/Free Full Text]
  9. Frøkiær J, Marples D, Knepper MA, Nielsen S. Bilateral ureteral obstruction downregulates expression of vasopressin-sensitive AQP-2 water channel in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 270: F657–F668, 1996.[Abstract/Free Full Text]
  10. Frøkiær J, Sorensen SS. Eicosanoid excretion from the contralateral kidney in pigs with complete unilateral ureteral obstruction. J Urol 154: 1205–1209, 1995.[Medline]
  11. Ge C, Garcia R, Anand-Srivastava MB. Altered expression of Gi-protein and adenylyl cyclase activity in hearts from one kidney one clip hypertensive rats: effect of captopril. J Hypertens 17: 1617–1626, 1999.[Web of Science][Medline]
  12. Gimenez I, Forbush B. Short-term stimulation of the renal Na-K-Cl cotransporter (NKCC2) by vasopressin involves phosphorylation and membrane translocation of the protein. J Biol Chem 278: 26946–26951, 2003.[Abstract/Free Full Text]
  13. Harris PJ, Young JA. Dose-dependent stimulation and inhibition of proximal tubular sodium reabsorption by angiotensin II in the rat kidney. Pflügers Arch 367: 295–297, 1977.[CrossRef][Web of Science][Medline]
  14. Hebert RL, Jacobson HR, Fredin D, Breyer MD. Evidence that separate PGE2 receptors modulate water and sodium transport in rabbit cortical collecting duct. Am J Physiol Renal Fluid Electrolyte Physiol 265: F643–F650, 1993.[Abstract/Free Full Text]
  15. Hebert SC, Culpepper RM, Andreoli TE. NaCl transport in mouse medullary thick ascending limbs. I. Functional nephron heterogeneity and ADH-stimulated NaCl cotransport. Am J Physiol Renal Fluid Electrolyte Physiol 241: F412–F431, 1981.[Abstract/Free Full Text]
  16. Horita S, Zheng Y, Hara C, Yamada H, Kunimi M, Taniguchi S, Uwatoko S, Sugaya T, Goto A, Fujita T, Seki G. Biphasic regulation of Na+-HCO3– cotransporter by angiotensin II type 1A receptor. Hypertension 40: 707–712, 2002.[Abstract/Free Full Text]
  17. Jensen AM, Li C, Praetorius HA, Nørregaard R, Frische S, Knepper MA, Nielsen S, Frøkiær J. Angiotensin II mediates downregulation of aquaporin water channels and key renal sodium transporters in response to urinary tract obstruction. Am J Physiol Renal Physiol 291: F1021–F1032, 2006.[Abstract/Free Full Text]
  18. Kim GH, Ecelbarger CA, Mitchell C, Packer RK, Wade JB, Knepper MA. Vasopressin increases Na-K-2Cl cotransporter expression in thick ascending limb of Henle's loop. Am J Physiol Renal Physiol 276: F96–F103, 1999.[Abstract/Free Full Text]
  19. Kim SW, Cho SH, Oh BS, Yeum CH, Choi KC, Ahn KY, Lee J. Diminished renal expression of aquaporin water channels in rats with experimental bilateral ureteral obstruction. J Am Soc Nephrol 12: 2019–2028, 2001.[Abstract/Free Full Text]
  20. Kim SW, Jeon YS, Lee JU, Kang DG, Kook H, Ahn KY, Kim SZ, Cho KW, Kim NH, Han JS, Choi KC. Diminished adenylate cyclase activity and aquaporin 2 expression in acute renal failure rats. Kidney Int 57: 1643–1650, 2000.[CrossRef][Web of Science][Medline]
  21. Knepper MA, Inoue T. Regulation of aquaporin-2 water channel trafficking by vasopressin. Curr Opin Cell Biol 9: 560–564, 1997.[CrossRef][Web of Science][Medline]
  22. Kook H, Rhee JH, Lee SE, Kang SY, Chung SS, Cho KW, Baik YH. Activation of particulate guanylyl cyclase by Vibrio vulnificus hemolysin. Eur J Pharmacol 365: 267–272, 1999.[CrossRef][Web of Science][Medline]
  23. Kwon TH, Nielsen J, Kim YH, Knepper MA, Frøkiær J, Nielsen S. Regulation of sodium transporters in the thick ascending limb of rat kidney: response to angiotensin II. Am J Physiol Renal Physiol 285: F152–F165, 2003.[Abstract/Free Full Text]
  24. Kwon TH, Nielsen J, Knepper MA, Frøkiær J, Nielsen S. Angiotensin II AT1 receptor blockade decreases vasopressin-induced water reabsorption and AQP2 levels in NaCl-restricted rats. Am J Physiol Renal Physiol 288: F673–F684, 2005.[Abstract/Free Full Text]
  25. Lee YJ, Song IK, Jang KJ, Nielsen J, Frøkiær J, Nielsen S, Kwon TH. Increased AQP2 targeting in primary cultured IMCD cells in response to angiotensin II through AT1 receptor. Am J Physiol Renal Physiol 292: F340–F350, 2007.[Abstract/Free Full Text]
  26. Li C, Wang W, Knepper MA, Nielsen S, Frøkiær J. Downregulation of renal aquaporins in response to unilateral ureteral obstruction. Am J Physiol Renal Physiol 284: F1066–F1079, 2003.[Abstract/Free Full Text]
  27. Li C, Wang W, Kwon TH, Isikay L, Wen JG, Marples D, Djurhuus JC, Stockwell A, Knepper MA, Nielsen S, Frøkiær J. Downregulation of AQP1, -2, and -3 after ureteral obstruction is associated with a long-term urine-concentrating defect. Am J Physiol Renal Physiol 281: F163–F171, 2001.[Abstract/Free Full Text]
  28. Li C, Wang W, Kwon TH, Knepper MA, Nielsen S, Frøkiær J. Altered expression of major renal Na transporters in rats with bilateral ureteral obstruction and release of obstruction. Am J Physiol Renal Physiol 285: F889–F901, 2003.[Abstract/Free Full Text]
  29. Lolait SJ, O'Carroll AM, McBride OW, Konig M, Morel A, Brownstein MJ. Cloning and characterization of a vasopressin V2 receptor and possible link to nephrogenic diabetes insipidus. Nature 357: 336–339, 1992.[CrossRef][Medline]
  30. Machida K, Wakamatsu S, Izumi Y, Yosifovska T, Matsuzaki T, Nakayama Y, Kohda Y, Inoue T, Saito H, Tomita K, Nonoguchi H. Downregulation of the V2 vasopressin receptor in dehydration: mechanisms and role of renal prostaglandin synthesis. Am J Physiol Renal Physiol 292: F1274–F1282, 2007.[Abstract/Free Full Text]
  31. Nørregaard R, Jensen BL, Li C, Wang W, Knepper MA, Nielsen S, Frøkiær J. COX-2 inhibition prevents downregulation of key renal water and sodium transport proteins in response to bilateral ureteral obstruction. Am J Physiol Renal Physiol 289: F322–F333, 2005.[Abstract/Free Full Text]
  32. Nørregaard R, Jensen BL, Topcu SO, Diget M, Schweer H, Knepper MA, Nielsen S, Frøkiær J. COX-2 activity transiently contributes to increased water and NaCl excretion in the polyuric phase after release of ureteral obstruction. Am J Physiol Renal Physiol 292: F1322–F1333, 2007.[Abstract/Free Full Text]
  33. Okegawa T, Jonas PE, DeSchryver K, Kawasaki A, Needleman P. Metabolic and cellular alterations underlying the exaggerated renal prostaglandin and thromboxane synthesis in ureter obstruction in rabbits. Inflammatory response involving fibroblasts and mononuclear cells. J Clin Invest 71: 81–90, 1983.[Web of Science][Medline]
  34. Palaparti A, Ge C, Anand-Srivastava MB. Angiotensin II enhances the expression of Gi{alpha} in A10 cells (smooth muscle): relationship with adenylyl cyclase activity. Arch Biochem Biophys 365: 113–122, 1999.[CrossRef][Web of Science][Medline]
  35. Pandey SK, Anand-Srivastava MB. Modulation of G-protein expression by the angiotensin converting enzyme inhibitor captopril in hearts from spontaneously hypertensive rats. Relationship with adenylyl cyclase. Am J Hypertens 9: 833–837, 1996.[CrossRef][Web of Science][Medline]
  36. Park F, Koike G, Cowley AW Jr. Regional time-dependent changes in vasopressin V2 receptor expression in the rat kidney during water restriction. Am J Physiol Renal Physiol 274: F906–F913, 1998.[Abstract/Free Full Text]
  37. Pimentel JL Jr, Montero A, Wang S, Yosipiv I, el-Dahr S, Martinez-Maldonado M. Sequential changes in renal expression of renin-angiotensin system genes in acute unilateral ureteral obstruction. Kidney Int 48: 1247–1253, 1995.[Web of Science][Medline]
  38. Reilly AM, Harris PJ, Williams DA. Biphasic effect of angiotensin II on intracellular sodium concentration in rat proximal tubules. Am J Physiol Renal Fluid Electrolyte Physiol 269: F374–F380, 1995.[Abstract/Free Full Text]
  39. Sonnenberg H, Wilson DR. The role of the medullary collecting ducts in postobstructive diuresis. J Clin Invest 57: 1564–1574, 1976.[Web of Science][Medline]
  40. Sonnenburg WK, Smith WL. Regulation of cyclic AMP metabolism in rabbit cortical collecting tubule cells by prostaglandins. J Biol Chem 263: 6155–6160, 1988.[Abstract/Free Full Text]
  41. Steiner M, Phillips MI. Renal tubular vasopressin receptors downregulated by dehydration. Am J Physiol Cell Physiol 254: C404–C410, 1988.[Abstract/Free Full Text]
  42. Sternweis PC, Gilman AG. Aluminum: a requirement for activation of the regulatory component of adenylate cyclase by fluoride. Proc Natl Acad Sci USA 79: 4888–4891, 1982.[Abstract/Free Full Text]
  43. Stow JL, Sabolic I, Brown D. Heterogeneous localization of G protein {alpha}-subunits in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 261: F831–F840, 1991.[Abstract/Free Full Text]
  44. Sunahara RK, Dessauer CW, Gilman AG. Complexity and diversity of mammalian adenylyl cyclases. Annu Rev Pharmacol Toxicol 36: 461–480, 1996.[CrossRef][Web of Science][Medline]
  45. Vyas SJ, Blaschak CM, Chinoy MR, Jackson EK. Angiotensin II-induced changes in G-protein expression and resistance of renal microvessels in young genetically hypertensive rats. Mol Cell Biochem 212: 121–129, 2000.[CrossRef][Web of Science][Medline]
  46. Wilson B, Reisman DD, Moyer CA. Fluid balance in the urological patient: disturbances in the renal regulation of the excretion of water and sodium salts following decompression of the urinary bladder. J Urol 66: 805–815, 1951.[Medline]
  47. Wong NL, Tsui JK. Upregulation of vasopressin V2 and aquaporin 2 in the inner medullary collecting duct of cardiomyopathic hamsters is attenuated by enalapril treatment. Metabolism 51: 970–975, 2002.[Medline]
  48. Wong NL, Tsui JK. Angiotensin II upregulates the expression of vasopressin V2 mRNA in the inner medullary collecting duct of the rat. Metabolism 52: 290–295, 2003.[CrossRef][Web of Science][Medline]
  49. Yarger WE, Aynedjian HS, Bank N. A micropuncture study of postobstructive diuresis in the rat. J Clin Invest 51: 625–637, 1972.[Web of Science][Medline]
  50. Yarger WE, Schocken DD, Harris RH. Obstructive nephropathy in the rat: possible roles for the renin-angiotensin system, prostaglandins, and thromboxanes in postobstructive renal function. J Clin Invest 65: 400–412, 1980.[Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
296/1/F127    most recent
90479.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jensen, A. M.
Right arrow Articles by Frøkiær, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jensen, A. M.
Right arrow Articles by Frøkiær, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2009 by the American Physiological Society.